universal primer mix (TaKaRa)

TaKaRa is a verified supplier

TaKaRa manufactures this product

About

News

Press Release

Team

Advisors

Partners

Contact

Bioz Stars

Bioz vStars

Buy from Supplier

Structured Review

TaKaRa universal primer mix
Universal Primer Mix, supplied by TaKaRa, used in various techniques. Bioz Stars score: 99/100, based on 1454 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/primer/Universal+Primer+Mix/pm42885934-194-9-19
Average 99 stars, based on 1454 article reviews

universal primer mix - by Bioz Stars, 2026-11

99/100 stars

Images

Reverse Transcription:

Article Title: Anti-VHH domain antibodies and use thereof
Article Snippet: .. The total RNA was extracted from 3×106-5×106 hybridoma cells with TRIzol (Ambion, CAT #: 15596-026) and reverse transcribed into cDNA using an antibody subtype-specific primer and a universal primer (Takara PrimeScriptTM 1st Strand cDNA Synthesis Kit, CAT #: 6110A). .. Subsequently, heavy chain and light chain variable region fragments of rabbit immunoglobulin were amplified by RACE PCR, and the resulting PCR fragments were subcloned into a pMD18-T vector system (Takara, CAT #: 6011); and a vector-specific primer was used to sequence the inserted fragments.

Article Title: Molecular Epidemiology of Sapovirus Infection in Japanese Children With Acute Gastroenteritis Before and After the COVID-19 Pandemic.
Article Snippet: The viral RNA was extracted from the supernatant of 10% stool suspension by the QIAamp Viral RNA mini kit (Qiagen) according to the manufacturer's instructions. .. The reverse transcription (RT) was conducted using the Rever Tra Ace enzyme (Toyobo) and a random primer (Takara‐Bio). ..

cDNA Synthesis:

Amplification:

Article Title: SLFN11-mediated ribosome biogenesis impairment induces TP53-independent apoptosis.
Article Snippet: The cells were exposed to 2 mg/mL puromycin (InvivoGen) for 2 weeks, and surviving cells were used for assays. .. To generate hygromycin-resistant SLFN11-expressing K562 cells, pPCIH (containing hygromycin-resistant gene) vector was used to switch from pPCIP vectors. cDNA of SLFN11 wild-type and mutants (E669Q, E209A/E214A, K652E, S753D) was amplified using the forward primer (50- CAGATCTGGATCCAGCGGCC -30) and the reverse primer (50- CGTCTCGAGGCGGCCCTAATGGCC ACCCCACGG -30) and cloned into the NotI site in the pPCIH vector using In-Fusion HD cloning kit (Clontech), and the mutations were validated by sequence analysis. ..

Article Title: Parasiticidal Activity of Citral Against Enteromyxum leei (myxozoa: myxosporea) in Olive Flounder (Paralichthys olivaceus).
Article Snippet: [3].. According to the National Fisheries Science Institute (2006), females generally grow larger and faster than males.. Myxosporean parasites are a significant health threat to aquaculture, particularly impacting cultured flatfish.

Clone Assay:

Cloning:

Sequencing:

Real-time Polymerase Chain Reaction:

Article Title: Multigenerational immunotoxicity assessment: A three-generation study in Drosophila melanogaster upon developmental exposure to triclosan.
Article Snippet: Triclosan (TCS) is widely used as an antibacterial agent, nevertheless, its presence in different environmental matrices and its persistent environmental nature pose a significant threat to the organism, including humans.. Numerous studies showed that TCS exposure could lead to multiple toxicities, including immune dysfunction.. However, whether parental TCS exposure could impair the offspring’s immune response remains limited.

Article Title: Rapid detection of Mycoplasma pneumoniae CARDS toxin in clinical respiratory specimens by a loop-mediated isothermal amplification assay
Article Snippet: The instrument used was Bio-Rad CFX96 (Bio-Rad, CA, USA). .. The reaction system was 1 μl of template DNA, 1 μl of forward primer, 0.5 μl of TaqMan probe primer, 1 μl of reverse primer, 12.5 μl of Premix Ex Taq (Probe qPCR) (2 × Conc., TaKaRa, Kyoto, Japan), and 9 μl of deionized water. ..

Polymerase Chain Reaction:

Article Title: Substantial enhancement of Agrobacterium -mediated transgene-free genome editing via short-term chemical selection using citrus as a model plant
Article Snippet: .. PCR reactions were carried out in 20-μl volumes containing PCR buffer with 1.5 mM MgCl2, 0.25 mM dNTPs, 0.25 μM of each primer, 0.2 μL e2TAK DNA polymerase (Takara, Japan), and 500 ng of genomic DNA. .. PCR reactions were carried out in 20-μl volumes containing PCR buffer with 1.5 mM MgCl2, 0.25 mM dNTPs, 0.25 μM of each primer, 0.2 μL e2TAK DNA polymerase (Takara, Japan), and 500 ng of genomic DNA.

Article Title: EPSPS target site mechanisms confer glyphosate resistance in Arctotheca calendula.
Article Snippet: .. The PCR was conducted in a 25-μL volume including 50– 100 ng cDNA, 0.4 μM each primer, 200 μM each of dNTP mixture, 5 μL 5× PrimeSTAR GXL buffer and 0.6 U PrimeSTAR GXL polymerase (TaKaRaBio, Tokyo, China). .. The PCR was run with the following profile: 40 cycles of 98°C for 30 s, 55°C (annealing temperature) for 15 s and 68 °C for 70 s. The amplified cDNA fragment was cloned into the pGEM-T vector (Promega, Madison, WI, USA) and transformed into JM109 competent Escherichia coli cells (Promega).

Review