the empty pgl3 basic vector was used as the negative control (Promega)
Structured Review

The Empty Pgl3 Basic Vector Was Used As The Negative Control, supplied by Promega, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/empty+vectors+pgl3-basic/pgl3+basic/pmc06607394-115-2-17
Average 90 stars, based on 1 article reviews
Images
1) Product Images from "Significant association of EED promoter hypomethylation with colorectal cancer"
Article Title: Significant association of EED promoter hypomethylation with colorectal cancer
Journal: Oncology Letters
doi: 10.3892/ol.2019.10432
Figure Legend Snippet: Dual-luciferase reporter assay in the 293T cell line. The pGL3-Basic and pGL3-Promoter vectors were used as negative and positive controls, respectively. The relative luciferase level is displayed for pGL3-Promoter, pGL3-Basic and pGL3-EED The pGL3-EED indicates the recombinant EED fragment ligated to the pGL3-Basic vector. An analysis of variance and Bonferroni's correction were applied for statistical analysis. P<0.05 was considered to indicate a statistically significant difference. *P<0.0001. EED, embryonic ectoderm development; Luc, luciferase.
Techniques Used: Luciferase, Reporter Assay, Recombinant, Plasmid Preparation
Related Articles
Luciferase:Article Title: Proline hydroxylation of CREB-regulated transcriptional coactivator 2 controls hepatic glucose metabolism Article Snippet: .. Dual luciferase activity assays—HEK293T cells were co-transfected with 0.5 μg of empty vector or plasmids encoding CRTC2 variants as indicated, along with 0.5 μg Activity Assay:Article Title: Proline hydroxylation of CREB-regulated transcriptional coactivator 2 controls hepatic glucose metabolism Article Snippet: .. Dual luciferase activity assays—HEK293T cells were co-transfected with 0.5 μg of empty vector or plasmids encoding CRTC2 variants as indicated, along with 0.5 μg Plasmid Preparation:Article Title: Proline hydroxylation of CREB-regulated transcriptional coactivator 2 controls hepatic glucose metabolism Article Snippet: .. Dual luciferase activity assays—HEK293T cells were co-transfected with 0.5 μg of empty vector or plasmids encoding CRTC2 variants as indicated, along with 0.5 μg Control:Article Title: Proline hydroxylation of CREB-regulated transcriptional coactivator 2 controls hepatic glucose metabolism Article Snippet: .. Dual luciferase activity assays—HEK293T cells were co-transfected with 0.5 μg of empty vector or plasmids encoding CRTC2 variants as indicated, along with 0.5 μg other:Article Title: Article Snippet: The plasmids for enhancer activity analysis were generated from Article Title: Egr-1 promotes the proliferation and migration of vascular smooth muscle cells by transcriptionally activating Egr-2 in arteriovenous fistulas Article Snippet: Rat EGR1 promoter (~1.3 Kb; PCR-amplified from rat VSMCs) cloned into Article Title: Folie 1 Article Snippet: Vendor Bulk anti-TGFB1,2,3 In Vivo 1D11.1 Human, Mouse, Bovine, Chicken Mouse IgG1 10μg/gBW AB_292143 6 Ichorbio Mouse IgG1 Isotype Control HKSP - Mouse IgG1 10μg/gBW AB_292138 2 Ichorbio Anti-mouse CD8 in vivo YTS169 Mouse Rat IgG2b 12,5μg/g BW AB_292144 5 Ichorbio Anti-mouse CD4 in vivo GK1.5 Mouse Rat IgG2b 12,5μg/g BW AB_292144 4 Ichorbio Rat IgG2b Isotype Control in vivo 1-2 - Rat IgG2b 12,5μg/g BW AB_292137 8 Ichorbio Supplementary Table S3: Primers used for RT-qPCR Target gene Direction Sequence (5’3’) GC [%] Length TM hu-TGF-β1 Fwd ATTCCTGGCGATACCTCAGC 55 20 59,4 hu-TGF-β1 Rev CGGTAGTGAACCCGTTGATG 55 20 59,4 hu-GAPDH Fwd GTCAGTGGTGGACCTGACCT 60 20 61,4 hu-GAPDH Rev TGAGCTTGACAAAGTGGTCG 50 20 57,3 Supplementary Table S4: Expression vectors Name Backbone Insert (cDNA) Selection marker RRID/parentage pMIG pMSCV empty IRES-GFP RRID:Addgene_ 9044 pMIG-CALRWT pMSCV Human CALRWT IRES-GFP Provided by Ann Mullally pMIG-CALRins5 pMSCV Human CALRins5 IRES-GFP Provided by Ann Mullally 9 pMIG-CALRdel52 pMSCV Human CALRdel52 IRES-GFP Provided by Ann Mullally pMSCV-MPL pMSCV Human MPL PKG- hygromycin resistance gene Provided by Ann Mullally pMIG-JAK2WT pMSCV Human JAK2WT IRES-GFP Provided by Justus Duyster pMIG-JAK2V617F pMSCV Human JAK2V617F IRES-GFP Provided by Justus Duyster pMSCV-EpoR pMSCV Human EPOR neomycin resistance gene In-house pMIG-STAT3WT pMX Human STAT3WT IRES-GFP In-house pMIGSTAT3V640F pMX Human STAT3V640F IRES-GFP In-house pGL4.73[ hRluc/SV40] pGL4 SV40 early enhancer, Article Title: Article Snippet: RIG-I ubiquitination assays Purification of GST-RIG-I 2CARD from mammalian cells was done as previously described (8, 11). pEBGRIG-I 2CARD (4 μg) and pcDNA4 carrying indicated gene or pCAGGS-NS1 (Influenza A virus, 10 μg) (7) and Article Title: Article Snippet: The constructed pGL3-ELO11 reporter plasmid was cotransfected 211 with the pac-dsxM or pac-dsxF expression plasmid by Article Title: Article Snippet: A total of 24 h after gene KD in 6-well culture plates, 2 μg TOPFlash and 0.5 μg pRL (Promega, E2261) plasmids were transfected into Article Title: Article Snippet: A total of 2 μg of DKK1 promoter and 0.5 μg of pRL (Promega, E2261) plasmids were transfected into |


