Review




Structured Review

Promega pgl2-basic-luc
Pgl2 Basic Luc, supplied by Promega, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/pgl2-basic-luc/pgl3+basic/pmc04826173-184-17-18
Average 90 stars, based on 1 article reviews
pgl2-basic-luc - by Bioz Stars, 2026-10
90/100 stars

Images

Related Articles

Luciferase:

Article Title: Proline hydroxylation of CREB-regulated transcriptional coactivator 2 controls hepatic glucose metabolism
Article Snippet: .. Dual luciferase activity assays—HEK293T cells were co-transfected with 0.5 μg of empty vector or plasmids encoding CRTC2 variants as indicated, along with 0.5 μg luciferase reporter plasmids and 80 ng of Renilla luciferase plasmid pRL-SV40 (Promega) as an internal control in 12 well plates. ..

Activity Assay:

Article Title: Proline hydroxylation of CREB-regulated transcriptional coactivator 2 controls hepatic glucose metabolism
Article Snippet: .. Dual luciferase activity assays—HEK293T cells were co-transfected with 0.5 μg of empty vector or plasmids encoding CRTC2 variants as indicated, along with 0.5 μg luciferase reporter plasmids and 80 ng of Renilla luciferase plasmid pRL-SV40 (Promega) as an internal control in 12 well plates. ..

Plasmid Preparation:

Article Title: Proline hydroxylation of CREB-regulated transcriptional coactivator 2 controls hepatic glucose metabolism
Article Snippet: .. Dual luciferase activity assays—HEK293T cells were co-transfected with 0.5 μg of empty vector or plasmids encoding CRTC2 variants as indicated, along with 0.5 μg luciferase reporter plasmids and 80 ng of Renilla luciferase plasmid pRL-SV40 (Promega) as an internal control in 12 well plates. ..

Control:

Article Title: Proline hydroxylation of CREB-regulated transcriptional coactivator 2 controls hepatic glucose metabolism
Article Snippet: .. Dual luciferase activity assays—HEK293T cells were co-transfected with 0.5 μg of empty vector or plasmids encoding CRTC2 variants as indicated, along with 0.5 μg luciferase reporter plasmids and 80 ng of Renilla luciferase plasmid pRL-SV40 (Promega) as an internal control in 12 well plates. ..

other:

Article Title:
Article Snippet: The plasmids for enhancer activity analysis were generated from pNL1.1 (Promega, N1001) (Supplemental Fig. S9B), and the plasmid served as the internal reference was generated from pGL4.10 (Promega, E6651) by insert a promoter of BmNPV ie-1 before luc2 (Supplemental Fig. S9A), which enables stable expression of the reference luciferase in BmN cells.

Article Title: Egr-1 promotes the proliferation and migration of vascular smooth muscle cells by transcriptionally activating Egr-2 in arteriovenous fistulas
Article Snippet: Rat EGR1 promoter (~1.3 Kb; PCR-amplified from rat VSMCs) cloned into pGL3-basic luciferase rep plasmid (Promega Corporation) to form EGR1 luciferase reporters.

Article Title: Folie 1
Article Snippet: Vendor Bulk anti-TGFB1,2,3 In Vivo 1D11.1 Human, Mouse, Bovine, Chicken Mouse IgG1 10μg/gBW AB_292143 6 Ichorbio Mouse IgG1 Isotype Control HKSP - Mouse IgG1 10μg/gBW AB_292138 2 Ichorbio Anti-mouse CD8 in vivo YTS169 Mouse Rat IgG2b 12,5μg/g BW AB_292144 5 Ichorbio Anti-mouse CD4 in vivo GK1.5 Mouse Rat IgG2b 12,5μg/g BW AB_292144 4 Ichorbio Rat IgG2b Isotype Control in vivo 1-2 - Rat IgG2b 12,5μg/g BW AB_292137 8 Ichorbio Supplementary Table S3: Primers used for RT-qPCR Target gene Direction Sequence (5’3’) GC [%] Length TM hu-TGF-β1 Fwd ATTCCTGGCGATACCTCAGC 55 20 59,4 hu-TGF-β1 Rev CGGTAGTGAACCCGTTGATG 55 20 59,4 hu-GAPDH Fwd GTCAGTGGTGGACCTGACCT 60 20 61,4 hu-GAPDH Rev TGAGCTTGACAAAGTGGTCG 50 20 57,3 Supplementary Table S4: Expression vectors Name Backbone Insert (cDNA) Selection marker RRID/parentage pMIG pMSCV empty IRES-GFP RRID:Addgene_ 9044 pMIG-CALRWT pMSCV Human CALRWT IRES-GFP Provided by Ann Mullally pMIG-CALRins5 pMSCV Human CALRins5 IRES-GFP Provided by Ann Mullally 9 pMIG-CALRdel52 pMSCV Human CALRdel52 IRES-GFP Provided by Ann Mullally pMSCV-MPL pMSCV Human MPL PKG- hygromycin resistance gene Provided by Ann Mullally pMIG-JAK2WT pMSCV Human JAK2WT IRES-GFP Provided by Justus Duyster pMIG-JAK2V617F pMSCV Human JAK2V617F IRES-GFP Provided by Justus Duyster pMSCV-EpoR pMSCV Human EPOR neomycin resistance gene In-house pMIG-STAT3WT pMX Human STAT3WT IRES-GFP In-house pMIGSTAT3V640F pMX Human STAT3V640F IRES-GFP In-house pGL4.73[ hRluc/SV40] pGL4 SV40 early enhancer, rRluc renilla luciferase Promega (E691A) pGL3-TGFb1 pGL3 Human TGFb1 promoter luciferase RRID:Addgene_ 101762 References: 1.

Article Title:
Article Snippet: RIG-I ubiquitination assays Purification of GST-RIG-I 2CARD from mammalian cells was done as previously described (8, 11). pEBGRIG-I 2CARD (4 μg) and pcDNA4 carrying indicated gene or pCAGGS-NS1 (Influenza A virus, 10 μg) (7) and pGL4.45[luc2P/ISRE/Hygro] (Promega) (100 ng) were transfected with Mirus TransIT-LT1 into 5x106 HEK293T cells in a 10 cm2 dish in DMEM high glucose with 5% FBS per manufacturer guidelines.

Article Title:
Article Snippet: The constructed pGL3-ELO11 reporter plasmid was cotransfected 211 with the pac-dsxM or pac-dsxF expression plasmid by FuGENE HD Transfection Reagent 212 (Promega) into Sf9 cells.

Article Title:
Article Snippet: A total of 24 h after gene KD in 6-well culture plates, 2 μg TOPFlash and 0.5 μg pRL (Promega, E2261) plasmids were transfected into SH-SY5Y cells (7.5×105) using FuGENE HD Transfection Reagent (Promega).

Article Title:
Article Snippet: A total of 2 μg of DKK1 promoter and 0.5 μg of pRL (Promega, E2261) plasmids were transfected into SH-SY5Y cells (7.5×105) using FuGENE HD Transfection Reagent (Promega) in a 6-well culture plate.



Similar Products

86
TaKaRa pgl2 basic 2kb st2 luc
Stamp2 promoter is activated by TNFα and p50. (A) 3T3-L1 cells with stable expression of either the <t>−2kb-ST2-LUC</t> or a <t>BASIC-LUC</t> reporters were differentiated into adipocytes, treated with TNFα (10 ng/ml) or vehicle (Ctrl) for 24 h and subjected to qRT-PCR analysis and (B) LUC assay. Values are presented as fold activity compared to vehicle. Results are from two independent experiments, n=9 for each sample. (C) HeLa cells were co-transfected with either 2xNFκB-LUC or −2kb-ST2-LUC (ST2-LUC), together with either AllStars (siAll) or NFKB1 (siNFKB1) siRNA. After 48 h, cells were harvested and LUC activity was determined. Values are presented as fold activity compared to control (siALL) from two independent experiments, n=6 for each sample. (D) qRT-PCR analysis of NFKB1 (p50) mRNA from the same cells used in C. Values are presented as fold activity compared to control (siALL). Results are from two independent experiments, n=6 for each sample. (E) HeLa cells were co-transfected with either 2xNFκB-LUC or −2kb-ST2-LUC (ST2-LUC), together with either a p50 expression plasmid or an empty control plasmid. After 48 h, cells were harvested and LUC activity was determined. Values are presented as fold activity compared to control (Ctrl) from two independent experiments, n=6 for each sample.
Pgl2 Basic 2kb St2 Luc, supplied by TaKaRa, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/pgl2-basic-luc/pmc06460919-67-8-17
Average 86 stars, based on 1 article reviews
pgl2 basic 2kb st2 luc - by Bioz Stars, 2026-10
86/100 stars
  Buy from Supplier

86
TaKaRa pgl2 basic luc
Stamp2 promoter is activated by TNFα and p50. (A) 3T3-L1 cells with stable expression of either the <t>−2kb-ST2-LUC</t> or a <t>BASIC-LUC</t> reporters were differentiated into adipocytes, treated with TNFα (10 ng/ml) or vehicle (Ctrl) for 24 h and subjected to qRT-PCR analysis and (B) LUC assay. Values are presented as fold activity compared to vehicle. Results are from two independent experiments, n=9 for each sample. (C) HeLa cells were co-transfected with either 2xNFκB-LUC or −2kb-ST2-LUC (ST2-LUC), together with either AllStars (siAll) or NFKB1 (siNFKB1) siRNA. After 48 h, cells were harvested and LUC activity was determined. Values are presented as fold activity compared to control (siALL) from two independent experiments, n=6 for each sample. (D) qRT-PCR analysis of NFKB1 (p50) mRNA from the same cells used in C. Values are presented as fold activity compared to control (siALL). Results are from two independent experiments, n=6 for each sample. (E) HeLa cells were co-transfected with either 2xNFκB-LUC or −2kb-ST2-LUC (ST2-LUC), together with either a p50 expression plasmid or an empty control plasmid. After 48 h, cells were harvested and LUC activity was determined. Values are presented as fold activity compared to control (Ctrl) from two independent experiments, n=6 for each sample.
Pgl2 Basic Luc, supplied by TaKaRa, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/pgl2-basic-luc/pmc06460919-67-6-17
Average 86 stars, based on 1 article reviews
pgl2 basic luc - by Bioz Stars, 2026-10
86/100 stars
  Buy from Supplier

99
New England Biolabs pgl2 basic luciferase vector luc
Stamp2 promoter is activated by TNFα and p50. (A) 3T3-L1 cells with stable expression of either the <t>−2kb-ST2-LUC</t> or a <t>BASIC-LUC</t> reporters were differentiated into adipocytes, treated with TNFα (10 ng/ml) or vehicle (Ctrl) for 24 h and subjected to qRT-PCR analysis and (B) LUC assay. Values are presented as fold activity compared to vehicle. Results are from two independent experiments, n=9 for each sample. (C) HeLa cells were co-transfected with either 2xNFκB-LUC or −2kb-ST2-LUC (ST2-LUC), together with either AllStars (siAll) or NFKB1 (siNFKB1) siRNA. After 48 h, cells were harvested and LUC activity was determined. Values are presented as fold activity compared to control (siALL) from two independent experiments, n=6 for each sample. (D) qRT-PCR analysis of NFKB1 (p50) mRNA from the same cells used in C. Values are presented as fold activity compared to control (siALL). Results are from two independent experiments, n=6 for each sample. (E) HeLa cells were co-transfected with either 2xNFκB-LUC or −2kb-ST2-LUC (ST2-LUC), together with either a p50 expression plasmid or an empty control plasmid. After 48 h, cells were harvested and LUC activity was determined. Values are presented as fold activity compared to control (Ctrl) from two independent experiments, n=6 for each sample.
Pgl2 Basic Luciferase Vector Luc, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/pgl2-basic-luc/XhoI/pmc05755924-180-6-19
Average 99 stars, based on 1 article reviews
pgl2 basic luciferase vector luc - by Bioz Stars, 2026-10
99/100 stars
  Buy from Supplier

90
Promega dnmt1-luc, containing the sequence from −25 to +232 of the human dnmt1 promoter in pgl2-basic vector
Stamp2 promoter is activated by TNFα and p50. (A) 3T3-L1 cells with stable expression of either the <t>−2kb-ST2-LUC</t> or a <t>BASIC-LUC</t> reporters were differentiated into adipocytes, treated with TNFα (10 ng/ml) or vehicle (Ctrl) for 24 h and subjected to qRT-PCR analysis and (B) LUC assay. Values are presented as fold activity compared to vehicle. Results are from two independent experiments, n=9 for each sample. (C) HeLa cells were co-transfected with either 2xNFκB-LUC or −2kb-ST2-LUC (ST2-LUC), together with either AllStars (siAll) or NFKB1 (siNFKB1) siRNA. After 48 h, cells were harvested and LUC activity was determined. Values are presented as fold activity compared to control (siALL) from two independent experiments, n=6 for each sample. (D) qRT-PCR analysis of NFKB1 (p50) mRNA from the same cells used in C. Values are presented as fold activity compared to control (siALL). Results are from two independent experiments, n=6 for each sample. (E) HeLa cells were co-transfected with either 2xNFκB-LUC or −2kb-ST2-LUC (ST2-LUC), together with either a p50 expression plasmid or an empty control plasmid. After 48 h, cells were harvested and LUC activity was determined. Values are presented as fold activity compared to control (Ctrl) from two independent experiments, n=6 for each sample.
Dnmt1 Luc, Containing The Sequence From −25 To +232 Of The Human Dnmt1 Promoter In Pgl2 Basic Vector, supplied by Promega, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/pgl2-basic-luc/pgl2+based+ucp2+firefly+luciferase+constructs/pm27317649-46-1-17
Average 90 stars, based on 1 article reviews
dnmt1-luc, containing the sequence from −25 to +232 of the human dnmt1 promoter in pgl2-basic vector - by Bioz Stars, 2026-10
90/100 stars
  Buy from Supplier

90
Promega pgl2-luc basic reporter plasmid
Stamp2 promoter is activated by TNFα and p50. (A) 3T3-L1 cells with stable expression of either the <t>−2kb-ST2-LUC</t> or a <t>BASIC-LUC</t> reporters were differentiated into adipocytes, treated with TNFα (10 ng/ml) or vehicle (Ctrl) for 24 h and subjected to qRT-PCR analysis and (B) LUC assay. Values are presented as fold activity compared to vehicle. Results are from two independent experiments, n=9 for each sample. (C) HeLa cells were co-transfected with either 2xNFκB-LUC or −2kb-ST2-LUC (ST2-LUC), together with either AllStars (siAll) or NFKB1 (siNFKB1) siRNA. After 48 h, cells were harvested and LUC activity was determined. Values are presented as fold activity compared to control (siALL) from two independent experiments, n=6 for each sample. (D) qRT-PCR analysis of NFKB1 (p50) mRNA from the same cells used in C. Values are presented as fold activity compared to control (siALL). Results are from two independent experiments, n=6 for each sample. (E) HeLa cells were co-transfected with either 2xNFκB-LUC or −2kb-ST2-LUC (ST2-LUC), together with either a p50 expression plasmid or an empty control plasmid. After 48 h, cells were harvested and LUC activity was determined. Values are presented as fold activity compared to control (Ctrl) from two independent experiments, n=6 for each sample.
Pgl2 Luc Basic Reporter Plasmid, supplied by Promega, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/pgl2-basic-luc/pgl3+basic/pm26850053-124-26-30
Average 90 stars, based on 1 article reviews
pgl2-luc basic reporter plasmid - by Bioz Stars, 2026-10
90/100 stars
  Buy from Supplier

90
Promega pgl2-basic-luc
Stamp2 promoter is activated by TNFα and p50. (A) 3T3-L1 cells with stable expression of either the <t>−2kb-ST2-LUC</t> or a <t>BASIC-LUC</t> reporters were differentiated into adipocytes, treated with TNFα (10 ng/ml) or vehicle (Ctrl) for 24 h and subjected to qRT-PCR analysis and (B) LUC assay. Values are presented as fold activity compared to vehicle. Results are from two independent experiments, n=9 for each sample. (C) HeLa cells were co-transfected with either 2xNFκB-LUC or −2kb-ST2-LUC (ST2-LUC), together with either AllStars (siAll) or NFKB1 (siNFKB1) siRNA. After 48 h, cells were harvested and LUC activity was determined. Values are presented as fold activity compared to control (siALL) from two independent experiments, n=6 for each sample. (D) qRT-PCR analysis of NFKB1 (p50) mRNA from the same cells used in C. Values are presented as fold activity compared to control (siALL). Results are from two independent experiments, n=6 for each sample. (E) HeLa cells were co-transfected with either 2xNFκB-LUC or −2kb-ST2-LUC (ST2-LUC), together with either a p50 expression plasmid or an empty control plasmid. After 48 h, cells were harvested and LUC activity was determined. Values are presented as fold activity compared to control (Ctrl) from two independent experiments, n=6 for each sample.
Pgl2 Basic Luc, supplied by Promega, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/pgl2-basic-luc/pgl3+basic/pmc04826173-184-17-18
Average 90 stars, based on 1 article reviews
pgl2-basic-luc - by Bioz Stars, 2026-10
90/100 stars
  Buy from Supplier

90
Promega pgl2-basic-lxre-luc
Stamp2 promoter is activated by TNFα and p50. (A) 3T3-L1 cells with stable expression of either the <t>−2kb-ST2-LUC</t> or a <t>BASIC-LUC</t> reporters were differentiated into adipocytes, treated with TNFα (10 ng/ml) or vehicle (Ctrl) for 24 h and subjected to qRT-PCR analysis and (B) LUC assay. Values are presented as fold activity compared to vehicle. Results are from two independent experiments, n=9 for each sample. (C) HeLa cells were co-transfected with either 2xNFκB-LUC or −2kb-ST2-LUC (ST2-LUC), together with either AllStars (siAll) or NFKB1 (siNFKB1) siRNA. After 48 h, cells were harvested and LUC activity was determined. Values are presented as fold activity compared to control (siALL) from two independent experiments, n=6 for each sample. (D) qRT-PCR analysis of NFKB1 (p50) mRNA from the same cells used in C. Values are presented as fold activity compared to control (siALL). Results are from two independent experiments, n=6 for each sample. (E) HeLa cells were co-transfected with either 2xNFκB-LUC or −2kb-ST2-LUC (ST2-LUC), together with either a p50 expression plasmid or an empty control plasmid. After 48 h, cells were harvested and LUC activity was determined. Values are presented as fold activity compared to control (Ctrl) from two independent experiments, n=6 for each sample.
Pgl2 Basic Lxre Luc, supplied by Promega, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/pgl2-basic-luc/pgl3+basic/pmc04471739-92-13-23
Average 90 stars, based on 1 article reviews
pgl2-basic-lxre-luc - by Bioz Stars, 2026-10
90/100 stars
  Buy from Supplier

90
Promega pgl2-basic firefly luciferase (luc) reporter plasmid
Stamp2 promoter is activated by TNFα and p50. (A) 3T3-L1 cells with stable expression of either the <t>−2kb-ST2-LUC</t> or a <t>BASIC-LUC</t> reporters were differentiated into adipocytes, treated with TNFα (10 ng/ml) or vehicle (Ctrl) for 24 h and subjected to qRT-PCR analysis and (B) LUC assay. Values are presented as fold activity compared to vehicle. Results are from two independent experiments, n=9 for each sample. (C) HeLa cells were co-transfected with either 2xNFκB-LUC or −2kb-ST2-LUC (ST2-LUC), together with either AllStars (siAll) or NFKB1 (siNFKB1) siRNA. After 48 h, cells were harvested and LUC activity was determined. Values are presented as fold activity compared to control (siALL) from two independent experiments, n=6 for each sample. (D) qRT-PCR analysis of NFKB1 (p50) mRNA from the same cells used in C. Values are presented as fold activity compared to control (siALL). Results are from two independent experiments, n=6 for each sample. (E) HeLa cells were co-transfected with either 2xNFκB-LUC or −2kb-ST2-LUC (ST2-LUC), together with either a p50 expression plasmid or an empty control plasmid. After 48 h, cells were harvested and LUC activity was determined. Values are presented as fold activity compared to control (Ctrl) from two independent experiments, n=6 for each sample.
Pgl2 Basic Firefly Luciferase (Luc) Reporter Plasmid, supplied by Promega, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/pgl2-basic-luc/pgl3+basic/pmc03829340-166-7-13
Average 90 stars, based on 1 article reviews
pgl2-basic firefly luciferase (luc) reporter plasmid - by Bioz Stars, 2026-10
90/100 stars
  Buy from Supplier

Image Search Results


Stamp2 promoter is activated by TNFα and p50. (A) 3T3-L1 cells with stable expression of either the −2kb-ST2-LUC or a BASIC-LUC reporters were differentiated into adipocytes, treated with TNFα (10 ng/ml) or vehicle (Ctrl) for 24 h and subjected to qRT-PCR analysis and (B) LUC assay. Values are presented as fold activity compared to vehicle. Results are from two independent experiments, n=9 for each sample. (C) HeLa cells were co-transfected with either 2xNFκB-LUC or −2kb-ST2-LUC (ST2-LUC), together with either AllStars (siAll) or NFKB1 (siNFKB1) siRNA. After 48 h, cells were harvested and LUC activity was determined. Values are presented as fold activity compared to control (siALL) from two independent experiments, n=6 for each sample. (D) qRT-PCR analysis of NFKB1 (p50) mRNA from the same cells used in C. Values are presented as fold activity compared to control (siALL). Results are from two independent experiments, n=6 for each sample. (E) HeLa cells were co-transfected with either 2xNFκB-LUC or −2kb-ST2-LUC (ST2-LUC), together with either a p50 expression plasmid or an empty control plasmid. After 48 h, cells were harvested and LUC activity was determined. Values are presented as fold activity compared to control (Ctrl) from two independent experiments, n=6 for each sample.

Journal: Metabolism: clinical and experimental

Article Title: Inflammation and ER stress differentially regulate STAMP2 expression and localization in adipocytes

doi: 10.1016/j.metabol.2019.01.014

Figure Lengend Snippet: Stamp2 promoter is activated by TNFα and p50. (A) 3T3-L1 cells with stable expression of either the −2kb-ST2-LUC or a BASIC-LUC reporters were differentiated into adipocytes, treated with TNFα (10 ng/ml) or vehicle (Ctrl) for 24 h and subjected to qRT-PCR analysis and (B) LUC assay. Values are presented as fold activity compared to vehicle. Results are from two independent experiments, n=9 for each sample. (C) HeLa cells were co-transfected with either 2xNFκB-LUC or −2kb-ST2-LUC (ST2-LUC), together with either AllStars (siAll) or NFKB1 (siNFKB1) siRNA. After 48 h, cells were harvested and LUC activity was determined. Values are presented as fold activity compared to control (siALL) from two independent experiments, n=6 for each sample. (D) qRT-PCR analysis of NFKB1 (p50) mRNA from the same cells used in C. Values are presented as fold activity compared to control (siALL). Results are from two independent experiments, n=6 for each sample. (E) HeLa cells were co-transfected with either 2xNFκB-LUC or −2kb-ST2-LUC (ST2-LUC), together with either a p50 expression plasmid or an empty control plasmid. After 48 h, cells were harvested and LUC activity was determined. Values are presented as fold activity compared to control (Ctrl) from two independent experiments, n=6 for each sample.

Article Snippet: To make stable reporter cells, linearized pGL2-BASIC-LUC or pGL2-BASIC-2kb-ST2-LUC was co-transfected with the linearized selection vector pPur (Clontech) in a 5:1 ratio using Lipofectamine 2000 (Invitrogen) as transfection agent.

Techniques: Expressing, Quantitative RT-PCR, Activity Assay, Transfection, Plasmid Preparation

Stamp2 promoter activity requires C/EBPα. (A) 3T3-L1 cells stably expressing the −2kb-ST2-LUC reporter were differentiated into adipocytes. They were then left untreated or incubated with Tg (300 nM), or Tu (2 ng/ml) for 24 h. Cells were then harvested and LUC activity was determined. Results are from two independent experiments, n=8 for each sample. (B) 3T3-L1 cells with stable expression of the −2kb-ST2-LUC reporter were transfected with either AllStar (siAll) or Cepba (siCEBPA) targeted siRNA, and differentiated towards adipocytes for 4 days. Cells were then harvested and LUC activities were determined. Values are presented as fold activity compared to control (siALL) from two independent experiments, n=6 for each sample. (C) qRT-PCR analysis of CEBPA mRNA from the same cells used in (B). (D) Overview of two predicted C/EBPα binding motifs (C/EBP1 and 2) in the mouse Stamp2 promoter. The nucleotides that are mutated are underlined. (E) HeLa cells were co-transfected with an expression vector for C/EBPα and either BASIC-LUC reporter plasmid (Ctrl), the wild-type −2kb-ST2-LUC, or a −2kb-ST2-LUC reporter construct mutated in C/EBP1 or C/EBP2 binding sites (MUT1 and MUT2, respectively). After 24 h, cells were harvested and LUC activities were determined. The data shown are from three independent experiments, n=9 for each sample.

Journal: Metabolism: clinical and experimental

Article Title: Inflammation and ER stress differentially regulate STAMP2 expression and localization in adipocytes

doi: 10.1016/j.metabol.2019.01.014

Figure Lengend Snippet: Stamp2 promoter activity requires C/EBPα. (A) 3T3-L1 cells stably expressing the −2kb-ST2-LUC reporter were differentiated into adipocytes. They were then left untreated or incubated with Tg (300 nM), or Tu (2 ng/ml) for 24 h. Cells were then harvested and LUC activity was determined. Results are from two independent experiments, n=8 for each sample. (B) 3T3-L1 cells with stable expression of the −2kb-ST2-LUC reporter were transfected with either AllStar (siAll) or Cepba (siCEBPA) targeted siRNA, and differentiated towards adipocytes for 4 days. Cells were then harvested and LUC activities were determined. Values are presented as fold activity compared to control (siALL) from two independent experiments, n=6 for each sample. (C) qRT-PCR analysis of CEBPA mRNA from the same cells used in (B). (D) Overview of two predicted C/EBPα binding motifs (C/EBP1 and 2) in the mouse Stamp2 promoter. The nucleotides that are mutated are underlined. (E) HeLa cells were co-transfected with an expression vector for C/EBPα and either BASIC-LUC reporter plasmid (Ctrl), the wild-type −2kb-ST2-LUC, or a −2kb-ST2-LUC reporter construct mutated in C/EBP1 or C/EBP2 binding sites (MUT1 and MUT2, respectively). After 24 h, cells were harvested and LUC activities were determined. The data shown are from three independent experiments, n=9 for each sample.

Article Snippet: To make stable reporter cells, linearized pGL2-BASIC-LUC or pGL2-BASIC-2kb-ST2-LUC was co-transfected with the linearized selection vector pPur (Clontech) in a 5:1 ratio using Lipofectamine 2000 (Invitrogen) as transfection agent.

Techniques: Activity Assay, Stable Transfection, Expressing, Incubation, Transfection, Quantitative RT-PCR, Binding Assay, Plasmid Preparation, Construct

Stamp2 promoter is activated by TNFα and p50. (A) 3T3-L1 cells with stable expression of either the −2kb-ST2-LUC or a BASIC-LUC reporters were differentiated into adipocytes, treated with TNFα (10 ng/ml) or vehicle (Ctrl) for 24 h and subjected to qRT-PCR analysis and (B) LUC assay. Values are presented as fold activity compared to vehicle. Results are from two independent experiments, n=9 for each sample. (C) HeLa cells were co-transfected with either 2xNFκB-LUC or −2kb-ST2-LUC (ST2-LUC), together with either AllStars (siAll) or NFKB1 (siNFKB1) siRNA. After 48 h, cells were harvested and LUC activity was determined. Values are presented as fold activity compared to control (siALL) from two independent experiments, n=6 for each sample. (D) qRT-PCR analysis of NFKB1 (p50) mRNA from the same cells used in C. Values are presented as fold activity compared to control (siALL). Results are from two independent experiments, n=6 for each sample. (E) HeLa cells were co-transfected with either 2xNFκB-LUC or −2kb-ST2-LUC (ST2-LUC), together with either a p50 expression plasmid or an empty control plasmid. After 48 h, cells were harvested and LUC activity was determined. Values are presented as fold activity compared to control (Ctrl) from two independent experiments, n=6 for each sample.

Journal: Metabolism: clinical and experimental

Article Title: Inflammation and ER stress differentially regulate STAMP2 expression and localization in adipocytes

doi: 10.1016/j.metabol.2019.01.014

Figure Lengend Snippet: Stamp2 promoter is activated by TNFα and p50. (A) 3T3-L1 cells with stable expression of either the −2kb-ST2-LUC or a BASIC-LUC reporters were differentiated into adipocytes, treated with TNFα (10 ng/ml) or vehicle (Ctrl) for 24 h and subjected to qRT-PCR analysis and (B) LUC assay. Values are presented as fold activity compared to vehicle. Results are from two independent experiments, n=9 for each sample. (C) HeLa cells were co-transfected with either 2xNFκB-LUC or −2kb-ST2-LUC (ST2-LUC), together with either AllStars (siAll) or NFKB1 (siNFKB1) siRNA. After 48 h, cells were harvested and LUC activity was determined. Values are presented as fold activity compared to control (siALL) from two independent experiments, n=6 for each sample. (D) qRT-PCR analysis of NFKB1 (p50) mRNA from the same cells used in C. Values are presented as fold activity compared to control (siALL). Results are from two independent experiments, n=6 for each sample. (E) HeLa cells were co-transfected with either 2xNFκB-LUC or −2kb-ST2-LUC (ST2-LUC), together with either a p50 expression plasmid or an empty control plasmid. After 48 h, cells were harvested and LUC activity was determined. Values are presented as fold activity compared to control (Ctrl) from two independent experiments, n=6 for each sample.

Article Snippet: To make stable reporter cells, linearized pGL2-BASIC-LUC or pGL2-BASIC-2kb-ST2-LUC was co-transfected with the linearized selection vector pPur (Clontech) in a 5:1 ratio using Lipofectamine 2000 (Invitrogen) as transfection agent.

Techniques: Expressing, Quantitative RT-PCR, Activity Assay, Transfection, Plasmid Preparation

Stamp2 promoter activity requires C/EBPα. (A) 3T3-L1 cells stably expressing the −2kb-ST2-LUC reporter were differentiated into adipocytes. They were then left untreated or incubated with Tg (300 nM), or Tu (2 ng/ml) for 24 h. Cells were then harvested and LUC activity was determined. Results are from two independent experiments, n=8 for each sample. (B) 3T3-L1 cells with stable expression of the −2kb-ST2-LUC reporter were transfected with either AllStar (siAll) or Cepba (siCEBPA) targeted siRNA, and differentiated towards adipocytes for 4 days. Cells were then harvested and LUC activities were determined. Values are presented as fold activity compared to control (siALL) from two independent experiments, n=6 for each sample. (C) qRT-PCR analysis of CEBPA mRNA from the same cells used in (B). (D) Overview of two predicted C/EBPα binding motifs (C/EBP1 and 2) in the mouse Stamp2 promoter. The nucleotides that are mutated are underlined. (E) HeLa cells were co-transfected with an expression vector for C/EBPα and either BASIC-LUC reporter plasmid (Ctrl), the wild-type −2kb-ST2-LUC, or a −2kb-ST2-LUC reporter construct mutated in C/EBP1 or C/EBP2 binding sites (MUT1 and MUT2, respectively). After 24 h, cells were harvested and LUC activities were determined. The data shown are from three independent experiments, n=9 for each sample.

Journal: Metabolism: clinical and experimental

Article Title: Inflammation and ER stress differentially regulate STAMP2 expression and localization in adipocytes

doi: 10.1016/j.metabol.2019.01.014

Figure Lengend Snippet: Stamp2 promoter activity requires C/EBPα. (A) 3T3-L1 cells stably expressing the −2kb-ST2-LUC reporter were differentiated into adipocytes. They were then left untreated or incubated with Tg (300 nM), or Tu (2 ng/ml) for 24 h. Cells were then harvested and LUC activity was determined. Results are from two independent experiments, n=8 for each sample. (B) 3T3-L1 cells with stable expression of the −2kb-ST2-LUC reporter were transfected with either AllStar (siAll) or Cepba (siCEBPA) targeted siRNA, and differentiated towards adipocytes for 4 days. Cells were then harvested and LUC activities were determined. Values are presented as fold activity compared to control (siALL) from two independent experiments, n=6 for each sample. (C) qRT-PCR analysis of CEBPA mRNA from the same cells used in (B). (D) Overview of two predicted C/EBPα binding motifs (C/EBP1 and 2) in the mouse Stamp2 promoter. The nucleotides that are mutated are underlined. (E) HeLa cells were co-transfected with an expression vector for C/EBPα and either BASIC-LUC reporter plasmid (Ctrl), the wild-type −2kb-ST2-LUC, or a −2kb-ST2-LUC reporter construct mutated in C/EBP1 or C/EBP2 binding sites (MUT1 and MUT2, respectively). After 24 h, cells were harvested and LUC activities were determined. The data shown are from three independent experiments, n=9 for each sample.

Article Snippet: To make stable reporter cells, linearized pGL2-BASIC-LUC or pGL2-BASIC-2kb-ST2-LUC was co-transfected with the linearized selection vector pPur (Clontech) in a 5:1 ratio using Lipofectamine 2000 (Invitrogen) as transfection agent.

Techniques: Activity Assay, Stable Transfection, Expressing, Incubation, Transfection, Quantitative RT-PCR, Binding Assay, Plasmid Preparation, Construct