Review



superscript tm iii reverse transcriptase kit  (Thermo Fisher)


Bioz Verified Symbol Thermo Fisher is a verified supplier
Bioz Manufacturer Symbol Thermo Fisher manufactures this product  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 90

    Structured Review

    Thermo Fisher superscript tm iii reverse transcriptase kit
    Superscript Tm Iii Reverse Transcriptase Kit, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/superscript+tm+iii+reverse+transcriptase/superscript+iii+reverse+transcriptase+kit/pmc11413725-87-11-20
    Average 90 stars, based on 1 article reviews
    superscript tm iii reverse transcriptase kit - by Bioz Stars, 2026-09
    90/100 stars

    Images

    Related Articles

    Reverse Transcription:

    Article Title: Hyaluronan-decorated-phloroglucinol-loaded mesoporous silica downregulates GLI1 and SMO genes of hedgehog signaling pathway in gastrointestinal cancer stem-like cells.
    Article Snippet: Cancer stem-like cells (CSCs), a small subset of cells within the tumor microenvironment, favor tumor relapse and remain a major obstacle in cancer therapy.. Hence, hyaluronan-based mesoporous silica nano-formulation with phloroglucinol (MSN-PG-HA) was employed in our study to address the cancer relapse by targeting CD44.. Various in vitro cellular assays were conducted to assess the nano-formulation's effect on suppressing CSC characteristics in AGS, HCT-116 and SW-620.

    Article Title: Bacteroides sphingolipids promote anti-inflammatory responses through the mevalonate pathway.
    Article Snippet: In brief Brown et al. show that bacterial sphingolipids delivered by outer membrane vesicles (OMVs) persist within mammalian immune cells and promote IL-10 secretion via the mevalonate pathway.. This sphingolipid-mevalonateIL-10 axis drives anti-inflammatory responses, linking microbial sphingolipid delivery to host immunometabolism and the resolution of inflammation.. Sphingolipid-deficient vesicles Sphingolipid-enriched vesicles

    Article Title: Extended analyses of rotavirus C (RVC) G-types and P-types reveal new cut-off value for the G-types and reclassification of strains.
    Article Snippet: .. Reverse transcription (RT) was carried out in a two-step process using SuperScript III Reverse Transcriptase Kit (Invitrogen, Thermo Fisher Scientific, Waltham, USA). ..

    Article Title: Development of a Pentacistronic Ebola Virus Minigenome System
    Article Snippet: Purification was achieved with the Direct-zol RNA MiniPrep Kit (Zymo Research, Tustin, CA, USA) with in-column DNase I treatment according to the manufacturer’s directions. vRNA quantification was conducted using 2-step RT-qPCR methods. .. Reverse transcription was performed using the SuperScript III or SuperScript IV Reverse Transcriptase kit (Thermo Fisher Scientific, Waltham, MA, USA) per manufacturer’s instructions with an EBOV trailer-specific primer (sequence: CTATATTTAGCCTCTCTCCC) for vRNA amplification. .. The resulting cDNA was subjected to qPCR with SYBR Green (Applied Biosystems, Waltham, MA, USA).

    Article Title: Genome Announcement of Four Parechovirus A3 Isolates from the United States of America.
    Article Snippet: .. Briefly, reverse transcription of viral RNA was performed using SuperScript III reverse transcriptase (Invitrogen, Thermo Fisher ScientificCatalog# 18080093) with a 28-base-pair reverse primer consisting of a 3′ end with eight random nucleotides (N1_8N, CCTTGAAGGCGGACTGTGAGNNNNNNNN). .. A complementary DNA (cDNA) strand was synthesized using the Klenow fragment of DNA polymerase I [(3′ to 5′exonuclease) (New England BioLabs, Catalog# M0209)].

    Article Title: <scp>PTPN2</scp> Negatively Regulates Macrophage Immune Responses and Cellular Bioenergetics
    Article Snippet: RNA was quantified with NanoDrop and the quality of the RNA was determined by running an RNA gel using with 500 ng RNA on a 1% agarose gel. .. Then, 1 μg of RNA was reverse transcribed to complementary DNA (cDNA) using the SuperScript III Reverse Transcriptase Kit (Thermo Fisher Scientific), as per the manufacturer's protocol. .. Quantitative realtime PCR (qRT- PCR) was performed with a LightCycler 480 (Roche) using SYBR Green Master Mix (Roche) according to the manufacturer's instructions.

    DNA Extraction:

    Article Title: Bacteroides sphingolipids promote anti-inflammatory responses through the mevalonate pathway.
    Article Snippet: In brief Brown et al. show that bacterial sphingolipids delivered by outer membrane vesicles (OMVs) persist within mammalian immune cells and promote IL-10 secretion via the mevalonate pathway.. This sphingolipid-mevalonateIL-10 axis drives anti-inflammatory responses, linking microbial sphingolipid delivery to host immunometabolism and the resolution of inflammation.. Sphingolipid-deficient vesicles Sphingolipid-enriched vesicles

    Extraction:

    Article Title: Bacteroides sphingolipids promote anti-inflammatory responses through the mevalonate pathway.
    Article Snippet: In brief Brown et al. show that bacterial sphingolipids delivered by outer membrane vesicles (OMVs) persist within mammalian immune cells and promote IL-10 secretion via the mevalonate pathway.. This sphingolipid-mevalonateIL-10 axis drives anti-inflammatory responses, linking microbial sphingolipid delivery to host immunometabolism and the resolution of inflammation.. Sphingolipid-deficient vesicles Sphingolipid-enriched vesicles

    Isolation:

    Article Title: Bacteroides sphingolipids promote anti-inflammatory responses through the mevalonate pathway.
    Article Snippet: In brief Brown et al. show that bacterial sphingolipids delivered by outer membrane vesicles (OMVs) persist within mammalian immune cells and promote IL-10 secretion via the mevalonate pathway.. This sphingolipid-mevalonateIL-10 axis drives anti-inflammatory responses, linking microbial sphingolipid delivery to host immunometabolism and the resolution of inflammation.. Sphingolipid-deficient vesicles Sphingolipid-enriched vesicles

    Cell Isolation:

    Article Title: Bacteroides sphingolipids promote anti-inflammatory responses through the mevalonate pathway.
    Article Snippet: In brief Brown et al. show that bacterial sphingolipids delivered by outer membrane vesicles (OMVs) persist within mammalian immune cells and promote IL-10 secretion via the mevalonate pathway.. This sphingolipid-mevalonateIL-10 axis drives anti-inflammatory responses, linking microbial sphingolipid delivery to host immunometabolism and the resolution of inflammation.. Sphingolipid-deficient vesicles Sphingolipid-enriched vesicles

    Bradford Protein Assay:

    Article Title: Bacteroides sphingolipids promote anti-inflammatory responses through the mevalonate pathway.
    Article Snippet: In brief Brown et al. show that bacterial sphingolipids delivered by outer membrane vesicles (OMVs) persist within mammalian immune cells and promote IL-10 secretion via the mevalonate pathway.. This sphingolipid-mevalonateIL-10 axis drives anti-inflammatory responses, linking microbial sphingolipid delivery to host immunometabolism and the resolution of inflammation.. Sphingolipid-deficient vesicles Sphingolipid-enriched vesicles

    Metabolomic:

    Article Title: Bacteroides sphingolipids promote anti-inflammatory responses through the mevalonate pathway.
    Article Snippet: In brief Brown et al. show that bacterial sphingolipids delivered by outer membrane vesicles (OMVs) persist within mammalian immune cells and promote IL-10 secretion via the mevalonate pathway.. This sphingolipid-mevalonateIL-10 axis drives anti-inflammatory responses, linking microbial sphingolipid delivery to host immunometabolism and the resolution of inflammation.. Sphingolipid-deficient vesicles Sphingolipid-enriched vesicles

    Software:

    Article Title: Bacteroides sphingolipids promote anti-inflammatory responses through the mevalonate pathway.
    Article Snippet: In brief Brown et al. show that bacterial sphingolipids delivered by outer membrane vesicles (OMVs) persist within mammalian immune cells and promote IL-10 secretion via the mevalonate pathway.. This sphingolipid-mevalonateIL-10 axis drives anti-inflammatory responses, linking microbial sphingolipid delivery to host immunometabolism and the resolution of inflammation.. Sphingolipid-deficient vesicles Sphingolipid-enriched vesicles

    Imaging:

    Article Title: Bacteroides sphingolipids promote anti-inflammatory responses through the mevalonate pathway.
    Article Snippet: In brief Brown et al. show that bacterial sphingolipids delivered by outer membrane vesicles (OMVs) persist within mammalian immune cells and promote IL-10 secretion via the mevalonate pathway.. This sphingolipid-mevalonateIL-10 axis drives anti-inflammatory responses, linking microbial sphingolipid delivery to host immunometabolism and the resolution of inflammation.. Sphingolipid-deficient vesicles Sphingolipid-enriched vesicles

    Cell Culture:

    Article Title: Bacteroides sphingolipids promote anti-inflammatory responses through the mevalonate pathway.
    Article Snippet: In brief Brown et al. show that bacterial sphingolipids delivered by outer membrane vesicles (OMVs) persist within mammalian immune cells and promote IL-10 secretion via the mevalonate pathway.. This sphingolipid-mevalonateIL-10 axis drives anti-inflammatory responses, linking microbial sphingolipid delivery to host immunometabolism and the resolution of inflammation.. Sphingolipid-deficient vesicles Sphingolipid-enriched vesicles

    other:

    Article Title: Biosynthesis of the Central Tricyclic Skeleton of Trichothecene Mycotoxins.
    Article Snippet: Pure LinkTM RNA kit and Superscript III Reverse Transcriptase Kit were purchased from Thermo Fisher Scientific.

    Article Title: The receptor-like cytoplasmic kinase OsSTRK1 regulates brassinosteroid signaling by phosphorylating OsGSK2.
    Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies Anti-OsGSK2 Beijing Protein Innovation AbP80050-A-SE Anti-OsBZR1 Beijing Protein Innovation AbP80050-A-SE Anti-Actin ABclonal Cat. # AC004; RRID:AB_2737399 Anti-MYC ABclonal Cat. # AE010; RRID:AB_2770408 Anti-FLAG ABclonal Cat. # AE005; RRID:AB_2770401 Anti-HA ABclonal Cat. # AE008; RRID:AB_2770404 Anti-pan Phospho Ser/Thr Beyotime Cat. # AF5725 Anti-pan Phospho Tyr Beyotime Cat. # AF5728 Anti-His Proteintech Cat. # HRP-66005; RRID:AB_2857904 Anti-GST Proteintech Cat. # HRP-66001; RRID:AB_2883833 Anti-MBP Ablonal Cat. # AE016; RRID:AB_2770406 Anti-H3 Millipore Cat. # 06-755; RRID:AB_11211742 Goat anti-mouse IgG secondary antibody, HRP Conjugated Beyotime Cat. # A0216 Goat anti-rabbit IgG secondary antibody, HRP Conjugated Beyotime Cat. # A0208 Bacterial and virus strains Escherichia coli Trans5a TransGen Biotech Cat. # CD201 Escherichia coli Rosetta (DE3) Beyotime Cat. # D1065S Agrobacterium tumefaciens GV3101 (pSoup-p19) Coolaber Cat. # CC407 Saccharomyces cerevisiae AH109 ZOMANBIO Cat. # ZC1604 Chemicals, peptides, and recombinant proteins TRIzol reagent ThermoFisher Cat. # 15596026 Synergy Brands Green Real-Time PCR Master Mix TOYOBO Cat. # QPK-201 SD -Trp-Leu Takara Cat. # 630316 SD -Ttp-Leu-His-Ade Takara Cat. # 630322 X-a-Gal Takara Cat. # 630463 Glutathione resin Beyotime Cat. # P2250 rProtein A sepharose GE Healthcare Cat. # 17-1279-03 Phos-tag APExBIO Cat. # F4002 Yoshida nutrient solution Coolaber Cat. # NSP1040 Protease Inhibitor Cocktail Sigma-Aldrich Cat. # P9599 DMSO Sigma-Aldrich Cat. # 5879 MG132 Selleck Cat. # S2619 CHX Selleck Cat. # S7418 24-epiBL Selleck Cat. # S8870 BIKININ Selleck Cat. # S7722 ATP Invivogen Cat. # tlrl-atpl Cellulase R-10 Yakult Cat. # L0012 Macerozyme R-10 Yakult Cat. # L0021 Critical commercial assays SuperScript III transcriptase kit ThermoFisher Cat. # 18080093 His tag protein purification kit Beyotime Cat. # P2226 GST tag protein purification kit Beyotime Cat. # P2262 SE seamless cloning and assembly kit ZOMANBIO Cat. # C231 (Continued on next page) 14 Cell Reports 44, 115569, April 22, 2025

    Sequencing:

    Article Title: Development of a Pentacistronic Ebola Virus Minigenome System
    Article Snippet: Purification was achieved with the Direct-zol RNA MiniPrep Kit (Zymo Research, Tustin, CA, USA) with in-column DNase I treatment according to the manufacturer’s directions. vRNA quantification was conducted using 2-step RT-qPCR methods. .. Reverse transcription was performed using the SuperScript III or SuperScript IV Reverse Transcriptase kit (Thermo Fisher Scientific, Waltham, MA, USA) per manufacturer’s instructions with an EBOV trailer-specific primer (sequence: CTATATTTAGCCTCTCTCCC) for vRNA amplification. .. The resulting cDNA was subjected to qPCR with SYBR Green (Applied Biosystems, Waltham, MA, USA).

    Amplification:

    Article Title: Development of a Pentacistronic Ebola Virus Minigenome System
    Article Snippet: Purification was achieved with the Direct-zol RNA MiniPrep Kit (Zymo Research, Tustin, CA, USA) with in-column DNase I treatment according to the manufacturer’s directions. vRNA quantification was conducted using 2-step RT-qPCR methods. .. Reverse transcription was performed using the SuperScript III or SuperScript IV Reverse Transcriptase kit (Thermo Fisher Scientific, Waltham, MA, USA) per manufacturer’s instructions with an EBOV trailer-specific primer (sequence: CTATATTTAGCCTCTCTCCC) for vRNA amplification. .. The resulting cDNA was subjected to qPCR with SYBR Green (Applied Biosystems, Waltham, MA, USA).



    Similar Products

    90
    Thermo Fisher superscript tm iii reverse transcriptase system
    Superscript Tm Iii Reverse Transcriptase System, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/superscript+tm+iii+reverse+transcriptase/superscript+iii+reverse+transcriptase/pm40609538-844-36-42
    Average 90 stars, based on 1 article reviews
    superscript tm iii reverse transcriptase system - by Bioz Stars, 2026-09
    90/100 stars
      Buy from Supplier

    90
    Thermo Fisher superscript tm iii reverse transcriptase
    Superscript Tm Iii Reverse Transcriptase, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/superscript+tm+iii+reverse+transcriptase/high+capacity+cdna+reverse+transcription+kit/pmc11810870-89-8-13
    Average 90 stars, based on 1 article reviews
    superscript tm iii reverse transcriptase - by Bioz Stars, 2026-09
    90/100 stars
      Buy from Supplier

    90
    Thermo Fisher superscript tm iii reverse transcriptase kit
    Superscript Tm Iii Reverse Transcriptase Kit, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/superscript+tm+iii+reverse+transcriptase/superscript+iii+reverse+transcriptase+kit/pmc11413725-87-11-20
    Average 90 stars, based on 1 article reviews
    superscript tm iii reverse transcriptase kit - by Bioz Stars, 2026-09
    90/100 stars
      Buy from Supplier

    90
    Thermo Fisher superscript tm iii reverse transcriptase enzyme
    Superscript Tm Iii Reverse Transcriptase Enzyme, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/superscript+tm+iii+reverse+transcriptase/bio_rxiv__2024__05__31__596889-68-27-33
    Average 90 stars, based on 1 article reviews
    superscript tm iii reverse transcriptase enzyme - by Bioz Stars, 2026-09
    90/100 stars
      Buy from Supplier

    Image Search Results