module Search Results


nebnext companion module  (New England Biolabs)
96
New England Biolabs nebnext companion module
Nebnext Companion Module, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/nebnext companion module/product/New England Biolabs
Average 96 stars, based on 1 article reviews
nebnext companion module - by Bioz Stars, 2026-05
96/100 stars
  Buy from Supplier
nebnext quick ligation module  (New England Biolabs)
98
New England Biolabs nebnext quick ligation module
Nebnext Quick Ligation Module, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 98/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/nebnext quick ligation module/product/New England Biolabs
Average 98 stars, based on 1 article reviews
nebnext quick ligation module - by Bioz Stars, 2026-05
98/100 stars
  Buy from Supplier
nebnext ultra ii fs module  (New England Biolabs)
96
New England Biolabs nebnext ultra ii fs module
Nebnext Ultra Ii Fs Module, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/nebnext ultra ii fs module/product/New England Biolabs
Average 96 stars, based on 1 article reviews
nebnext ultra ii fs module - by Bioz Stars, 2026-05
96/100 stars
  Buy from Supplier
module  (New England Biolabs)
96
New England Biolabs module
Module, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/module/product/New England Biolabs
Average 96 stars, based on 1 article reviews
module - by Bioz Stars, 2026-05
96/100 stars
  Buy from Supplier
nebnext poly a mrna magnetic isolation module  (New England Biolabs)
99
New England Biolabs nebnext poly a mrna magnetic isolation module
Inhibition of PABPC1 expression reduces EBOV replication. HeLa cells were mock-transfected (reagent only) or transfected with two distinct PABPC1 siRNAs or nontargeting AllStars negative control siRNAs. At 48 h post-transfection, cells were infected with EBOV at an MOI of 0.1. A.) At 16 hpi, samples were inactivated in 10% neutral-buffered formalin and RNAFISH was performed using probes detecting (+) sense NP and VP35 RNA (magenta). Nuclei were visualized by staining with Hoechst (blue). Scale bar = 250 μM. B.) Quantification of NP and VP35 RNA staining in panel A was performed in ImageJ by calculating the area occupied by <t>mRNA</t> signal and normalizing it to the area occupied by Hoechst (nuclei) signal. C.) In a parallel set of samples, total RNA was isolated by lysing the cells with Trizol reagent at 16 hours post infection. NP RNA levels were quantified by one-step RT-qPCR using a (+) sense NP probe to detect EBOV RNA and are normalized to the level of β-Actin RNA. D) Depletion of PABPC1 in siRNA-treated cells. A parallel set of samples were subjected to SDS-PAGE followed by western blotting with PABPC1 and actin antibodies. Molecular weight markers in kDa are shown at left.
Nebnext Poly A Mrna Magnetic Isolation Module, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/nebnext poly a mrna magnetic isolation module/product/New England Biolabs
Average 99 stars, based on 1 article reviews
nebnext poly a mrna magnetic isolation module - by Bioz Stars, 2026-05
99/100 stars
  Buy from Supplier
q sense flow module  (Biolin Scientific)
94
Biolin Scientific q sense flow module
Inhibition of PABPC1 expression reduces EBOV replication. HeLa cells were mock-transfected (reagent only) or transfected with two distinct PABPC1 siRNAs or nontargeting AllStars negative control siRNAs. At 48 h post-transfection, cells were infected with EBOV at an MOI of 0.1. A.) At 16 hpi, samples were inactivated in 10% neutral-buffered formalin and RNAFISH was performed using probes detecting (+) sense NP and VP35 RNA (magenta). Nuclei were visualized by staining with Hoechst (blue). Scale bar = 250 μM. B.) Quantification of NP and VP35 RNA staining in panel A was performed in ImageJ by calculating the area occupied by <t>mRNA</t> signal and normalizing it to the area occupied by Hoechst (nuclei) signal. C.) In a parallel set of samples, total RNA was isolated by lysing the cells with Trizol reagent at 16 hours post infection. NP RNA levels were quantified by one-step RT-qPCR using a (+) sense NP probe to detect EBOV RNA and are normalized to the level of β-Actin RNA. D) Depletion of PABPC1 in siRNA-treated cells. A parallel set of samples were subjected to SDS-PAGE followed by western blotting with PABPC1 and actin antibodies. Molecular weight markers in kDa are shown at left.
Q Sense Flow Module, supplied by Biolin Scientific, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/q sense flow module/product/Biolin Scientific
Average 94 stars, based on 1 article reviews
q sense flow module - by Bioz Stars, 2026-05
94/100 stars
  Buy from Supplier
ram ii ft raman module  (Bruker Corporation)
94
Bruker Corporation ram ii ft raman module
Inhibition of PABPC1 expression reduces EBOV replication. HeLa cells were mock-transfected (reagent only) or transfected with two distinct PABPC1 siRNAs or nontargeting AllStars negative control siRNAs. At 48 h post-transfection, cells were infected with EBOV at an MOI of 0.1. A.) At 16 hpi, samples were inactivated in 10% neutral-buffered formalin and RNAFISH was performed using probes detecting (+) sense NP and VP35 RNA (magenta). Nuclei were visualized by staining with Hoechst (blue). Scale bar = 250 μM. B.) Quantification of NP and VP35 RNA staining in panel A was performed in ImageJ by calculating the area occupied by <t>mRNA</t> signal and normalizing it to the area occupied by Hoechst (nuclei) signal. C.) In a parallel set of samples, total RNA was isolated by lysing the cells with Trizol reagent at 16 hours post infection. NP RNA levels were quantified by one-step RT-qPCR using a (+) sense NP probe to detect EBOV RNA and are normalized to the level of β-Actin RNA. D) Depletion of PABPC1 in siRNA-treated cells. A parallel set of samples were subjected to SDS-PAGE followed by western blotting with PABPC1 and actin antibodies. Molecular weight markers in kDa are shown at left.
Ram Ii Ft Raman Module, supplied by Bruker Corporation, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/ram ii ft raman module/product/Bruker Corporation
Average 94 stars, based on 1 article reviews
ram ii ft raman module - by Bioz Stars, 2026-05
94/100 stars
  Buy from Supplier
nucleic acid detection module  (Bio-Rad)
94
Bio-Rad nucleic acid detection module
Inhibition of PABPC1 expression reduces EBOV replication. HeLa cells were mock-transfected (reagent only) or transfected with two distinct PABPC1 siRNAs or nontargeting AllStars negative control siRNAs. At 48 h post-transfection, cells were infected with EBOV at an MOI of 0.1. A.) At 16 hpi, samples were inactivated in 10% neutral-buffered formalin and RNAFISH was performed using probes detecting (+) sense NP and VP35 RNA (magenta). Nuclei were visualized by staining with Hoechst (blue). Scale bar = 250 μM. B.) Quantification of NP and VP35 RNA staining in panel A was performed in ImageJ by calculating the area occupied by <t>mRNA</t> signal and normalizing it to the area occupied by Hoechst (nuclei) signal. C.) In a parallel set of samples, total RNA was isolated by lysing the cells with Trizol reagent at 16 hours post infection. NP RNA levels were quantified by one-step RT-qPCR using a (+) sense NP probe to detect EBOV RNA and are normalized to the level of β-Actin RNA. D) Depletion of PABPC1 in siRNA-treated cells. A parallel set of samples were subjected to SDS-PAGE followed by western blotting with PABPC1 and actin antibodies. Molecular weight markers in kDa are shown at left.
Nucleic Acid Detection Module, supplied by Bio-Rad, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/nucleic acid detection module/product/Bio-Rad
Average 94 stars, based on 1 article reviews
nucleic acid detection module - by Bioz Stars, 2026-05
94/100 stars
  Buy from Supplier
c1000 touchtm deep well thermal cycler  (Bio-Rad)
97
Bio-Rad c1000 touchtm deep well thermal cycler
Inhibition of PABPC1 expression reduces EBOV replication. HeLa cells were mock-transfected (reagent only) or transfected with two distinct PABPC1 siRNAs or nontargeting AllStars negative control siRNAs. At 48 h post-transfection, cells were infected with EBOV at an MOI of 0.1. A.) At 16 hpi, samples were inactivated in 10% neutral-buffered formalin and RNAFISH was performed using probes detecting (+) sense NP and VP35 RNA (magenta). Nuclei were visualized by staining with Hoechst (blue). Scale bar = 250 μM. B.) Quantification of NP and VP35 RNA staining in panel A was performed in ImageJ by calculating the area occupied by <t>mRNA</t> signal and normalizing it to the area occupied by Hoechst (nuclei) signal. C.) In a parallel set of samples, total RNA was isolated by lysing the cells with Trizol reagent at 16 hours post infection. NP RNA levels were quantified by one-step RT-qPCR using a (+) sense NP probe to detect EBOV RNA and are normalized to the level of β-Actin RNA. D) Depletion of PABPC1 in siRNA-treated cells. A parallel set of samples were subjected to SDS-PAGE followed by western blotting with PABPC1 and actin antibodies. Molecular weight markers in kDa are shown at left.
C1000 Touchtm Deep Well Thermal Cycler, supplied by Bio-Rad, used in various techniques. Bioz Stars score: 97/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/c1000 touchtm deep well thermal cycler/product/Bio-Rad
Average 97 stars, based on 1 article reviews
c1000 touchtm deep well thermal cycler - by Bioz Stars, 2026-05
97/100 stars
  Buy from Supplier
c1000 touch thermocycler  (Bio-Rad)
96
Bio-Rad c1000 touch thermocycler
Inhibition of PABPC1 expression reduces EBOV replication. HeLa cells were mock-transfected (reagent only) or transfected with two distinct PABPC1 siRNAs or nontargeting AllStars negative control siRNAs. At 48 h post-transfection, cells were infected with EBOV at an MOI of 0.1. A.) At 16 hpi, samples were inactivated in 10% neutral-buffered formalin and RNAFISH was performed using probes detecting (+) sense NP and VP35 RNA (magenta). Nuclei were visualized by staining with Hoechst (blue). Scale bar = 250 μM. B.) Quantification of NP and VP35 RNA staining in panel A was performed in ImageJ by calculating the area occupied by <t>mRNA</t> signal and normalizing it to the area occupied by Hoechst (nuclei) signal. C.) In a parallel set of samples, total RNA was isolated by lysing the cells with Trizol reagent at 16 hours post infection. NP RNA levels were quantified by one-step RT-qPCR using a (+) sense NP probe to detect EBOV RNA and are normalized to the level of β-Actin RNA. D) Depletion of PABPC1 in siRNA-treated cells. A parallel set of samples were subjected to SDS-PAGE followed by western blotting with PABPC1 and actin antibodies. Molecular weight markers in kDa are shown at left.
C1000 Touch Thermocycler, supplied by Bio-Rad, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/c1000 touch thermocycler/product/Bio-Rad
Average 96 stars, based on 1 article reviews
c1000 touch thermocycler - by Bioz Stars, 2026-05
96/100 stars
  Buy from Supplier
pvdf membranes  (Bio-Rad)
93
Bio-Rad pvdf membranes
Inhibition of PABPC1 expression reduces EBOV replication. HeLa cells were mock-transfected (reagent only) or transfected with two distinct PABPC1 siRNAs or nontargeting AllStars negative control siRNAs. At 48 h post-transfection, cells were infected with EBOV at an MOI of 0.1. A.) At 16 hpi, samples were inactivated in 10% neutral-buffered formalin and RNAFISH was performed using probes detecting (+) sense NP and VP35 RNA (magenta). Nuclei were visualized by staining with Hoechst (blue). Scale bar = 250 μM. B.) Quantification of NP and VP35 RNA staining in panel A was performed in ImageJ by calculating the area occupied by <t>mRNA</t> signal and normalizing it to the area occupied by Hoechst (nuclei) signal. C.) In a parallel set of samples, total RNA was isolated by lysing the cells with Trizol reagent at 16 hours post infection. NP RNA levels were quantified by one-step RT-qPCR using a (+) sense NP probe to detect EBOV RNA and are normalized to the level of β-Actin RNA. D) Depletion of PABPC1 in siRNA-treated cells. A parallel set of samples were subjected to SDS-PAGE followed by western blotting with PABPC1 and actin antibodies. Molecular weight markers in kDa are shown at left.
Pvdf Membranes, supplied by Bio-Rad, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/pvdf membranes/product/Bio-Rad
Average 93 stars, based on 1 article reviews
pvdf membranes - by Bioz Stars, 2026-05
93/100 stars
  Buy from Supplier
clampfit module  (Danaher Inc)
96
Danaher Inc clampfit module
Inhibition of PABPC1 expression reduces EBOV replication. HeLa cells were mock-transfected (reagent only) or transfected with two distinct PABPC1 siRNAs or nontargeting AllStars negative control siRNAs. At 48 h post-transfection, cells were infected with EBOV at an MOI of 0.1. A.) At 16 hpi, samples were inactivated in 10% neutral-buffered formalin and RNAFISH was performed using probes detecting (+) sense NP and VP35 RNA (magenta). Nuclei were visualized by staining with Hoechst (blue). Scale bar = 250 μM. B.) Quantification of NP and VP35 RNA staining in panel A was performed in ImageJ by calculating the area occupied by <t>mRNA</t> signal and normalizing it to the area occupied by Hoechst (nuclei) signal. C.) In a parallel set of samples, total RNA was isolated by lysing the cells with Trizol reagent at 16 hours post infection. NP RNA levels were quantified by one-step RT-qPCR using a (+) sense NP probe to detect EBOV RNA and are normalized to the level of β-Actin RNA. D) Depletion of PABPC1 in siRNA-treated cells. A parallel set of samples were subjected to SDS-PAGE followed by western blotting with PABPC1 and actin antibodies. Molecular weight markers in kDa are shown at left.
Clampfit Module, supplied by Danaher Inc, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/clampfit module/product/Danaher Inc
Average 96 stars, based on 1 article reviews
clampfit module - by Bioz Stars, 2026-05
96/100 stars
  Buy from Supplier

Image Search Results


Inhibition of PABPC1 expression reduces EBOV replication. HeLa cells were mock-transfected (reagent only) or transfected with two distinct PABPC1 siRNAs or nontargeting AllStars negative control siRNAs. At 48 h post-transfection, cells were infected with EBOV at an MOI of 0.1. A.) At 16 hpi, samples were inactivated in 10% neutral-buffered formalin and RNAFISH was performed using probes detecting (+) sense NP and VP35 RNA (magenta). Nuclei were visualized by staining with Hoechst (blue). Scale bar = 250 μM. B.) Quantification of NP and VP35 RNA staining in panel A was performed in ImageJ by calculating the area occupied by mRNA signal and normalizing it to the area occupied by Hoechst (nuclei) signal. C.) In a parallel set of samples, total RNA was isolated by lysing the cells with Trizol reagent at 16 hours post infection. NP RNA levels were quantified by one-step RT-qPCR using a (+) sense NP probe to detect EBOV RNA and are normalized to the level of β-Actin RNA. D) Depletion of PABPC1 in siRNA-treated cells. A parallel set of samples were subjected to SDS-PAGE followed by western blotting with PABPC1 and actin antibodies. Molecular weight markers in kDa are shown at left.

Journal: bioRxiv

Article Title: A Yeast Two-Hybrid Protein Domain Screening Approach for Ebola Virus-Human Protein Interactions Identifies PABPC1 as a Host Factor Required for Replication

doi: 10.64898/2026.03.05.709814

Figure Lengend Snippet: Inhibition of PABPC1 expression reduces EBOV replication. HeLa cells were mock-transfected (reagent only) or transfected with two distinct PABPC1 siRNAs or nontargeting AllStars negative control siRNAs. At 48 h post-transfection, cells were infected with EBOV at an MOI of 0.1. A.) At 16 hpi, samples were inactivated in 10% neutral-buffered formalin and RNAFISH was performed using probes detecting (+) sense NP and VP35 RNA (magenta). Nuclei were visualized by staining with Hoechst (blue). Scale bar = 250 μM. B.) Quantification of NP and VP35 RNA staining in panel A was performed in ImageJ by calculating the area occupied by mRNA signal and normalizing it to the area occupied by Hoechst (nuclei) signal. C.) In a parallel set of samples, total RNA was isolated by lysing the cells with Trizol reagent at 16 hours post infection. NP RNA levels were quantified by one-step RT-qPCR using a (+) sense NP probe to detect EBOV RNA and are normalized to the level of β-Actin RNA. D) Depletion of PABPC1 in siRNA-treated cells. A parallel set of samples were subjected to SDS-PAGE followed by western blotting with PABPC1 and actin antibodies. Molecular weight markers in kDa are shown at left.

Article Snippet: Unidirectional cDNA was prepared from 1 μg of total RNA using the NEBNext® UltraTM Directional RNA Library Prep Kit for Illumina following the “Protocol for use with NEBNext Poly(A) mRNA Magnetic Isolation Module (NEB #E7490)” through step 1.7 (Manual Version 5.0 5/15) with the following changes: 1) poly(A)+ mRNA was eluted for 5 minutes at 65 °C to prevent fragmentation; 2) after synthesizing second strand cDNA, the cDNA was purified using a Zymo Research DNA Clean & Concentrator-5 column (#D4013); 3) the adaptor primer (/5Phos/GATCGGAAGAGCTTGTTCTACCGAGGGACCC/ideoxyU/ ACTACTGCCTAAC GAACTCCCGCTCTTCCGATC*T; * indicates a phosphorothioate bond; synthesized and PAGE purified by IDT) was a modification of the NEBNext Adaptor for Illumina (E7352A).

Techniques: Inhibition, Expressing, Transfection, Negative Control, Infection, Staining, Isolation, Quantitative RT-PCR, SDS Page, Western Blot, Molecular Weight