nebnext poly a mrna magnetic isolation module (New England Biolabs)
New England Biolabs is a verified supplier 
New England Biolabs manufactures this product 
99
Structured Review
New England Biolabs
nebnext poly a mrna magnetic isolation module
Nebnext Poly A Mrna Magnetic Isolation Module, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 99/100, based on 6773 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/module/NEBNext+Poly(A)+mRNA+Magnetic+Isolation+Module/pm42869908-473-4-4
Average 99 stars, based on 6773 article reviews
Nebnext Poly A Mrna Magnetic Isolation Module, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 99/100, based on 6773 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/module/NEBNext+Poly(A)+mRNA+Magnetic+Isolation+Module/pm42869908-473-4-4
Average 99 stars, based on 6773 article reviews
nebnext poly a mrna magnetic isolation module - by Bioz Stars,
2026-10
99/100 stars
Images
Related Articles
Isolation:Article Title: Carbohydrate-active enzyme architectures reflect distinct fungal and bacterial strategies for lignocellulose conversion to volatile fatty acids. Article Snippet: For bacterial metatranscriptomes, rRNA was depleted using the NEBNext rRNA Depletion Kit (New England Biolabs, MA, USA). .. For fungal metatranscriptomes, enrichment of mRNA and separation from rRNA was achieved using the Article Title: Reciprocal coupling between EMT and BMP morphogen signalling drives collective cell invasion. Article Snippet: .. Polyadenylated mRNA was enriched from 1 μg of total RNA using the Article Title: Transcriptomic analysis of zebrafish ( Danio rerio ) liver exposed to sediments from the Loa River Article Snippet: Library preparation for sequencing was performed using the NEBNext Ultra II RNA Library Prep Kit for Illumina (New England Biolabs NEB, cat. no E7770S, United States). .. This process included mRNA isolation using Article Title: Active transcriptome remodeling underlies antimony-induced drug tolerance in persister-like Leishmania parasites. Article Snippet: Isolated RNA sample quality was assessed by High Sensitivity RNA Tapestation (Agilent Technologies Inc., California, USA) and quantified by AccuBlue Broad Range RNA Quantitation assay (Biotium, California, USA). .. Paramagnetic beads coupled with oligo d(T)25 were combined with total RNA to isolate poly(A)+ transcripts based on Article Title: CG14075/Mmt promotes amino acid catabolism and cooperates with AKH during starvation in Drosophila. Article Snippet: RNA was extracted from ten CC-containing neuronal ganglia and wholebody samples using TRIzol (Thermo Fisher Scientific). .. RNA was purified by Article Title: Developmental contexts of gene-regulatory evolution following whole genome duplication in salmonids. Article Snippet: RNA-seq library preparations were performed by Novogene using total RNA samples described above from both species (Supplementary Tables 1 and 2). .. In all cases, the NEBNext Ultra Directional RNA Library Prep for Illumina kit (no. E7420S/L) was used with the Article Title: The NFIL3-MYC signaling axis: a novel therapeutic target and prognostic marker in high-risk multiple myeloma Article Snippet: RNA sequencing (RNAseq) analyses of MM.1S cells were performed after GSI XII (5 μM) or DMSO treatment for 24 h or NOTCH1 knockdown using two different specific shRNAs (shN1 #1, target sequence: GAACGAGCATAGTCCAAAAA; shN1 #2, target sequence: GTAGTTGTTCGTTGGTTATA) cloned into the pLKO.1-puro vector (Addgene, Watertown, MA, USA) at the AgeI and EcoRI restriction sites, versus empty vector (EV). .. Total RNA was extracted with the RNeasy Plus Mini kit (Qiagen, Hilden, Germany) and mRNA was isolated using the Selection:Article Title: Transcriptomic analysis of zebrafish ( Danio rerio ) liver exposed to sediments from the Loa River Article Snippet: Library preparation for sequencing was performed using the NEBNext Ultra II RNA Library Prep Kit for Illumina (New England Biolabs NEB, cat. no E7770S, United States). .. This process included mRNA isolation using Magnetic Beads:Article Title: Transcriptomic analysis of zebrafish ( Danio rerio ) liver exposed to sediments from the Loa River Article Snippet: Library preparation for sequencing was performed using the NEBNext Ultra II RNA Library Prep Kit for Illumina (New England Biolabs NEB, cat. no E7770S, United States). .. This process included mRNA isolation using Sequencing:Article Title: Transcriptomic analysis of zebrafish ( Danio rerio ) liver exposed to sediments from the Loa River Article Snippet: Library preparation for sequencing was performed using the NEBNext Ultra II RNA Library Prep Kit for Illumina (New England Biolabs NEB, cat. no E7770S, United States). .. This process included mRNA isolation using Purification:Article Title: CG14075/Mmt promotes amino acid catabolism and cooperates with AKH during starvation in Drosophila. Article Snippet: RNA was extracted from ten CC-containing neuronal ganglia and wholebody samples using TRIzol (Thermo Fisher Scientific). .. RNA was purified by other:Article Title: 4-Phenylbutyric acid activates an NF-κB-Egr-1 axis to control myoblast proliferation and ECM gene expression. Article Snippet: 0001641439) Nichirei Biosciences Cat #: 173012-500ML Glycine Nacalai tesque Cat #: 17109-35 Hanks’ Balanced Salt Solution/HBSS Nacalai Tesque Cat #: 17461-05 HCl FUJIFILM Wako Pure Chemical Corporation Cat #: 084-05425 Horse serum (HS) GIBCO Cat #:26050088 Immobilon Western Chemiluminescent HRP Substrate Cytiva Cat #: RPN2235 Lipofectamine RNAiMAX transfection reagent Invitrogen Cat #: 13778075 Hilymax Dojindo Cat #: H357 M-PER Mammalian Protein Extraction Reagent Thermo Fisher Cat #: 78501 Matrigel Corning Cat #: 354234 NaCl FUJIFILM Wako Pure Chemical Corporation Cat #: 191-01665 Paraformaldehyde (37% PFA, for crosslinking) FUJIFILM Wako Pure Chemical Corporation Cat #: 063-04815 Paraformaldehyde (4% PFA) FUJIFILM Wako Pure Chemical Corporation Cat #:163-20145 Penicillin-Streptomycin Mixed Solution Nacalai tesque Cat #: 26253-84 Phosphatase Inhibitor Cocktail Solution II(×100) FUJIFILM Wako Pure Chemical Corporation Cat #: 160-24371 Phosphate-buffered saline (PBS, pH 7.4) Nacalai tesque Cat #: 14249-24 ProLong Glass Antifade Mountant Thermo Fisher Cat #: P36965 Protein A Mag Sepharose Cytiva Cat #: 28944006 PicoLab Rodent Diet 20 LabDiet Cat #: 5053 Red Blood Cell (RBC) Lysis Buffer/RCK buffer BioLegend Cat #: 420301 Sample Buffer Solution with Reducing Reagent(6×) for SDS-PAGE pH6.8 Nacalai tesque Cat #: 09499-14 Sodium Dodecyl Sulfate FUJIFILM Wako Pure Chemical Corporation Cat #: 199-07141 Tauroursodeoxycholic Acid (TUDCA) Selleck Biotech Cat #: S3654 Triton X-100 Sigma-Aldrich Cat #: 9002-93-1 Trypsin-EDTA (0.25%) Nacalai tesque Cat #: 35554-64 Tunicamycin Cayman Chemical Cat #: 11445 Tween 20 Sigma-Aldrich Cat #: P9416-100ML Silencer Select Mouse Hdac5 siRNA (Assay ID s67423) Invitrogen Cat #: 4390771 Silencer Select Mouse Egr-1 siRNA (Assay ID s65378) Invitrogen Cat #: 4390771 Silencer Select Negative Control No. 1 siRNA Invitrogen Cat #: 4390843 Critical commercial assays Agilent 4200 TapeStation D1000 assay Agilent Cat #: D1000 CellTiter 96 AQueous One Solution Cell Proliferation Assay (MTS) Promega Cat #: G3582 ISOSPIN Cell & Tissue RNA kit Nippon Gene Cat #: 314-08211 JC-1 MitoMP Detection Kit Dojindo Cat #: MT09 Maxwell RSC Simply RNA Cell Kit Promega Cat #: AS1390 (Continued on next page) iScience 29, 117620, October 16, 2026 17 Multiplex Assay:Article Title: Developmental contexts of gene-regulatory evolution following whole genome duplication in salmonids. Article Snippet: RNA-seq library preparations were performed by Novogene using total RNA samples described above from both species (Supplementary Tables 1 and 2). .. In all cases, the NEBNext Ultra Directional RNA Library Prep for Illumina kit (no. E7420S/L) was used with the |
