Review



mammalian cell expression vector psectag2b  (Thermo Fisher)


Bioz Verified Symbol Thermo Fisher is a verified supplier
Bioz Manufacturer Symbol Thermo Fisher manufactures this product  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 86

    Structured Review

    Thermo Fisher mammalian cell expression vector psectag2b
    Mammalian Cell Expression Vector Psectag2b, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/psectag2b+expression+vector/us10000554-300-37-42
    Average 86 stars, based on 1 article reviews
    mammalian cell expression vector psectag2b - by Bioz Stars, 2026-10
    86/100 stars

    Images

    Related Articles

    Clone Assay:

    Article Title: Potential Regulation of ARID1A by miR-129-5p and miR-3613-3p and Their Prognostic Value in Gastric Cancer.
    Article Snippet: .. To ectopically express miR-129-5p and miR-3613-3p in cancer cell line SNU-1, HCT116, MCF-7, SKBR3, 769-P and A549, their DNA sequences were cloned into expression plasmids pSecTag2B (Invitrogen) by using standard genetic engineering techniques [72]. .. A full-length cDNA of miRNAs miR-129-5p (GGATCTTTTTGCGGTCTGGGCTTGCTGTTCCTCTCAACAGTAGTCAGGAAGCCCTTACCCCAAAAAGTATCT) and miR-3613-3p (TGGTTGGGTTTGGATTGTTGTACTTTTTTTTTTGTTCGTTGCATTTTTAGGAACAAAAA AAAAAGCCCAACCCTTCACACCACTTCA) were amplified using the Phusion DNA Polymerase (Thermo Scientific) with a pair of target-specific PCR primers (Table 8) containing the CciNI and NotI restriction sites (shown in italics).

    Article Title: CRISPR-Cas13d for CHO Cell Engineering and Antibody Production
    Article Snippet: .. Plasmid construction The Cas13d gene, CasRx from Ruminococcus flavefaciens strain XPD3002, and its upstream EF1α promoter were cloned from pXR001 (Addgene) and subcloned into pUSEamp(+) (Merck Millipore) usingPac I/Nhe I. Zeocin resistance gene (ZeoR)-BGH poly A sequence was amplified from pSecTag2b (Thermo Fisher) and ligated with a self-cleavable 2A sequence derived from porcine teschovirus-1 (P2A) to form the P2AZeoR-polyA fragment. ..

    Article Title: Influence of hyaluronic acid binding on the actin cortex measured by optical forces.
    Article Snippet: Cells were treated with 0.25 μM Latrunculin-A (Sigma-Aldrich) for 6 h or 10 μM blebbistatin (Sigma-Aldrich) for 30 min prior to stretcher measurements. .. Generation of stably transfected cells: The cDNA coding for CD44s was cloned into a pSecTag2B vector (Invitrogen). .. Wild type (WT) RPM-MC cells (Cd44-negative) were transfected with Lipofectamin 2000 (Invitrogen) according to the manufacturer’s protocol and cultured in the presence of 200 μg/ml zeocin (InvivoGen) as selection reagent.

    Article Title: Progranulin inhibits phospholipase sPLA2-IIA to control neuroinflammation
    Article Snippet: Mouse Pla2g2a -Myc-DDK construct was obtained from Origene (m-sPLA2-IIA-myc). .. Mouse PGRN construct was cloned into pSecTag2B vector (Invitrogen) with an N-terminal FLAG-His tag (Flag-mPGRN). ..

    Article Title: Potential Regulation of ARID1A by miR-129-5p and miR-3613-3p and Their Prognostic Value in Gastric Cancer
    Article Snippet: .. To ectopically express miR-129-5p and miR-3613-3p in cancer cell line SNU-1, HCT116, MCF-7, SKBR3, 769-P and A549, their DNA sequences were cloned into expression plasmids pSecTag2B (Invitrogen) by using standard genetic engineering techniques [ ]. .. A full-length cDNA of miRNAs miR-129-5p (GGATCTTTTTGCGGTCTGGGCTTGCTGTTCCTCTCAACAGTAGTCAGGAAGCCCTTACCCCAAAAAGTATCT) and miR-3613-3p (TGGTTGGGTTTGGATTGTTGTACTTTTTTTTTTGTTCGTTGCATTTTTAGGAACAAAAAAAAAAGCCCAACCCTTCACACCACTTCA) were amplified using the Phusion DNA Polymerase (Thermo Scientific) with a pair of target-specific PCR primers ( ) containing the CciNI and NotI restriction sites (shown in italics).

    Expressing:

    Article Title: Potential Regulation of ARID1A by miR-129-5p and miR-3613-3p and Their Prognostic Value in Gastric Cancer.
    Article Snippet: .. To ectopically express miR-129-5p and miR-3613-3p in cancer cell line SNU-1, HCT116, MCF-7, SKBR3, 769-P and A549, their DNA sequences were cloned into expression plasmids pSecTag2B (Invitrogen) by using standard genetic engineering techniques [72]. .. A full-length cDNA of miRNAs miR-129-5p (GGATCTTTTTGCGGTCTGGGCTTGCTGTTCCTCTCAACAGTAGTCAGGAAGCCCTTACCCCAAAAAGTATCT) and miR-3613-3p (TGGTTGGGTTTGGATTGTTGTACTTTTTTTTTTGTTCGTTGCATTTTTAGGAACAAAAA AAAAAGCCCAACCCTTCACACCACTTCA) were amplified using the Phusion DNA Polymerase (Thermo Scientific) with a pair of target-specific PCR primers (Table 8) containing the CciNI and NotI restriction sites (shown in italics).

    Article Title: Potential Regulation of ARID1A by miR-129-5p and miR-3613-3p and Their Prognostic Value in Gastric Cancer
    Article Snippet: .. To ectopically express miR-129-5p and miR-3613-3p in cancer cell line SNU-1, HCT116, MCF-7, SKBR3, 769-P and A549, their DNA sequences were cloned into expression plasmids pSecTag2B (Invitrogen) by using standard genetic engineering techniques [ ]. .. A full-length cDNA of miRNAs miR-129-5p (GGATCTTTTTGCGGTCTGGGCTTGCTGTTCCTCTCAACAGTAGTCAGGAAGCCCTTACCCCAAAAAGTATCT) and miR-3613-3p (TGGTTGGGTTTGGATTGTTGTACTTTTTTTTTTGTTCGTTGCATTTTTAGGAACAAAAAAAAAAGCCCAACCCTTCACACCACTTCA) were amplified using the Phusion DNA Polymerase (Thermo Scientific) with a pair of target-specific PCR primers ( ) containing the CciNI and NotI restriction sites (shown in italics).

    other:

    Article Title: The Interaction between Factor H and Von Willebrand Factor
    Article Snippet: ADAMTS-13 cDNA was cloned into pSecTag2B His-tag vector (Invitrogen) at the HindIII and XbaI sites, and transfected into HEK 293 cells (Invitrogen) with Lipofectamine 2000 (Invitrogen).

    Plasmid Preparation:

    Article Title: CRISPR-Cas13d for CHO Cell Engineering and Antibody Production
    Article Snippet: .. Plasmid construction The Cas13d gene, CasRx from Ruminococcus flavefaciens strain XPD3002, and its upstream EF1α promoter were cloned from pXR001 (Addgene) and subcloned into pUSEamp(+) (Merck Millipore) usingPac I/Nhe I. Zeocin resistance gene (ZeoR)-BGH poly A sequence was amplified from pSecTag2b (Thermo Fisher) and ligated with a self-cleavable 2A sequence derived from porcine teschovirus-1 (P2A) to form the P2AZeoR-polyA fragment. ..

    Article Title: Influence of hyaluronic acid binding on the actin cortex measured by optical forces.
    Article Snippet: Cells were treated with 0.25 μM Latrunculin-A (Sigma-Aldrich) for 6 h or 10 μM blebbistatin (Sigma-Aldrich) for 30 min prior to stretcher measurements. .. Generation of stably transfected cells: The cDNA coding for CD44s was cloned into a pSecTag2B vector (Invitrogen). .. Wild type (WT) RPM-MC cells (Cd44-negative) were transfected with Lipofectamin 2000 (Invitrogen) according to the manufacturer’s protocol and cultured in the presence of 200 μg/ml zeocin (InvivoGen) as selection reagent.

    Article Title: Progranulin inhibits phospholipase sPLA2-IIA to control neuroinflammation
    Article Snippet: Mouse Pla2g2a -Myc-DDK construct was obtained from Origene (m-sPLA2-IIA-myc). .. Mouse PGRN construct was cloned into pSecTag2B vector (Invitrogen) with an N-terminal FLAG-His tag (Flag-mPGRN). ..

    Article Title: The Heterotrimeric Laminin Coiled-Coil Domain Exerts Anti-Adhesive Effects and Induces a Pro-Invasive Phenotype
    Article Snippet: .. A 2207 bp HindIII/NotI fragment derived from the plasmid pCR2.1-tα1 was introduced into the HindIII/NotI site of pSECTAG2B (Invitrogen Life Technologies) resulting in pSECTAG2B.tα1 vector. .. An oligo pair (primers 7 and 8) containing the FLAG-tag sequence (DYKDDDDK) was ligated into the NotI/XbaI site of pcDNA3.1/Hygro (+) (Invitrogen Life Technologies), resulting in pcDNA3.1/Hygro.FLAG.

    Sequencing:

    Article Title: CRISPR-Cas13d for CHO Cell Engineering and Antibody Production
    Article Snippet: .. Plasmid construction The Cas13d gene, CasRx from Ruminococcus flavefaciens strain XPD3002, and its upstream EF1α promoter were cloned from pXR001 (Addgene) and subcloned into pUSEamp(+) (Merck Millipore) usingPac I/Nhe I. Zeocin resistance gene (ZeoR)-BGH poly A sequence was amplified from pSecTag2b (Thermo Fisher) and ligated with a self-cleavable 2A sequence derived from porcine teschovirus-1 (P2A) to form the P2AZeoR-polyA fragment. ..

    Article Title: Secreted Neutrophil Gelatinase-Associated Lipocalin Shows Stronger Ability to Inhibit Cyst Enlargement of ADPKD Cells Compared with Nonsecreted Form
    Article Snippet: Optical sections of cysts were reconstructed into Z-stack or 3D video using ZEISS ZEN microscope software. .. The mouse NGAL sequence (534 bp) was inserted into the pSecTag2B vector (Invitrogen, Carlsbad, CA, USA) in frame and downstream of a murine Igκ-chain leader sequence to overexpress the secreted NGAL protein. ..

    Amplification:

    Article Title: CRISPR-Cas13d for CHO Cell Engineering and Antibody Production
    Article Snippet: .. Plasmid construction The Cas13d gene, CasRx from Ruminococcus flavefaciens strain XPD3002, and its upstream EF1α promoter were cloned from pXR001 (Addgene) and subcloned into pUSEamp(+) (Merck Millipore) usingPac I/Nhe I. Zeocin resistance gene (ZeoR)-BGH poly A sequence was amplified from pSecTag2b (Thermo Fisher) and ligated with a self-cleavable 2A sequence derived from porcine teschovirus-1 (P2A) to form the P2AZeoR-polyA fragment. ..

    Derivative Assay:

    Article Title: CRISPR-Cas13d for CHO Cell Engineering and Antibody Production
    Article Snippet: .. Plasmid construction The Cas13d gene, CasRx from Ruminococcus flavefaciens strain XPD3002, and its upstream EF1α promoter were cloned from pXR001 (Addgene) and subcloned into pUSEamp(+) (Merck Millipore) usingPac I/Nhe I. Zeocin resistance gene (ZeoR)-BGH poly A sequence was amplified from pSecTag2b (Thermo Fisher) and ligated with a self-cleavable 2A sequence derived from porcine teschovirus-1 (P2A) to form the P2AZeoR-polyA fragment. ..

    Article Title: The Heterotrimeric Laminin Coiled-Coil Domain Exerts Anti-Adhesive Effects and Induces a Pro-Invasive Phenotype
    Article Snippet: .. A 2207 bp HindIII/NotI fragment derived from the plasmid pCR2.1-tα1 was introduced into the HindIII/NotI site of pSECTAG2B (Invitrogen Life Technologies) resulting in pSECTAG2B.tα1 vector. .. An oligo pair (primers 7 and 8) containing the FLAG-tag sequence (DYKDDDDK) was ligated into the NotI/XbaI site of pcDNA3.1/Hygro (+) (Invitrogen Life Technologies), resulting in pcDNA3.1/Hygro.FLAG.

    Stable Transfection:

    Article Title: Influence of hyaluronic acid binding on the actin cortex measured by optical forces.
    Article Snippet: Cells were treated with 0.25 μM Latrunculin-A (Sigma-Aldrich) for 6 h or 10 μM blebbistatin (Sigma-Aldrich) for 30 min prior to stretcher measurements. .. Generation of stably transfected cells: The cDNA coding for CD44s was cloned into a pSecTag2B vector (Invitrogen). .. Wild type (WT) RPM-MC cells (Cd44-negative) were transfected with Lipofectamin 2000 (Invitrogen) according to the manufacturer’s protocol and cultured in the presence of 200 μg/ml zeocin (InvivoGen) as selection reagent.

    Transfection:

    Article Title: Influence of hyaluronic acid binding on the actin cortex measured by optical forces.
    Article Snippet: Cells were treated with 0.25 μM Latrunculin-A (Sigma-Aldrich) for 6 h or 10 μM blebbistatin (Sigma-Aldrich) for 30 min prior to stretcher measurements. .. Generation of stably transfected cells: The cDNA coding for CD44s was cloned into a pSecTag2B vector (Invitrogen). .. Wild type (WT) RPM-MC cells (Cd44-negative) were transfected with Lipofectamin 2000 (Invitrogen) according to the manufacturer’s protocol and cultured in the presence of 200 μg/ml zeocin (InvivoGen) as selection reagent.

    Construct:

    Article Title: Progranulin inhibits phospholipase sPLA2-IIA to control neuroinflammation
    Article Snippet: Mouse Pla2g2a -Myc-DDK construct was obtained from Origene (m-sPLA2-IIA-myc). .. Mouse PGRN construct was cloned into pSecTag2B vector (Invitrogen) with an N-terminal FLAG-His tag (Flag-mPGRN). ..



    Similar Products

    86
    Thermo Fisher eukaryotic expression vector psectag2b
    Eukaryotic Expression Vector Psectag2b, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/psectag2b+expression+vector/pm37752138-83-4-8
    Average 86 stars, based on 1 article reviews
    eukaryotic expression vector psectag2b - by Bioz Stars, 2026-10
    86/100 stars
      Buy from Supplier

    86
    Thermo Fisher psectag2b expression vector
    Psectag2b Expression Vector, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/psectag2b+expression+vector/pm36652482-237-7-11
    Average 86 stars, based on 1 article reviews
    psectag2b expression vector - by Bioz Stars, 2026-10
    86/100 stars
      Buy from Supplier

    86
    Thermo Fisher mammalian cell expression vector psectag2b
    Mammalian Cell Expression Vector Psectag2b, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/psectag2b+expression+vector/us10000554-300-37-42
    Average 86 stars, based on 1 article reviews
    mammalian cell expression vector psectag2b - by Bioz Stars, 2026-10
    86/100 stars
      Buy from Supplier

    90
    Thermo Fisher psectag2b mammalian expression vector
    Psectag2b Mammalian Expression Vector, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/psectag2b+expression+vector/pm27222007-52-9-13
    Average 90 stars, based on 1 article reviews
    psectag2b mammalian expression vector - by Bioz Stars, 2026-10
    90/100 stars
      Buy from Supplier

    90
    Thermo Fisher expression vector psectag2b
    Expression Vector Psectag2b, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/psectag2b+expression+vector/us08110369-924-11-14
    Average 90 stars, based on 1 article reviews
    expression vector psectag2b - by Bioz Stars, 2026-10
    90/100 stars
      Buy from Supplier

    Image Search Results