Cell Culture:Article Title: Attenuated interferon signalling in alveolar epithelium limits resistance to Streptococcus pyogenes
Article Snippet: Cells were then dissociated using Gentle Cell Dissociation Reagent (StemCell Technologies, 100-0485) and replated on plates coated with growth factor-reduced Matrigel (Corning, 354277). .. Afterwards, cells were cultured in the anteriorisation media “DS/SB” (cSFDM with 2 μM Dorsomorphin (Tocris, 3093/10) and 10 μM SB431542 (Tocris, 1614)) for 3 days, with the first 24 hours also supplemented with 10 μM Y-27632 (Tocris, 1254). .. From day 6 of the differentiation, Cells were kept in “CBRa” (cSFDM with 3 μM CHIR99021 (Tocris, 4423), 10 ng/ml rhBMP4 (R&D Systems, 314-BP), and 100 nM Retinoic Acid (Sigma, R2625)) to induce NKX2-1 + lung progenitors.
other:
Article Title: Inflammatory signaling differentially changes chromatin accessibility and gene expression of the PD- associated kinase LRRK2 between human and mice
Article Snippet: Upon reaching 90% confluence, FBn N3 differentiation media (50% DMEM/F12 (Thermo Fisher, 11320033), 50% Neurobasal (Thermo Fisher, 21103049) with 0.5x GlutaMAX (Thermo Fisher, 25030–081), 1x Penicillin-Streptomycin (Thermo Fisher, 15140122), 0.5x B-27 minus vitamin A (Thermo Fisher, 12587010), 0.5x N2 supplement (Thermo Fisher, 17502048), 0.5x MEM Non-Essential Amino Acids (NEAA) (Thermo Fisher, 11140–050), 0.055 mM 2-mercaptoethanol (Thermo Fisher, 21985–023) and 1 μg/mL Insulin (Millipore Sigma, 91077C)) plus 1.5 μM Dorsomorphin (Tocris Bioscience, 3093) and 10 μM SB431542 (Stemgent, 04–0010-05) was added and changed daily until differentiation day 11.
Article Title: Human iPSC-derived 2D cortical neurons and 3D cortical organoids show fetal brain proteomic similarity and distinct phosphoproteomic profiles
Article Snippet: Next day, the cells were 90%–100% confluent and differentiation was initiated by changing medium to Neurobasal medium (DMEM/F12, Neurobasal, 1X B-27 minus vitamin A, 1X N2 supplement, 1X L-Glutamine, 1X Non-essential amino acids (NEAA), 50 μM β-mercapto-ethanol, 0.4X Penicillin/streptomycin) supplemented with 10 μM SB431542 (Tocris, cat# 1614) and 2 μM Dorsomorphin (Tocris, cat# 3093) for 12 days.
Saline:
Recombinant:Article Title: OGT regulates RNA-binding protein nucleocytoplasmic partitioning, but this fails in amyotrophic lateral sclerosis.
Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies Mouse monoclonal anti-PTBP1 Proteintech Cat#67462-1-Ig; RRID: AB_2882692 Rabbit polyclonal anti-PTBP1 Proteintech Cat#12582-1-AP; RRID: AB_2176402 Rabbit polyclonal anti-U2AF65 Abcam Cat#ab37530; RRID: AB_883336 Mouse monoclonal anti-hnRNPK Santa Cruz Cat#sc-28380; RRID: AB_627734 Rabbit polyclonal anti-TDP-43 Proteintech Cat#12892-1-AP; RRID: AB_2200505 Mouse monoclonal anti-FUS Santa Cruz Cat#sc-47711; RRID: AB_2105208 Rabbit polyclonal anti-SFPQ Abcam Cat#ab38148; RRID: AB_945424 Mouse monoclonal anti-U2AF35 Proteintech Cat#60289-1-Ig; RRID: AB_2858277 Chicken polyclonal anti-beta III Tubulin Abcam Cat#ab41489; RRID: AB_727049 Mouse monoclonal anti-OGT Santa Cruz Cat#sc-74546; RRID: AB_2157067 Mouse monoclonal anti-O-GlcNAc RL2 Abcam Cat#ab2739; RRID: AB_303264 Chemicals, peptides, and recombinant proteins Essential 8 Medium Gibco Cat#A1517001 Geltrex Gibco Cat#A1413302 UltraPure EDTA Invitrogen Cat#15575020 DMEM/F12 Gibco Cat#31330038 Neurobasal Medium Gibco Cat#12348017 N-2 Supplement Gibco Cat#17502001 B27 Supplement Gibco Cat#12587001 GlutaMAX Supplement Thermo Scientific Cat#35050038 MEM Non-Essential Amino Acids Gibco Cat#11140050 β-Mercaptoethanol Gibco Cat#21985023 Human insulin Sigma-Aldrich Cat#I9278 Dorsomorphin Tocris Cat3093 SB431542 Tocris Cat#1614 CHIR99021 Tocris Cat#4423 Retinoic Acid Sigma-Aldrich Cat#R2625 Purmorphamine Sigma-Aldrich Cat#540220 Compound E Tocris Cat#6476 Lipofectamine RNAiMAX Transfection Reagent Invitrogen Cat#13778150 SYBR Green Mastermix Applied Biosystems Cat#4309155 Tris-HCl Buffer, pH 7.5 Invitrogen Cat#15567027 NaCl Invitrogen Cat#AM9760G NP-40 Detergent Solution Thermo Scientific Cat#85124 EDTA Invitrogen Cat#AM9260G cOmplete Protease Inhibitor Cocktail Roche Cat#4693159001 NuPAGE Reducing Agent Invitrogen Cat#NP0009 NuPAGE LDS Sample Buffer Invitrogen Cat#NP0007 NuPAGE MOPS SDS Running Buffer Invitrogen Cat#NP0001 Paraformaldehyde Thermo Scientific Cat#043368.9M PBS Gibco Cat#10010015 Bovine Serum Albumin Sigma-Aldrich Cat#A7906 Triton X-100 Thermo Scientific Cat#9002-93-1 (Continued on next page) iScience 29, 117807, November 20, 2026 11 .. REAGENT or RESOURCE SOURCE IDENTIFIER Thiamet G Sigma-Aldrich Cat#SML0244 Critical commercial assays Maxwell RSC simplyRNA Cells Kit Promega Cat#AS1390 SuperScript IV First-Strand Synthesis System Invitrogen Cat#18091050 Pierce BCA Protein Assay Kit Thermo Scientific Cat#23227 Revert Total Protein Stain Kit LICORbio Cat#926-11016 ECL Western Blotting Detection Reagent Cytiva Cat#RPN2232 Deposited data Existing RBP CLIP data ENCODE https://www.encodeproject.org/ Original Western blot images This paper Mendeley Data: https://doi.org/10.17632/854xtzypt4.1 Experimental models: Cell lines Human: CTRL1 iPSC line Thermo Fisher Scientific Cat#A18945 Human: CTRL2 iPSC line Ludtmann et al.44 (Wray lab) N/A Human: CTRL3 iPSC line Cedars-Sinai CS0002iCTR-nxx; RRID: CVCL_E8CP Human: CTRL4 iPSC line NIH CRM CRMi003-A, RRID: CVCL_1E71 Human: VCPmut1 R155C iPSC line Ludtmann et al.44 (Wray lab) N/A Human: VCPmut2 R155C iPSC line Ludtmann et al.44 (Wray lab) N/A Human: VCPmut3 R191Q iPSC line Ludtmann et al.44 (Wray lab) N/A Human: VCPmut4 R191Q iPSC line Ludtmann et al.44 (Wray lab) N/A Human: TARDBPmut1 G298S iPSC line Cedars-Sinai CS47iALS-TDPnxx Human: TARDBPmut2 G298S iPSC line Target ALS TALSTDP-47.10; RRID: CVCL_FA03 Oligonucleotides ASO-OGT sequence: GTGGCAGTTACAAACCCGTTACCAT Parra et al.29 N/A ASO-NC sequence: TTAGTTTAATCACGCTCG This paper N/A Primer: OGT IRT Forward: GAAGCCAAGGTAGGTGTTTGA Tyzack et al.27 N/A Primer: OGT IRT Reverse: AAGAGTTGAAGACTTGGCAAA Tyzack et al.27 N/A Primer: OGT PCT Forward: TTCGCAGTGACCTGGGGAAC This paper N/A Primer: OGT PCT Reverse: CACAGCCAAGATTACTCCAAGC This paper N/A Primer: GAPDH Forward: ATGACATCAAGAAGGTGGTG This paper N/A Primer: GAPDH Reverse: CATACCAGGAAATGAGCTTG This paper N/A Software and algorithms Image Lab v6 Bio-Rad GraphPad Prism v11 Dotmatics https://www.graphpad.com/ R Project for Statistical Computing v4 CRAN RRID: SCR_001905 STAR v2.7 RNA-STAR RRID:SCR_004463 Cutadapt Martin45 RRID:SCR_011841 FlowJo v11 Waters Biosciences https://www.flowjo.com/ Harmony High-Content Imaging and Analysis Software v5 Revvity Cat#HH17000019 CellProfiler v4 Broad Institute https://cellprofiler.org/ 12 iScience 29, 117807, November 20, 2026
Transfection:Article Title: OGT regulates RNA-binding protein nucleocytoplasmic partitioning, but this fails in amyotrophic lateral sclerosis.
Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies Mouse monoclonal anti-PTBP1 Proteintech Cat#67462-1-Ig; RRID: AB_2882692 Rabbit polyclonal anti-PTBP1 Proteintech Cat#12582-1-AP; RRID: AB_2176402 Rabbit polyclonal anti-U2AF65 Abcam Cat#ab37530; RRID: AB_883336 Mouse monoclonal anti-hnRNPK Santa Cruz Cat#sc-28380; RRID: AB_627734 Rabbit polyclonal anti-TDP-43 Proteintech Cat#12892-1-AP; RRID: AB_2200505 Mouse monoclonal anti-FUS Santa Cruz Cat#sc-47711; RRID: AB_2105208 Rabbit polyclonal anti-SFPQ Abcam Cat#ab38148; RRID: AB_945424 Mouse monoclonal anti-U2AF35 Proteintech Cat#60289-1-Ig; RRID: AB_2858277 Chicken polyclonal anti-beta III Tubulin Abcam Cat#ab41489; RRID: AB_727049 Mouse monoclonal anti-OGT Santa Cruz Cat#sc-74546; RRID: AB_2157067 Mouse monoclonal anti-O-GlcNAc RL2 Abcam Cat#ab2739; RRID: AB_303264 Chemicals, peptides, and recombinant proteins Essential 8 Medium Gibco Cat#A1517001 Geltrex Gibco Cat#A1413302 UltraPure EDTA Invitrogen Cat#15575020 DMEM/F12 Gibco Cat#31330038 Neurobasal Medium Gibco Cat#12348017 N-2 Supplement Gibco Cat#17502001 B27 Supplement Gibco Cat#12587001 GlutaMAX Supplement Thermo Scientific Cat#35050038 MEM Non-Essential Amino Acids Gibco Cat#11140050 β-Mercaptoethanol Gibco Cat#21985023 Human insulin Sigma-Aldrich Cat#I9278 Dorsomorphin Tocris Cat3093 SB431542 Tocris Cat#1614 CHIR99021 Tocris Cat#4423 Retinoic Acid Sigma-Aldrich Cat#R2625 Purmorphamine Sigma-Aldrich Cat#540220 Compound E Tocris Cat#6476 Lipofectamine RNAiMAX Transfection Reagent Invitrogen Cat#13778150 SYBR Green Mastermix Applied Biosystems Cat#4309155 Tris-HCl Buffer, pH 7.5 Invitrogen Cat#15567027 NaCl Invitrogen Cat#AM9760G NP-40 Detergent Solution Thermo Scientific Cat#85124 EDTA Invitrogen Cat#AM9260G cOmplete Protease Inhibitor Cocktail Roche Cat#4693159001 NuPAGE Reducing Agent Invitrogen Cat#NP0009 NuPAGE LDS Sample Buffer Invitrogen Cat#NP0007 NuPAGE MOPS SDS Running Buffer Invitrogen Cat#NP0001 Paraformaldehyde Thermo Scientific Cat#043368.9M PBS Gibco Cat#10010015 Bovine Serum Albumin Sigma-Aldrich Cat#A7906 Triton X-100 Thermo Scientific Cat#9002-93-1 (Continued on next page) iScience 29, 117807, November 20, 2026 11 .. REAGENT or RESOURCE SOURCE IDENTIFIER Thiamet G Sigma-Aldrich Cat#SML0244 Critical commercial assays Maxwell RSC simplyRNA Cells Kit Promega Cat#AS1390 SuperScript IV First-Strand Synthesis System Invitrogen Cat#18091050 Pierce BCA Protein Assay Kit Thermo Scientific Cat#23227 Revert Total Protein Stain Kit LICORbio Cat#926-11016 ECL Western Blotting Detection Reagent Cytiva Cat#RPN2232 Deposited data Existing RBP CLIP data ENCODE https://www.encodeproject.org/ Original Western blot images This paper Mendeley Data: https://doi.org/10.17632/854xtzypt4.1 Experimental models: Cell lines Human: CTRL1 iPSC line Thermo Fisher Scientific Cat#A18945 Human: CTRL2 iPSC line Ludtmann et al.44 (Wray lab) N/A Human: CTRL3 iPSC line Cedars-Sinai CS0002iCTR-nxx; RRID: CVCL_E8CP Human: CTRL4 iPSC line NIH CRM CRMi003-A, RRID: CVCL_1E71 Human: VCPmut1 R155C iPSC line Ludtmann et al.44 (Wray lab) N/A Human: VCPmut2 R155C iPSC line Ludtmann et al.44 (Wray lab) N/A Human: VCPmut3 R191Q iPSC line Ludtmann et al.44 (Wray lab) N/A Human: VCPmut4 R191Q iPSC line Ludtmann et al.44 (Wray lab) N/A Human: TARDBPmut1 G298S iPSC line Cedars-Sinai CS47iALS-TDPnxx Human: TARDBPmut2 G298S iPSC line Target ALS TALSTDP-47.10; RRID: CVCL_FA03 Oligonucleotides ASO-OGT sequence: GTGGCAGTTACAAACCCGTTACCAT Parra et al.29 N/A ASO-NC sequence: TTAGTTTAATCACGCTCG This paper N/A Primer: OGT IRT Forward: GAAGCCAAGGTAGGTGTTTGA Tyzack et al.27 N/A Primer: OGT IRT Reverse: AAGAGTTGAAGACTTGGCAAA Tyzack et al.27 N/A Primer: OGT PCT Forward: TTCGCAGTGACCTGGGGAAC This paper N/A Primer: OGT PCT Reverse: CACAGCCAAGATTACTCCAAGC This paper N/A Primer: GAPDH Forward: ATGACATCAAGAAGGTGGTG This paper N/A Primer: GAPDH Reverse: CATACCAGGAAATGAGCTTG This paper N/A Software and algorithms Image Lab v6 Bio-Rad GraphPad Prism v11 Dotmatics https://www.graphpad.com/ R Project for Statistical Computing v4 CRAN RRID: SCR_001905 STAR v2.7 RNA-STAR RRID:SCR_004463 Cutadapt Martin45 RRID:SCR_011841 FlowJo v11 Waters Biosciences https://www.flowjo.com/ Harmony High-Content Imaging and Analysis Software v5 Revvity Cat#HH17000019 CellProfiler v4 Broad Institute https://cellprofiler.org/ 12 iScience 29, 117807, November 20, 2026
SYBR Green Assay:Article Title: OGT regulates RNA-binding protein nucleocytoplasmic partitioning, but this fails in amyotrophic lateral sclerosis.
Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies Mouse monoclonal anti-PTBP1 Proteintech Cat#67462-1-Ig; RRID: AB_2882692 Rabbit polyclonal anti-PTBP1 Proteintech Cat#12582-1-AP; RRID: AB_2176402 Rabbit polyclonal anti-U2AF65 Abcam Cat#ab37530; RRID: AB_883336 Mouse monoclonal anti-hnRNPK Santa Cruz Cat#sc-28380; RRID: AB_627734 Rabbit polyclonal anti-TDP-43 Proteintech Cat#12892-1-AP; RRID: AB_2200505 Mouse monoclonal anti-FUS Santa Cruz Cat#sc-47711; RRID: AB_2105208 Rabbit polyclonal anti-SFPQ Abcam Cat#ab38148; RRID: AB_945424 Mouse monoclonal anti-U2AF35 Proteintech Cat#60289-1-Ig; RRID: AB_2858277 Chicken polyclonal anti-beta III Tubulin Abcam Cat#ab41489; RRID: AB_727049 Mouse monoclonal anti-OGT Santa Cruz Cat#sc-74546; RRID: AB_2157067 Mouse monoclonal anti-O-GlcNAc RL2 Abcam Cat#ab2739; RRID: AB_303264 Chemicals, peptides, and recombinant proteins Essential 8 Medium Gibco Cat#A1517001 Geltrex Gibco Cat#A1413302 UltraPure EDTA Invitrogen Cat#15575020 DMEM/F12 Gibco Cat#31330038 Neurobasal Medium Gibco Cat#12348017 N-2 Supplement Gibco Cat#17502001 B27 Supplement Gibco Cat#12587001 GlutaMAX Supplement Thermo Scientific Cat#35050038 MEM Non-Essential Amino Acids Gibco Cat#11140050 β-Mercaptoethanol Gibco Cat#21985023 Human insulin Sigma-Aldrich Cat#I9278 Dorsomorphin Tocris Cat3093 SB431542 Tocris Cat#1614 CHIR99021 Tocris Cat#4423 Retinoic Acid Sigma-Aldrich Cat#R2625 Purmorphamine Sigma-Aldrich Cat#540220 Compound E Tocris Cat#6476 Lipofectamine RNAiMAX Transfection Reagent Invitrogen Cat#13778150 SYBR Green Mastermix Applied Biosystems Cat#4309155 Tris-HCl Buffer, pH 7.5 Invitrogen Cat#15567027 NaCl Invitrogen Cat#AM9760G NP-40 Detergent Solution Thermo Scientific Cat#85124 EDTA Invitrogen Cat#AM9260G cOmplete Protease Inhibitor Cocktail Roche Cat#4693159001 NuPAGE Reducing Agent Invitrogen Cat#NP0009 NuPAGE LDS Sample Buffer Invitrogen Cat#NP0007 NuPAGE MOPS SDS Running Buffer Invitrogen Cat#NP0001 Paraformaldehyde Thermo Scientific Cat#043368.9M PBS Gibco Cat#10010015 Bovine Serum Albumin Sigma-Aldrich Cat#A7906 Triton X-100 Thermo Scientific Cat#9002-93-1 (Continued on next page) iScience 29, 117807, November 20, 2026 11 .. REAGENT or RESOURCE SOURCE IDENTIFIER Thiamet G Sigma-Aldrich Cat#SML0244 Critical commercial assays Maxwell RSC simplyRNA Cells Kit Promega Cat#AS1390 SuperScript IV First-Strand Synthesis System Invitrogen Cat#18091050 Pierce BCA Protein Assay Kit Thermo Scientific Cat#23227 Revert Total Protein Stain Kit LICORbio Cat#926-11016 ECL Western Blotting Detection Reagent Cytiva Cat#RPN2232 Deposited data Existing RBP CLIP data ENCODE https://www.encodeproject.org/ Original Western blot images This paper Mendeley Data: https://doi.org/10.17632/854xtzypt4.1 Experimental models: Cell lines Human: CTRL1 iPSC line Thermo Fisher Scientific Cat#A18945 Human: CTRL2 iPSC line Ludtmann et al.44 (Wray lab) N/A Human: CTRL3 iPSC line Cedars-Sinai CS0002iCTR-nxx; RRID: CVCL_E8CP Human: CTRL4 iPSC line NIH CRM CRMi003-A, RRID: CVCL_1E71 Human: VCPmut1 R155C iPSC line Ludtmann et al.44 (Wray lab) N/A Human: VCPmut2 R155C iPSC line Ludtmann et al.44 (Wray lab) N/A Human: VCPmut3 R191Q iPSC line Ludtmann et al.44 (Wray lab) N/A Human: VCPmut4 R191Q iPSC line Ludtmann et al.44 (Wray lab) N/A Human: TARDBPmut1 G298S iPSC line Cedars-Sinai CS47iALS-TDPnxx Human: TARDBPmut2 G298S iPSC line Target ALS TALSTDP-47.10; RRID: CVCL_FA03 Oligonucleotides ASO-OGT sequence: GTGGCAGTTACAAACCCGTTACCAT Parra et al.29 N/A ASO-NC sequence: TTAGTTTAATCACGCTCG This paper N/A Primer: OGT IRT Forward: GAAGCCAAGGTAGGTGTTTGA Tyzack et al.27 N/A Primer: OGT IRT Reverse: AAGAGTTGAAGACTTGGCAAA Tyzack et al.27 N/A Primer: OGT PCT Forward: TTCGCAGTGACCTGGGGAAC This paper N/A Primer: OGT PCT Reverse: CACAGCCAAGATTACTCCAAGC This paper N/A Primer: GAPDH Forward: ATGACATCAAGAAGGTGGTG This paper N/A Primer: GAPDH Reverse: CATACCAGGAAATGAGCTTG This paper N/A Software and algorithms Image Lab v6 Bio-Rad GraphPad Prism v11 Dotmatics https://www.graphpad.com/ R Project for Statistical Computing v4 CRAN RRID: SCR_001905 STAR v2.7 RNA-STAR RRID:SCR_004463 Cutadapt Martin45 RRID:SCR_011841 FlowJo v11 Waters Biosciences https://www.flowjo.com/ Harmony High-Content Imaging and Analysis Software v5 Revvity Cat#HH17000019 CellProfiler v4 Broad Institute https://cellprofiler.org/ 12 iScience 29, 117807, November 20, 2026
Protease Inhibitor:Article Title: OGT regulates RNA-binding protein nucleocytoplasmic partitioning, but this fails in amyotrophic lateral sclerosis.
Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies Mouse monoclonal anti-PTBP1 Proteintech Cat#67462-1-Ig; RRID: AB_2882692 Rabbit polyclonal anti-PTBP1 Proteintech Cat#12582-1-AP; RRID: AB_2176402 Rabbit polyclonal anti-U2AF65 Abcam Cat#ab37530; RRID: AB_883336 Mouse monoclonal anti-hnRNPK Santa Cruz Cat#sc-28380; RRID: AB_627734 Rabbit polyclonal anti-TDP-43 Proteintech Cat#12892-1-AP; RRID: AB_2200505 Mouse monoclonal anti-FUS Santa Cruz Cat#sc-47711; RRID: AB_2105208 Rabbit polyclonal anti-SFPQ Abcam Cat#ab38148; RRID: AB_945424 Mouse monoclonal anti-U2AF35 Proteintech Cat#60289-1-Ig; RRID: AB_2858277 Chicken polyclonal anti-beta III Tubulin Abcam Cat#ab41489; RRID: AB_727049 Mouse monoclonal anti-OGT Santa Cruz Cat#sc-74546; RRID: AB_2157067 Mouse monoclonal anti-O-GlcNAc RL2 Abcam Cat#ab2739; RRID: AB_303264 Chemicals, peptides, and recombinant proteins Essential 8 Medium Gibco Cat#A1517001 Geltrex Gibco Cat#A1413302 UltraPure EDTA Invitrogen Cat#15575020 DMEM/F12 Gibco Cat#31330038 Neurobasal Medium Gibco Cat#12348017 N-2 Supplement Gibco Cat#17502001 B27 Supplement Gibco Cat#12587001 GlutaMAX Supplement Thermo Scientific Cat#35050038 MEM Non-Essential Amino Acids Gibco Cat#11140050 β-Mercaptoethanol Gibco Cat#21985023 Human insulin Sigma-Aldrich Cat#I9278 Dorsomorphin Tocris Cat3093 SB431542 Tocris Cat#1614 CHIR99021 Tocris Cat#4423 Retinoic Acid Sigma-Aldrich Cat#R2625 Purmorphamine Sigma-Aldrich Cat#540220 Compound E Tocris Cat#6476 Lipofectamine RNAiMAX Transfection Reagent Invitrogen Cat#13778150 SYBR Green Mastermix Applied Biosystems Cat#4309155 Tris-HCl Buffer, pH 7.5 Invitrogen Cat#15567027 NaCl Invitrogen Cat#AM9760G NP-40 Detergent Solution Thermo Scientific Cat#85124 EDTA Invitrogen Cat#AM9260G cOmplete Protease Inhibitor Cocktail Roche Cat#4693159001 NuPAGE Reducing Agent Invitrogen Cat#NP0009 NuPAGE LDS Sample Buffer Invitrogen Cat#NP0007 NuPAGE MOPS SDS Running Buffer Invitrogen Cat#NP0001 Paraformaldehyde Thermo Scientific Cat#043368.9M PBS Gibco Cat#10010015 Bovine Serum Albumin Sigma-Aldrich Cat#A7906 Triton X-100 Thermo Scientific Cat#9002-93-1 (Continued on next page) iScience 29, 117807, November 20, 2026 11 .. REAGENT or RESOURCE SOURCE IDENTIFIER Thiamet G Sigma-Aldrich Cat#SML0244 Critical commercial assays Maxwell RSC simplyRNA Cells Kit Promega Cat#AS1390 SuperScript IV First-Strand Synthesis System Invitrogen Cat#18091050 Pierce BCA Protein Assay Kit Thermo Scientific Cat#23227 Revert Total Protein Stain Kit LICORbio Cat#926-11016 ECL Western Blotting Detection Reagent Cytiva Cat#RPN2232 Deposited data Existing RBP CLIP data ENCODE https://www.encodeproject.org/ Original Western blot images This paper Mendeley Data: https://doi.org/10.17632/854xtzypt4.1 Experimental models: Cell lines Human: CTRL1 iPSC line Thermo Fisher Scientific Cat#A18945 Human: CTRL2 iPSC line Ludtmann et al.44 (Wray lab) N/A Human: CTRL3 iPSC line Cedars-Sinai CS0002iCTR-nxx; RRID: CVCL_E8CP Human: CTRL4 iPSC line NIH CRM CRMi003-A, RRID: CVCL_1E71 Human: VCPmut1 R155C iPSC line Ludtmann et al.44 (Wray lab) N/A Human: VCPmut2 R155C iPSC line Ludtmann et al.44 (Wray lab) N/A Human: VCPmut3 R191Q iPSC line Ludtmann et al.44 (Wray lab) N/A Human: VCPmut4 R191Q iPSC line Ludtmann et al.44 (Wray lab) N/A Human: TARDBPmut1 G298S iPSC line Cedars-Sinai CS47iALS-TDPnxx Human: TARDBPmut2 G298S iPSC line Target ALS TALSTDP-47.10; RRID: CVCL_FA03 Oligonucleotides ASO-OGT sequence: GTGGCAGTTACAAACCCGTTACCAT Parra et al.29 N/A ASO-NC sequence: TTAGTTTAATCACGCTCG This paper N/A Primer: OGT IRT Forward: GAAGCCAAGGTAGGTGTTTGA Tyzack et al.27 N/A Primer: OGT IRT Reverse: AAGAGTTGAAGACTTGGCAAA Tyzack et al.27 N/A Primer: OGT PCT Forward: TTCGCAGTGACCTGGGGAAC This paper N/A Primer: OGT PCT Reverse: CACAGCCAAGATTACTCCAAGC This paper N/A Primer: GAPDH Forward: ATGACATCAAGAAGGTGGTG This paper N/A Primer: GAPDH Reverse: CATACCAGGAAATGAGCTTG This paper N/A Software and algorithms Image Lab v6 Bio-Rad GraphPad Prism v11 Dotmatics https://www.graphpad.com/ R Project for Statistical Computing v4 CRAN RRID: SCR_001905 STAR v2.7 RNA-STAR RRID:SCR_004463 Cutadapt Martin45 RRID:SCR_011841 FlowJo v11 Waters Biosciences https://www.flowjo.com/ Harmony High-Content Imaging and Analysis Software v5 Revvity Cat#HH17000019 CellProfiler v4 Broad Institute https://cellprofiler.org/ 12 iScience 29, 117807, November 20, 2026
|
Tocris is a verified supplier 
Tocris manufactures this product 