Review

dntp mixture (TaKaRa)

TaKaRa is a verified supplier

TaKaRa manufactures this product

About

News

Press Release

Team

Advisors

Partners

Contact

Bioz Stars

Bioz vStars

Buy from Supplier

Structured Review

TaKaRa dntp mixture
Dntp Mixture, supplied by TaKaRa, used in various techniques. Bioz Stars score: 96/100, based on 8908 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/dntps/dNTP+Mixture/pm42884072-243-15-20
Average 96 stars, based on 8908 article reviews

dntp mixture - by Bioz Stars, 2026-11

96/100 stars

Images

Comparison:

Article Title: Spatial mapping of RNA turnover kinetics and regulatory landscapes of mRNA stability in the mammalian brain
Article Snippet: .. In the random primer comparison experiment ( Supplementary Fig. 1b-c ), each oligo was added to a 200 μl Klenow-based reaction mixture (Klenow buffer A: 1x Maxima RT buffer (ThermoFisher), 12% PEG-8000, 1 mM dNTPs (Clontech), 5 μM Template Switch Oligo (TSO)-GAATG (TSO-GAATG: /5SpC3/AAGCAGTGGTATCAACGCAGAGTGAATG), 10 μM TSO-random primer, and 1.25 U/μl Klenow exo-(Enzymatics)). ..

Amplification:

Article Title: Spatial mapping of RNA turnover kinetics and regulatory landscapes of mRNA stability in the mammalian brain
Article Snippet: .. The standard second strand synthesis reaction mix was replaced with a Bst -based reaction mixture: 1× Isothermal Amplification Buffer II (NEB), 6 mM MgSO 4 , 4% Ficoll PM-400, 1.4 mM dNTPs (Clontech), 10 μM random primer (TSO-N3G2N4B: AAGCAGTGGTATCAACGCAGAGTGA(N1:25252525)(N1)(N1)GG(N1)(N1)(N1)(N1)(N2: 00333433); N1 represents a mixture of A, T, C and G at a 25:25:25:25 ratio, N2 represents a mixture of A, T, C and G at a 0:33:34:33 ratio), and 0.4 U/μl Bst DNA polymerase (NEB, M0374). ..

Article Title: Spatial mapping of RNA turnover kinetics and regulatory landscapes of mRNA stability in the mammalian brain
Article Snippet: Second, we tested Bst 3.0 DNA polymerase (Bst3, NEB, M0374), which offers strong strand displacement activity and high fidelity ( Supplementary Fig. 1d-f ). .. The Bst3 reaction mixture included: 1× Isothermal Amplification Buffer II (NEB), 6 mM MgSO4, 4% Ficoll PM-400, 1.4 mM dNTPs (Clontech), 10 μM TSO-random primer, and 0.4 U/μl Bst 3.0). ..

Article Title: Spatial mapping of RNA turnover kinetics and regulatory landscapes of mRNA stability in the mammalian brain
Article Snippet: .. Specifically, beads were resuspended in 200 μL of Bst 3-based reaction mixture containing 1× Isothermal Amplification Buffer II (NEB), 6 mM MgSO4, 4% Ficoll PM-400, 1.4 mM dNTPs (Clontech), 10 μM TSO-N3G2N4B random primer (AAGCAGTGGTATCAACGCAGAGTGA (N1:25252525)(N1)(N1)GG(N1)(N1)(N1) (N1)(N2: 00333433); N1 represents a mixture of A, C, G and T at a 25:25:25:25 ratio, N2 represents a mixture of A, C, G and T at a 0:33:34:33 ratio), and 0.4 U/μL Bst 3 DNA polymerase (NEB, M0374). ..

Incubation:

Article Title: Novel serum small extracellular vesicle miRNAs with multi-target RCA-CRISPR sensor for liver cancer detection
Article Snippet: The ligation reaction was conducted in a 20 μL volume at 37 °C for 1 h, containing 4 μL of phosphorylated circular probe (100 nM), 4 μL of miRNA at various concentrations, 1 μL of ATP (1 μM) (#4041, TaKaRa, Japan), 2 μL of 10 × T4 DNA ligase buffer (#B0202S, New England Biolabs, USA), 0.5 μL of T4 DNA ligase (350 U/μL) (#M0202S, New England Biolabs, USA) and 8.5 μL of DEPC-treated water (#R0021, Beyotime, China). .. Subsequently, 2 μL of dNTPs (10 mM each) (#4043, TaKaRa, Japan), 0.3 μL of phi 29 DNA polymerase (10 U/μL) (#M0269L, New England Biolabs, USA), 3 μL of 10 × phi 29 DNA polymerase buffer (#M0269L, New England Biolabs, USA), 1 μL of BSA solution (100 μg/mL) (#M0269L, New England Biolabs, USA), and 3.7 μL of DEPC-treated water were added to initiate the RCA reaction, which was carried out at 30 °C for 1.5 h. For the cleavage reaction, 0.5 μL of Cas12a enzyme (2 μM) (#M0653T, New England Biolabs, USA), 1 μL of crRNA (3 μM), 2 μL of Fluorophore-quencher (F-Q) reporter (10 μM), 5 μL of 10 × NEB buffer (#B7202S, New England Biolabs, USA), and 11.5 μL of DEPC-treated water were added to the mixture and incubated at 37 °C for 30 min. .. The fluorescence images were captured using a Blue Vision 200 A/B V200 fluorescence microscope (Clinx, China).

Construct:

Article Title: A Glucan Synthase-Remodeler Module Organizes Branched Glucan Assembly in the Fungal Cell Wall
Article Snippet: For D75-4590 (MedChemExpress, cat# HY-134655) treatment of S. pombe cells, a stock solution of 20 mM was made in DMSO. .. The bgs3-1 temperature sensitive allele was constructed as described ( ) with the exception that EX taq polymerase (Takara, cat# 4025) and accompanying dNTPs (Takara, cat# RR01BM) were used. ..