86
|
Sangon Biotech
ctaatgggaacgtcacacacca sangon biotech n a tnfa primer Ctaatgggaacgtcacacacca Sangon Biotech N A Tnfa Primer, supplied by Sangon Biotech, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/primer/a+biotech+ctaatgggaacgtcacacacca+n+primer+sangon+tnfa/pm38159573-806-207-208 Average 86 stars, based on 1 article reviews
ctaatgggaacgtcacacacca sangon biotech n a tnfa primer - by Bioz Stars,
2026-09
86/100 stars
|
Buy from Supplier |
86
|
Sangon Biotech
ggcttctttcgcacaatctcaat sangon biotech n a pdgfra primer Ggcttctttcgcacaatctcaat Sangon Biotech N A Pdgfra Primer, supplied by Sangon Biotech, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/primer/a+biotech+ggcttctttcgcacaatctcaat+n+pdgfra+primer+sangon/pm35863346-241-84-85 Average 86 stars, based on 1 article reviews
ggcttctttcgcacaatctcaat sangon biotech n a pdgfra primer - by Bioz Stars,
2026-09
86/100 stars
|
Buy from Supplier |
86
|
Sangon Biotech
cagggtcaaggcaagcctc sangon biotech n a cxcl5 primer Cagggtcaaggcaagcctc Sangon Biotech N A Cxcl5 Primer, supplied by Sangon Biotech, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/primer/a+biotech+cagggtcaaggcaagcctc+cxcl5+n+primer+sangon/pm38159573-806-235-236 Average 86 stars, based on 1 article reviews
cagggtcaaggcaagcctc sangon biotech n a cxcl5 primer - by Bioz Stars,
2026-09
86/100 stars
|
Buy from Supplier |
86
|
Sangon Biotech
accttccaggatgaggacatga sangon biotech n a il1b primer Accttccaggatgaggacatga Sangon Biotech N A Il1b Primer, supplied by Sangon Biotech, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/primer/a+accttccaggatgaggacatga+biotech+il1b+n+primer+sangon/pm38159573-806-200-201 Average 86 stars, based on 1 article reviews
accttccaggatgaggacatga sangon biotech n a il1b primer - by Bioz Stars,
2026-09
86/100 stars
|
Buy from Supplier |
86
|
Merck & Co
ggccttcgtttttgataagtc merck n a primer Ggccttcgtttttgataagtc Merck N A Primer, supplied by Merck & Co, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/primer/a+ggccttcgtttttgataagtc+merck+n+primer/pmc12281364__mmc2-633-226-227 Average 86 stars, based on 1 article reviews
ggccttcgtttttgataagtc merck n a primer - by Bioz Stars,
2026-09
86/100 stars
|
Buy from Supplier |
86
|
Sangon Biotech
sangon biotech n a primer Sangon Biotech N A Primer, supplied by Sangon Biotech, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/primer/a+biotech+n+primer+sangon/pm41534530-729-51-52 Average 86 stars, based on 1 article reviews
sangon biotech n a primer - by Bioz Stars,
2026-09
86/100 stars
|
Buy from Supplier |
86
|
Eurofins
primer sequences Primer Sequences, supplied by Eurofins, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/primer/primer+sequences/pmc12269598__mmc6-291-0-12 Average 86 stars, based on 1 article reviews
primer sequences - by Bioz Stars,
2026-09
86/100 stars
|
Buy from Supplier |
91
|
Novus Biologicals
paper n a primer Paper N A Primer, supplied by Novus Biologicals, used in various techniques. Bioz Stars score: 91/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/primer/GAPDH+primer/pm38100351-247-73-87 Average 91 stars, based on 1 article reviews
paper n a primer - by Bioz Stars,
2026-09
91/100 stars
|
Buy from Supplier |
91
|
OriGene
anddsc2 primers Anddsc2 Primers, supplied by OriGene, used in various techniques. Bioz Stars score: 91/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/primer/Desmoglein+2+(DSG2)+Human+qPCR+Primer+Pair/10__1158_slash_1541___7786__mcr___22___0763-64-51-55 Average 91 stars, based on 1 article reviews
anddsc2 primers - by Bioz Stars,
2026-09
91/100 stars
|
Buy from Supplier |
92
|
OriGene
gtggtagtaaccaaagcatctgc Gtggtagtaaccaaagcatctgc, supplied by OriGene, used in various techniques. Bioz Stars score: 92/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/primer/Oprk1+Mouse+qPCR+Primer+Pair/pmc07385665-101-7-9 Average 92 stars, based on 1 article reviews
gtggtagtaaccaaagcatctgc - by Bioz Stars,
2026-09
92/100 stars
|
Buy from Supplier |
97
|
OriGene
primer sequences Primer Sequences, supplied by OriGene, used in various techniques. Bioz Stars score: 97/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/primer/Primer/pm42244013-162-0-13 Average 97 stars, based on 1 article reviews
primer sequences - by Bioz Stars,
2026-09
97/100 stars
|
Buy from Supplier |
93
|
OriGene
myh7 Myh7, supplied by OriGene, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/primer/CMH1+(MYH7)+Human+qPCR+Primer+Pair/pmc12141862-173-28-29 Average 93 stars, based on 1 article reviews
myh7 - by Bioz Stars,
2026-09
93/100 stars
|
Buy from Supplier |