module Search Results


94
R&D Systems mouse ifn γ elispot development module
The protein expression and immune responses of the human tNOX recombinant proteins in mice. Recombinant human tNOX was expressed in E. coli and purified with His-tag purification resin. A. The expressed, purified and dialyzed proteins were resolved by SDS-PAGE and detected by western blot analysis with anti-His tag and anti-tNOX antibodies, and are shown in Lanes 1, 2 and 3, respectively. The molecular weight (KDa) marker (M) is shown at the left. Arrow indicates the tNOX protein band. B. Blood samples were collected at 0, 14, 28 and 35 days after the first vaccination and antibody titers were measured by ELISA. The specific anti-tNOX antibody response was significantly higher in the tNOX vaccine group compared with unvaccinated controls (*P < 0.05). C. Splenocytes of mice were stimulated with human tNOX protein and IFN-γ-secreting T cells were evaluated by <t>ELISpot</t> assay. Representative images show proliferative spots of splenocytes from mice vaccinated with tNOX (tNOX) or without tNOX (NC). D. The frequencies of tNOX-specific IFN-γ-secreting T cells was significantly higher in the tNOX vaccine group compared to the NC group (*P < 0.05). The average spot counts of the NC and tNOX vaccine groups were 67 ± 13 and 155 ± 42, respectively.
Mouse Ifn γ Elispot Development Module, supplied by R&D Systems, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/mouse ifn γ elispot development module/product/R&D Systems
Average 94 stars, based on 1 article reviews
mouse ifn γ elispot development module - by Bioz Stars, 2026-04
94/100 stars
  Buy from Supplier

98
AutoMate Scientific Inc sonalert module
The protein expression and immune responses of the human tNOX recombinant proteins in mice. Recombinant human tNOX was expressed in E. coli and purified with His-tag purification resin. A. The expressed, purified and dialyzed proteins were resolved by SDS-PAGE and detected by western blot analysis with anti-His tag and anti-tNOX antibodies, and are shown in Lanes 1, 2 and 3, respectively. The molecular weight (KDa) marker (M) is shown at the left. Arrow indicates the tNOX protein band. B. Blood samples were collected at 0, 14, 28 and 35 days after the first vaccination and antibody titers were measured by ELISA. The specific anti-tNOX antibody response was significantly higher in the tNOX vaccine group compared with unvaccinated controls (*P < 0.05). C. Splenocytes of mice were stimulated with human tNOX protein and IFN-γ-secreting T cells were evaluated by <t>ELISpot</t> assay. Representative images show proliferative spots of splenocytes from mice vaccinated with tNOX (tNOX) or without tNOX (NC). D. The frequencies of tNOX-specific IFN-γ-secreting T cells was significantly higher in the tNOX vaccine group compared to the NC group (*P < 0.05). The average spot counts of the NC and tNOX vaccine groups were 67 ± 13 and 155 ± 42, respectively.
Sonalert Module, supplied by AutoMate Scientific Inc, used in various techniques. Bioz Stars score: 98/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/sonalert module/product/AutoMate Scientific Inc
Average 98 stars, based on 1 article reviews
sonalert module - by Bioz Stars, 2026-04
98/100 stars
  Buy from Supplier

94
R&D Systems alkaline phosphatase conjugated streptavidin
The protein expression and immune responses of the human tNOX recombinant proteins in mice. Recombinant human tNOX was expressed in E. coli and purified with His-tag purification resin. A. The expressed, purified and dialyzed proteins were resolved by SDS-PAGE and detected by western blot analysis with anti-His tag and anti-tNOX antibodies, and are shown in Lanes 1, 2 and 3, respectively. The molecular weight (KDa) marker (M) is shown at the left. Arrow indicates the tNOX protein band. B. Blood samples were collected at 0, 14, 28 and 35 days after the first vaccination and antibody titers were measured by ELISA. The specific anti-tNOX antibody response was significantly higher in the tNOX vaccine group compared with unvaccinated controls (*P < 0.05). C. Splenocytes of mice were stimulated with human tNOX protein and IFN-γ-secreting T cells were evaluated by <t>ELISpot</t> assay. Representative images show proliferative spots of splenocytes from mice vaccinated with tNOX (tNOX) or without tNOX (NC). D. The frequencies of tNOX-specific IFN-γ-secreting T cells was significantly higher in the tNOX vaccine group compared to the NC group (*P < 0.05). The average spot counts of the NC and tNOX vaccine groups were 67 ± 13 and 155 ± 42, respectively.
Alkaline Phosphatase Conjugated Streptavidin, supplied by R&D Systems, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/alkaline phosphatase conjugated streptavidin/product/R&D Systems
Average 94 stars, based on 1 article reviews
alkaline phosphatase conjugated streptavidin - by Bioz Stars, 2026-04
94/100 stars
  Buy from Supplier

97
New England Biolabs module
The protein expression and immune responses of the human tNOX recombinant proteins in mice. Recombinant human tNOX was expressed in E. coli and purified with His-tag purification resin. A. The expressed, purified and dialyzed proteins were resolved by SDS-PAGE and detected by western blot analysis with anti-His tag and anti-tNOX antibodies, and are shown in Lanes 1, 2 and 3, respectively. The molecular weight (KDa) marker (M) is shown at the left. Arrow indicates the tNOX protein band. B. Blood samples were collected at 0, 14, 28 and 35 days after the first vaccination and antibody titers were measured by ELISA. The specific anti-tNOX antibody response was significantly higher in the tNOX vaccine group compared with unvaccinated controls (*P < 0.05). C. Splenocytes of mice were stimulated with human tNOX protein and IFN-γ-secreting T cells were evaluated by <t>ELISpot</t> assay. Representative images show proliferative spots of splenocytes from mice vaccinated with tNOX (tNOX) or without tNOX (NC). D. The frequencies of tNOX-specific IFN-γ-secreting T cells was significantly higher in the tNOX vaccine group compared to the NC group (*P < 0.05). The average spot counts of the NC and tNOX vaccine groups were 67 ± 13 and 155 ± 42, respectively.
Module, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 97/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/module/product/New England Biolabs
Average 97 stars, based on 1 article reviews
module - by Bioz Stars, 2026-04
97/100 stars
  Buy from Supplier

99
New England Biolabs nebnext poly a mrna magnetic isolation module
Inhibition of PABPC1 expression reduces EBOV replication. HeLa cells were mock-transfected (reagent only) or transfected with two distinct PABPC1 siRNAs or nontargeting AllStars negative control siRNAs. At 48 h post-transfection, cells were infected with EBOV at an MOI of 0.1. A.) At 16 hpi, samples were inactivated in 10% neutral-buffered formalin and RNAFISH was performed using probes detecting (+) sense NP and VP35 RNA (magenta). Nuclei were visualized by staining with Hoechst (blue). Scale bar = 250 μM. B.) Quantification of NP and VP35 RNA staining in panel A was performed in ImageJ by calculating the area occupied by <t>mRNA</t> signal and normalizing it to the area occupied by Hoechst (nuclei) signal. C.) In a parallel set of samples, total RNA was isolated by lysing the cells with Trizol reagent at 16 hours post infection. NP RNA levels were quantified by one-step RT-qPCR using a (+) sense NP probe to detect EBOV RNA and are normalized to the level of β-Actin RNA. D) Depletion of PABPC1 in siRNA-treated cells. A parallel set of samples were subjected to SDS-PAGE followed by western blotting with PABPC1 and actin antibodies. Molecular weight markers in kDa are shown at left.
Nebnext Poly A Mrna Magnetic Isolation Module, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/nebnext poly a mrna magnetic isolation module/product/New England Biolabs
Average 99 stars, based on 1 article reviews
nebnext poly a mrna magnetic isolation module - by Bioz Stars, 2026-04
99/100 stars
  Buy from Supplier

96
New England Biolabs nebnext ultra ii ligation module
Inhibition of PABPC1 expression reduces EBOV replication. HeLa cells were mock-transfected (reagent only) or transfected with two distinct PABPC1 siRNAs or nontargeting AllStars negative control siRNAs. At 48 h post-transfection, cells were infected with EBOV at an MOI of 0.1. A.) At 16 hpi, samples were inactivated in 10% neutral-buffered formalin and RNAFISH was performed using probes detecting (+) sense NP and VP35 RNA (magenta). Nuclei were visualized by staining with Hoechst (blue). Scale bar = 250 μM. B.) Quantification of NP and VP35 RNA staining in panel A was performed in ImageJ by calculating the area occupied by <t>mRNA</t> signal and normalizing it to the area occupied by Hoechst (nuclei) signal. C.) In a parallel set of samples, total RNA was isolated by lysing the cells with Trizol reagent at 16 hours post infection. NP RNA levels were quantified by one-step RT-qPCR using a (+) sense NP probe to detect EBOV RNA and are normalized to the level of β-Actin RNA. D) Depletion of PABPC1 in siRNA-treated cells. A parallel set of samples were subjected to SDS-PAGE followed by western blotting with PABPC1 and actin antibodies. Molecular weight markers in kDa are shown at left.
Nebnext Ultra Ii Ligation Module, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/nebnext ultra ii ligation module/product/New England Biolabs
Average 96 stars, based on 1 article reviews
nebnext ultra ii ligation module - by Bioz Stars, 2026-04
96/100 stars
  Buy from Supplier

97
AutoMate Scientific Inc grid floors
Inhibition of PABPC1 expression reduces EBOV replication. HeLa cells were mock-transfected (reagent only) or transfected with two distinct PABPC1 siRNAs or nontargeting AllStars negative control siRNAs. At 48 h post-transfection, cells were infected with EBOV at an MOI of 0.1. A.) At 16 hpi, samples were inactivated in 10% neutral-buffered formalin and RNAFISH was performed using probes detecting (+) sense NP and VP35 RNA (magenta). Nuclei were visualized by staining with Hoechst (blue). Scale bar = 250 μM. B.) Quantification of NP and VP35 RNA staining in panel A was performed in ImageJ by calculating the area occupied by <t>mRNA</t> signal and normalizing it to the area occupied by Hoechst (nuclei) signal. C.) In a parallel set of samples, total RNA was isolated by lysing the cells with Trizol reagent at 16 hours post infection. NP RNA levels were quantified by one-step RT-qPCR using a (+) sense NP probe to detect EBOV RNA and are normalized to the level of β-Actin RNA. D) Depletion of PABPC1 in siRNA-treated cells. A parallel set of samples were subjected to SDS-PAGE followed by western blotting with PABPC1 and actin antibodies. Molecular weight markers in kDa are shown at left.
Grid Floors, supplied by AutoMate Scientific Inc, used in various techniques. Bioz Stars score: 97/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/grid floors/product/AutoMate Scientific Inc
Average 97 stars, based on 1 article reviews
grid floors - by Bioz Stars, 2026-04
97/100 stars
  Buy from Supplier

96
New England Biolabs nebnext companion module reagents
Inhibition of PABPC1 expression reduces EBOV replication. HeLa cells were mock-transfected (reagent only) or transfected with two distinct PABPC1 siRNAs or nontargeting AllStars negative control siRNAs. At 48 h post-transfection, cells were infected with EBOV at an MOI of 0.1. A.) At 16 hpi, samples were inactivated in 10% neutral-buffered formalin and RNAFISH was performed using probes detecting (+) sense NP and VP35 RNA (magenta). Nuclei were visualized by staining with Hoechst (blue). Scale bar = 250 μM. B.) Quantification of NP and VP35 RNA staining in panel A was performed in ImageJ by calculating the area occupied by <t>mRNA</t> signal and normalizing it to the area occupied by Hoechst (nuclei) signal. C.) In a parallel set of samples, total RNA was isolated by lysing the cells with Trizol reagent at 16 hours post infection. NP RNA levels were quantified by one-step RT-qPCR using a (+) sense NP probe to detect EBOV RNA and are normalized to the level of β-Actin RNA. D) Depletion of PABPC1 in siRNA-treated cells. A parallel set of samples were subjected to SDS-PAGE followed by western blotting with PABPC1 and actin antibodies. Molecular weight markers in kDa are shown at left.
Nebnext Companion Module Reagents, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/nebnext companion module reagents/product/New England Biolabs
Average 96 stars, based on 1 article reviews
nebnext companion module reagents - by Bioz Stars, 2026-04
96/100 stars
  Buy from Supplier

93
R&D Systems mouse granzyme b elispot development module
Inhibition of PABPC1 expression reduces EBOV replication. HeLa cells were mock-transfected (reagent only) or transfected with two distinct PABPC1 siRNAs or nontargeting AllStars negative control siRNAs. At 48 h post-transfection, cells were infected with EBOV at an MOI of 0.1. A.) At 16 hpi, samples were inactivated in 10% neutral-buffered formalin and RNAFISH was performed using probes detecting (+) sense NP and VP35 RNA (magenta). Nuclei were visualized by staining with Hoechst (blue). Scale bar = 250 μM. B.) Quantification of NP and VP35 RNA staining in panel A was performed in ImageJ by calculating the area occupied by <t>mRNA</t> signal and normalizing it to the area occupied by Hoechst (nuclei) signal. C.) In a parallel set of samples, total RNA was isolated by lysing the cells with Trizol reagent at 16 hours post infection. NP RNA levels were quantified by one-step RT-qPCR using a (+) sense NP probe to detect EBOV RNA and are normalized to the level of β-Actin RNA. D) Depletion of PABPC1 in siRNA-treated cells. A parallel set of samples were subjected to SDS-PAGE followed by western blotting with PABPC1 and actin antibodies. Molecular weight markers in kDa are shown at left.
Mouse Granzyme B Elispot Development Module, supplied by R&D Systems, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/mouse granzyme b elispot development module/product/R&D Systems
Average 93 stars, based on 1 article reviews
mouse granzyme b elispot development module - by Bioz Stars, 2026-04
93/100 stars
  Buy from Supplier

96
New England Biolabs nebnext ultra directional rna second strand synthesis modules
Inhibition of PABPC1 expression reduces EBOV replication. HeLa cells were mock-transfected (reagent only) or transfected with two distinct PABPC1 siRNAs or nontargeting AllStars negative control siRNAs. At 48 h post-transfection, cells were infected with EBOV at an MOI of 0.1. A.) At 16 hpi, samples were inactivated in 10% neutral-buffered formalin and RNAFISH was performed using probes detecting (+) sense NP and VP35 RNA (magenta). Nuclei were visualized by staining with Hoechst (blue). Scale bar = 250 μM. B.) Quantification of NP and VP35 RNA staining in panel A was performed in ImageJ by calculating the area occupied by <t>mRNA</t> signal and normalizing it to the area occupied by Hoechst (nuclei) signal. C.) In a parallel set of samples, total RNA was isolated by lysing the cells with Trizol reagent at 16 hours post infection. NP RNA levels were quantified by one-step RT-qPCR using a (+) sense NP probe to detect EBOV RNA and are normalized to the level of β-Actin RNA. D) Depletion of PABPC1 in siRNA-treated cells. A parallel set of samples were subjected to SDS-PAGE followed by western blotting with PABPC1 and actin antibodies. Molecular weight markers in kDa are shown at left.
Nebnext Ultra Directional Rna Second Strand Synthesis Modules, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/nebnext ultra directional rna second strand synthesis modules/product/New England Biolabs
Average 96 stars, based on 1 article reviews
nebnext ultra directional rna second strand synthesis modules - by Bioz Stars, 2026-04
96/100 stars
  Buy from Supplier

95
New England Biolabs nebnext ultra ii fs dna module kit
Inhibition of PABPC1 expression reduces EBOV replication. HeLa cells were mock-transfected (reagent only) or transfected with two distinct PABPC1 siRNAs or nontargeting AllStars negative control siRNAs. At 48 h post-transfection, cells were infected with EBOV at an MOI of 0.1. A.) At 16 hpi, samples were inactivated in 10% neutral-buffered formalin and RNAFISH was performed using probes detecting (+) sense NP and VP35 RNA (magenta). Nuclei were visualized by staining with Hoechst (blue). Scale bar = 250 μM. B.) Quantification of NP and VP35 RNA staining in panel A was performed in ImageJ by calculating the area occupied by <t>mRNA</t> signal and normalizing it to the area occupied by Hoechst (nuclei) signal. C.) In a parallel set of samples, total RNA was isolated by lysing the cells with Trizol reagent at 16 hours post infection. NP RNA levels were quantified by one-step RT-qPCR using a (+) sense NP probe to detect EBOV RNA and are normalized to the level of β-Actin RNA. D) Depletion of PABPC1 in siRNA-treated cells. A parallel set of samples were subjected to SDS-PAGE followed by western blotting with PABPC1 and actin antibodies. Molecular weight markers in kDa are shown at left.
Nebnext Ultra Ii Fs Dna Module Kit, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 95/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/nebnext ultra ii fs dna module kit/product/New England Biolabs
Average 95 stars, based on 1 article reviews
nebnext ultra ii fs dna module kit - by Bioz Stars, 2026-04
95/100 stars
  Buy from Supplier

Image Search Results


The protein expression and immune responses of the human tNOX recombinant proteins in mice. Recombinant human tNOX was expressed in E. coli and purified with His-tag purification resin. A. The expressed, purified and dialyzed proteins were resolved by SDS-PAGE and detected by western blot analysis with anti-His tag and anti-tNOX antibodies, and are shown in Lanes 1, 2 and 3, respectively. The molecular weight (KDa) marker (M) is shown at the left. Arrow indicates the tNOX protein band. B. Blood samples were collected at 0, 14, 28 and 35 days after the first vaccination and antibody titers were measured by ELISA. The specific anti-tNOX antibody response was significantly higher in the tNOX vaccine group compared with unvaccinated controls (*P < 0.05). C. Splenocytes of mice were stimulated with human tNOX protein and IFN-γ-secreting T cells were evaluated by ELISpot assay. Representative images show proliferative spots of splenocytes from mice vaccinated with tNOX (tNOX) or without tNOX (NC). D. The frequencies of tNOX-specific IFN-γ-secreting T cells was significantly higher in the tNOX vaccine group compared to the NC group (*P < 0.05). The average spot counts of the NC and tNOX vaccine groups were 67 ± 13 and 155 ± 42, respectively.

Journal: American Journal of Cancer Research

Article Title: Immune response evoked by tumor-associated NADH oxidase (tNOX) confers potential inhibitory effect on lung carcinoma in a mouse model

doi:

Figure Lengend Snippet: The protein expression and immune responses of the human tNOX recombinant proteins in mice. Recombinant human tNOX was expressed in E. coli and purified with His-tag purification resin. A. The expressed, purified and dialyzed proteins were resolved by SDS-PAGE and detected by western blot analysis with anti-His tag and anti-tNOX antibodies, and are shown in Lanes 1, 2 and 3, respectively. The molecular weight (KDa) marker (M) is shown at the left. Arrow indicates the tNOX protein band. B. Blood samples were collected at 0, 14, 28 and 35 days after the first vaccination and antibody titers were measured by ELISA. The specific anti-tNOX antibody response was significantly higher in the tNOX vaccine group compared with unvaccinated controls (*P < 0.05). C. Splenocytes of mice were stimulated with human tNOX protein and IFN-γ-secreting T cells were evaluated by ELISpot assay. Representative images show proliferative spots of splenocytes from mice vaccinated with tNOX (tNOX) or without tNOX (NC). D. The frequencies of tNOX-specific IFN-γ-secreting T cells was significantly higher in the tNOX vaccine group compared to the NC group (*P < 0.05). The average spot counts of the NC and tNOX vaccine groups were 67 ± 13 and 155 ± 42, respectively.

Article Snippet: ELISpot assays were performed using a Mouse IFN-γ ELISpot Development Module (R&D Systems, Inc., Minneapolis, MN, USA) according to the manufacturer’s protocol.

Techniques: Expressing, Recombinant, Purification, SDS Page, Western Blot, Molecular Weight, Marker, Enzyme-linked Immunosorbent Assay, Enzyme-linked Immunospot

Inhibition of PABPC1 expression reduces EBOV replication. HeLa cells were mock-transfected (reagent only) or transfected with two distinct PABPC1 siRNAs or nontargeting AllStars negative control siRNAs. At 48 h post-transfection, cells were infected with EBOV at an MOI of 0.1. A.) At 16 hpi, samples were inactivated in 10% neutral-buffered formalin and RNAFISH was performed using probes detecting (+) sense NP and VP35 RNA (magenta). Nuclei were visualized by staining with Hoechst (blue). Scale bar = 250 μM. B.) Quantification of NP and VP35 RNA staining in panel A was performed in ImageJ by calculating the area occupied by mRNA signal and normalizing it to the area occupied by Hoechst (nuclei) signal. C.) In a parallel set of samples, total RNA was isolated by lysing the cells with Trizol reagent at 16 hours post infection. NP RNA levels were quantified by one-step RT-qPCR using a (+) sense NP probe to detect EBOV RNA and are normalized to the level of β-Actin RNA. D) Depletion of PABPC1 in siRNA-treated cells. A parallel set of samples were subjected to SDS-PAGE followed by western blotting with PABPC1 and actin antibodies. Molecular weight markers in kDa are shown at left.

Journal: bioRxiv

Article Title: A Yeast Two-Hybrid Protein Domain Screening Approach for Ebola Virus-Human Protein Interactions Identifies PABPC1 as a Host Factor Required for Replication

doi: 10.64898/2026.03.05.709814

Figure Lengend Snippet: Inhibition of PABPC1 expression reduces EBOV replication. HeLa cells were mock-transfected (reagent only) or transfected with two distinct PABPC1 siRNAs or nontargeting AllStars negative control siRNAs. At 48 h post-transfection, cells were infected with EBOV at an MOI of 0.1. A.) At 16 hpi, samples were inactivated in 10% neutral-buffered formalin and RNAFISH was performed using probes detecting (+) sense NP and VP35 RNA (magenta). Nuclei were visualized by staining with Hoechst (blue). Scale bar = 250 μM. B.) Quantification of NP and VP35 RNA staining in panel A was performed in ImageJ by calculating the area occupied by mRNA signal and normalizing it to the area occupied by Hoechst (nuclei) signal. C.) In a parallel set of samples, total RNA was isolated by lysing the cells with Trizol reagent at 16 hours post infection. NP RNA levels were quantified by one-step RT-qPCR using a (+) sense NP probe to detect EBOV RNA and are normalized to the level of β-Actin RNA. D) Depletion of PABPC1 in siRNA-treated cells. A parallel set of samples were subjected to SDS-PAGE followed by western blotting with PABPC1 and actin antibodies. Molecular weight markers in kDa are shown at left.

Article Snippet: Unidirectional cDNA was prepared from 1 μg of total RNA using the NEBNext® UltraTM Directional RNA Library Prep Kit for Illumina following the “Protocol for use with NEBNext Poly(A) mRNA Magnetic Isolation Module (NEB #E7490)” through step 1.7 (Manual Version 5.0 5/15) with the following changes: 1) poly(A)+ mRNA was eluted for 5 minutes at 65 °C to prevent fragmentation; 2) after synthesizing second strand cDNA, the cDNA was purified using a Zymo Research DNA Clean & Concentrator-5 column (#D4013); 3) the adaptor primer (/5Phos/GATCGGAAGAGCTTGTTCTACCGAGGGACCC/ideoxyU/ ACTACTGCCTAAC GAACTCCCGCTCTTCCGATC*T; * indicates a phosphorothioate bond; synthesized and PAGE purified by IDT) was a modification of the NEBNext Adaptor for Illumina (E7352A).

Techniques: Inhibition, Expressing, Transfection, Negative Control, Infection, Staining, Isolation, Quantitative RT-PCR, SDS Page, Western Blot, Molecular Weight