pgl3-basic (empty pgl3 vector) (Promega)
Structured Review

Pgl3 Basic (Empty Pgl3 Vector), supplied by Promega, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/empty+vectors+pgl3-basic/pgl3+basic/pmc04749529-250-23-45
Average 90 stars, based on 1 article reviews
Images
1) Product Images from "Insulin requires A 1 adenosine receptors expression to reverse gestational diabetes-increased L-arginine transport in human umbilical vein endothelium"
Article Title: Insulin requires A 1 adenosine receptors expression to reverse gestational diabetes-increased L-arginine transport in human umbilical vein endothelium
Journal: Purinergic Signalling
doi: 10.1007/s11302-015-9491-2
Figure Legend Snippet: Involvement of A1AR and A2AAR on GDM and insulin effect on hCAT-1 expression. a Western blot for hCAT-1 protein abundance in HUVECs from normal (Normal) or gestational diabetes mellitus (GDM) pregnancies incubated in the absence (−) or presence (+) insulin (1 nM, 8 h) and/or A1 adenosine receptor (A1AR) antagonist (Antag). Lower panel, hCAT-1/β-actin ratio densitometries normalized to 1 in cells from normal pregnancies in the absence of insulin or the antagonist. b hCAT-1 protein abundance as in a for A2AAR antagonist. c hCAT-1 mRNA expression as in a for A1AR antagonist. d hCAT-1 mRNA expression as in b for A2AAR antagonist. e Luciferase (Luc) reporter constructs containing two truncations of SLC7A1 promoter (−1606 and −650 bp from the transcription start point) were transfected in HUVECs from normal or GDM pregnancies, along with Renilla reporter plasmid, and assayed for Firefly and Renilla luciferase activity, respectively. Results depict ratio of Firefly/Renilla luciferase activity. After 36 h of transfection, cells were incubated for further 8 h without (Without insulin) or with (With insulin) insulin (1 nM) in the absence (Control) or presence of A1AR or A2AAR antagonists. Cells were also transfected with the empty pGL3-basic vector or pGL3-control vector (SV40 pGL3) as negative or positive controls, respectively (see “Materials and methods”). In a and c, *P < 0.05 vs. corresponding values in Normal. †P < 0.05 vs. values in the absence of insulin or A1AR antagonist. ‡P < 0.05 vs. all other corresponding values. In b and d, *P < 0.05 vs. corresponding values in Normal. †P < 0.05 vs. all other corresponding values. In e, *P < 0.05 vs. vs. all other values except between themselves in the corresponding promoter constructs. Values are mean ± SEM (n = 38)
Techniques Used: Expressing, Western Blot, Incubation, Luciferase, Construct, Transfection, Plasmid Preparation, Activity Assay
Figure Legend Snippet: GDM and insulin effect on hCAT-1 expression in A1AR and A2AAR knockdown cells. a Western blot for hCAT-1 protein abundance in HUVECs in the absence (−) or presence (+) of insulin (1 nM, 8 h) in non-transfected (−) or transfected (+) cells with siRNA against A1AR (KDA1AR). Lower panel, hCAT-1/β-actin ratio densitometries normalized to 1 in cells transfected with sc-siRNA from normal or GDM pregnancies in the absence of insulin. b Western blot for hCAT-1 protein abundance with siRNA against A2AAR (KDA2AAR) as in A. c hCAT-1 mRNA expression in KDA1AR or KDA2AAR cells as in A. d Luciferase (Luc) reporter construct pGL3-hCAT-1−1606 of SLC7A1 promoter transfected in KDA1AR or KDA2AAR cells, along with Renilla reporter plasmid. After 36 h of transfection, cells were incubated without (−) or with (+) insulin (1 nM, 8 h) (see “Materials and methods”). e Luciferase (Luc) reporter construct SLC7A1 promoter transfected in KDA1AR or KDA2AAR cells as in d. In a, *P < 0.05 vs. all other values except between themselves, †P < 0.05 vs. all other corresponding values in GDM. In b, *P < 0.05 vs. all other values. †P < 0.05 vs. all other values except between themselves. In c–e, *P < 0.05 vs. all other values in Normal except between themselves. †P < 0.05 vs. all other values in GDM except between themselves. ‡P < 0.05 vs. corresponding values in Normal. Values are mean ± SEM (n = 29)
Techniques Used: Expressing, Western Blot, Transfection, Luciferase, Construct, Plasmid Preparation, Incubation
Related Articles
Luciferase:Article Title: Proline hydroxylation of CREB-regulated transcriptional coactivator 2 controls hepatic glucose metabolism Article Snippet: .. Dual luciferase activity assays—HEK293T cells were co-transfected with 0.5 μg of empty vector or plasmids encoding CRTC2 variants as indicated, along with 0.5 μg Activity Assay:Article Title: Proline hydroxylation of CREB-regulated transcriptional coactivator 2 controls hepatic glucose metabolism Article Snippet: .. Dual luciferase activity assays—HEK293T cells were co-transfected with 0.5 μg of empty vector or plasmids encoding CRTC2 variants as indicated, along with 0.5 μg Plasmid Preparation:Article Title: Proline hydroxylation of CREB-regulated transcriptional coactivator 2 controls hepatic glucose metabolism Article Snippet: .. Dual luciferase activity assays—HEK293T cells were co-transfected with 0.5 μg of empty vector or plasmids encoding CRTC2 variants as indicated, along with 0.5 μg Control:Article Title: Proline hydroxylation of CREB-regulated transcriptional coactivator 2 controls hepatic glucose metabolism Article Snippet: .. Dual luciferase activity assays—HEK293T cells were co-transfected with 0.5 μg of empty vector or plasmids encoding CRTC2 variants as indicated, along with 0.5 μg other:Article Title: Article Snippet: The plasmids for enhancer activity analysis were generated from Article Title: Egr-1 promotes the proliferation and migration of vascular smooth muscle cells by transcriptionally activating Egr-2 in arteriovenous fistulas Article Snippet: Rat EGR1 promoter (~1.3 Kb; PCR-amplified from rat VSMCs) cloned into Article Title: Folie 1 Article Snippet: Vendor Bulk anti-TGFB1,2,3 In Vivo 1D11.1 Human, Mouse, Bovine, Chicken Mouse IgG1 10μg/gBW AB_292143 6 Ichorbio Mouse IgG1 Isotype Control HKSP - Mouse IgG1 10μg/gBW AB_292138 2 Ichorbio Anti-mouse CD8 in vivo YTS169 Mouse Rat IgG2b 12,5μg/g BW AB_292144 5 Ichorbio Anti-mouse CD4 in vivo GK1.5 Mouse Rat IgG2b 12,5μg/g BW AB_292144 4 Ichorbio Rat IgG2b Isotype Control in vivo 1-2 - Rat IgG2b 12,5μg/g BW AB_292137 8 Ichorbio Supplementary Table S3: Primers used for RT-qPCR Target gene Direction Sequence (5’3’) GC [%] Length TM hu-TGF-β1 Fwd ATTCCTGGCGATACCTCAGC 55 20 59,4 hu-TGF-β1 Rev CGGTAGTGAACCCGTTGATG 55 20 59,4 hu-GAPDH Fwd GTCAGTGGTGGACCTGACCT 60 20 61,4 hu-GAPDH Rev TGAGCTTGACAAAGTGGTCG 50 20 57,3 Supplementary Table S4: Expression vectors Name Backbone Insert (cDNA) Selection marker RRID/parentage pMIG pMSCV empty IRES-GFP RRID:Addgene_ 9044 pMIG-CALRWT pMSCV Human CALRWT IRES-GFP Provided by Ann Mullally pMIG-CALRins5 pMSCV Human CALRins5 IRES-GFP Provided by Ann Mullally 9 pMIG-CALRdel52 pMSCV Human CALRdel52 IRES-GFP Provided by Ann Mullally pMSCV-MPL pMSCV Human MPL PKG- hygromycin resistance gene Provided by Ann Mullally pMIG-JAK2WT pMSCV Human JAK2WT IRES-GFP Provided by Justus Duyster pMIG-JAK2V617F pMSCV Human JAK2V617F IRES-GFP Provided by Justus Duyster pMSCV-EpoR pMSCV Human EPOR neomycin resistance gene In-house pMIG-STAT3WT pMX Human STAT3WT IRES-GFP In-house pMIGSTAT3V640F pMX Human STAT3V640F IRES-GFP In-house pGL4.73[ hRluc/SV40] pGL4 SV40 early enhancer, Article Title: Article Snippet: RIG-I ubiquitination assays Purification of GST-RIG-I 2CARD from mammalian cells was done as previously described (8, 11). pEBGRIG-I 2CARD (4 μg) and pcDNA4 carrying indicated gene or pCAGGS-NS1 (Influenza A virus, 10 μg) (7) and Article Title: Article Snippet: The constructed pGL3-ELO11 reporter plasmid was cotransfected 211 with the pac-dsxM or pac-dsxF expression plasmid by Article Title: Article Snippet: A total of 24 h after gene KD in 6-well culture plates, 2 μg TOPFlash and 0.5 μg pRL (Promega, E2261) plasmids were transfected into Article Title: Article Snippet: A total of 2 μg of DKK1 promoter and 0.5 μg of pRL (Promega, E2261) plasmids were transfected into |


