reverse transcription kit (catalog number:4368813 (Thermo Fisher)
Thermo Fisher is a verified supplier 
Thermo Fisher manufactures this product 
90
Structured Review
Thermo Fisher
reverse transcription kit (catalog number:4368813
Reverse Transcription Kit (Catalog Number:4368813, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/transcript+numbers/pm39624268-66-22-27
Average 90 stars, based on 1 article reviews
Reverse Transcription Kit (Catalog Number:4368813, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/transcript+numbers/pm39624268-66-22-27
Average 90 stars, based on 1 article reviews
reverse transcription kit (catalog number:4368813 - by Bioz Stars,
2026-09
90/100 stars
Images
Related Articles
Synthesized:Article Title: CircRNF13 enhances IGF2BP1 phase separation-mediated ITGB1 mRNA stabilization in an m6A-dependent manner to promote oral cancer cisplatin chemoresistance Article Snippet: GFP-IGF2BP1-GV739-Neomycin and ITGB1-GV657-puromycin plasmids were obtained from Genechem (Shanghai, China). .. RNA was extracted with TRIzol (Invitrogen, USA), and first-strand cDNA was synthesized using a Reverse Transcription:Article Title: CircRNF13 enhances IGF2BP1 phase separation-mediated ITGB1 mRNA stabilization in an m6A-dependent manner to promote oral cancer cisplatin chemoresistance Article Snippet: GFP-IGF2BP1-GV739-Neomycin and ITGB1-GV657-puromycin plasmids were obtained from Genechem (Shanghai, China). .. RNA was extracted with TRIzol (Invitrogen, USA), and first-strand cDNA was synthesized using a Article Title: A study to determine the effect of nano-selenium and thymoquinone on the Nrf2 gene expression in Alzheimer's disease. Article Snippet: .. Quantitative real-time PCR to estimate nuclear factor-erythroid 2 p45-related factor 2 (Nrf2) utilizing the sV total RNa isolation technique, total RNa was isolated from tissue homogenate. (Thermo Scientific, USA). the amount of total RNa that was produced was determined spectrophotometrically at 260 nm. utilizing a Article Title: The analysis of X chromosome activity of porcine embryonic stem Cells: Study based on parthenogenetic embryonic stem cells with LCDM medium. Article Snippet: The derivation of porcine embryonic stem cell (pESC) lines remains a major challenge in this field.. To date, the porcine naïve ESCs have yet to be successfully established, and standardized criteria for their characterization and evaluation are still lacking.. The regulation of X-chromosome activity integrates information from embryonic development and the dosage of sex chromosomes, which is closely associated with the pluripotent state of embryonic stem cells. Article Title: c-di-GMP inhibits rRNA methylation and impairs ribosome assembly in the presence of kanamycin. Article Snippet: The eluted RNA and RNA fragments were purified with phenol‒chloroform and quantified using a NanoDrop 2000 spectrophotometer (Thermo Fisher Scientific). .. Real-time RT-PCR was performed using a Article Title: Odontogenic differentiation of dental pulp stem cells by glycogen synthase kinase-3β inhibitory peptides Article Snippet: At 14 and 21 days, the attached cells were harvested, and total RNA was extracted using RNeasy Plus Kits (QIAGEN, Hilden, Germany) following the manufacturer’s protocol. .. The extracted RNA was then converted to cDNA using a Article Title: c-di-GMP inhibits rRNA methylation and impairs ribosome assembly in the presence of kanamycin. Article Snippet: Sequence1 (5′→ 3′) Sequence2 (5′→ 3′) C1962 CGGTCCTAAGGTAGCGAAAT ACTGAGTCTCGGGTGGAGA ACGGCGGCCGTAACTATA GCCTGGCCATCATTACGCC Sequence1 (5′→ 3′) Sequence2 (5′→ 3′) 23S rRNA AGTGGAAGCGTCTGGAAAGG GCCCTACTCATCGAGCTCAC ATCGTACCCCAAACCGACAC TTCTCCCGAAGTTACGGCAC Measuring the relative mRNA levels of methyltransferases E. coli strains (WT, dgcZ+ and dgcZG206A,G207A) were cultivated overnight in LB medium at 37 °C, transferred to Vogel‐Bonner medium at a 1:1000 ratio with 10 mM acetate at 25 °C for 12 h, and induced with 0.2 mM IPTG at 25 °C for 20 h. Cells corresponding to 10 OD were harvested for RNA extraction using an RNA extraction kit (Sangon Biotech, China). .. Real-time RT-PCR was performed using a Article Title: A study to determine the effect of nano-selenium and thymoquinone on the Nrf2 gene expression in Alzheimer’s disease Article Snippet: .. Utilizing a Real-time Polymerase Chain Reaction:Article Title: A study to determine the effect of nano-selenium and thymoquinone on the Nrf2 gene expression in Alzheimer's disease. Article Snippet: .. Quantitative real-time PCR to estimate nuclear factor-erythroid 2 p45-related factor 2 (Nrf2) utilizing the sV total RNa isolation technique, total RNa was isolated from tissue homogenate. (Thermo Scientific, USA). the amount of total RNa that was produced was determined spectrophotometrically at 260 nm. utilizing a Article Title: c-di-GMP inhibits rRNA methylation and impairs ribosome assembly in the presence of kanamycin. Article Snippet: The eluted RNA and RNA fragments were purified with phenol‒chloroform and quantified using a NanoDrop 2000 spectrophotometer (Thermo Fisher Scientific). .. Real-time RT-PCR was performed using a Article Title: c-di-GMP inhibits rRNA methylation and impairs ribosome assembly in the presence of kanamycin. Article Snippet: Sequence1 (5′→ 3′) Sequence2 (5′→ 3′) C1962 CGGTCCTAAGGTAGCGAAAT ACTGAGTCTCGGGTGGAGA ACGGCGGCCGTAACTATA GCCTGGCCATCATTACGCC Sequence1 (5′→ 3′) Sequence2 (5′→ 3′) 23S rRNA AGTGGAAGCGTCTGGAAAGG GCCCTACTCATCGAGCTCAC ATCGTACCCCAAACCGACAC TTCTCCCGAAGTTACGGCAC Measuring the relative mRNA levels of methyltransferases E. coli strains (WT, dgcZ+ and dgcZG206A,G207A) were cultivated overnight in LB medium at 37 °C, transferred to Vogel‐Bonner medium at a 1:1000 ratio with 10 mM acetate at 25 °C for 12 h, and induced with 0.2 mM IPTG at 25 °C for 20 h. Cells corresponding to 10 OD were harvested for RNA extraction using an RNA extraction kit (Sangon Biotech, China). .. Real-time RT-PCR was performed using a Isolation:Article Title: A study to determine the effect of nano-selenium and thymoquinone on the Nrf2 gene expression in Alzheimer's disease. Article Snippet: .. Quantitative real-time PCR to estimate nuclear factor-erythroid 2 p45-related factor 2 (Nrf2) utilizing the sV total RNa isolation technique, total RNa was isolated from tissue homogenate. (Thermo Scientific, USA). the amount of total RNa that was produced was determined spectrophotometrically at 260 nm. utilizing a Produced:Article Title: A study to determine the effect of nano-selenium and thymoquinone on the Nrf2 gene expression in Alzheimer's disease. Article Snippet: .. Quantitative real-time PCR to estimate nuclear factor-erythroid 2 p45-related factor 2 (Nrf2) utilizing the sV total RNa isolation technique, total RNa was isolated from tissue homogenate. (Thermo Scientific, USA). the amount of total RNa that was produced was determined spectrophotometrically at 260 nm. utilizing a other:Article Title: Vitamin D augments insulin secretion via calcium influx and upregulation of voltage calcium channels: Findings from INS-1 cells and human islets. Article Snippet: Vitamin D (VD) has been implicated in regulating insulin secretion and pancreatic β-cell function.. Yet, the underlying molecular mechanism of VD in glucose homeostasis is not fully understood.. This study investigates the effect of VD in regulating insulin secretion and pancreatic β-cell function. Quantitative RT-PCR:Article Title: c-di-GMP inhibits rRNA methylation and impairs ribosome assembly in the presence of kanamycin. Article Snippet: The eluted RNA and RNA fragments were purified with phenol‒chloroform and quantified using a NanoDrop 2000 spectrophotometer (Thermo Fisher Scientific). .. Real-time RT-PCR was performed using a Article Title: c-di-GMP inhibits rRNA methylation and impairs ribosome assembly in the presence of kanamycin. Article Snippet: Sequence1 (5′→ 3′) Sequence2 (5′→ 3′) C1962 CGGTCCTAAGGTAGCGAAAT ACTGAGTCTCGGGTGGAGA ACGGCGGCCGTAACTATA GCCTGGCCATCATTACGCC Sequence1 (5′→ 3′) Sequence2 (5′→ 3′) 23S rRNA AGTGGAAGCGTCTGGAAAGG GCCCTACTCATCGAGCTCAC ATCGTACCCCAAACCGACAC TTCTCCCGAAGTTACGGCAC Measuring the relative mRNA levels of methyltransferases E. coli strains (WT, dgcZ+ and dgcZG206A,G207A) were cultivated overnight in LB medium at 37 °C, transferred to Vogel‐Bonner medium at a 1:1000 ratio with 10 mM acetate at 25 °C for 12 h, and induced with 0.2 mM IPTG at 25 °C for 20 h. Cells corresponding to 10 OD were harvested for RNA extraction using an RNA extraction kit (Sangon Biotech, China). .. Real-time RT-PCR was performed using a |
