Review




Structured Review

Shanghai GenePharma empty nc vector (oe-nc
Empty Nc Vector (Oe Nc, supplied by Shanghai GenePharma, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/empty+vector+(nc-oe/empty+vector/pmc09218723-45-40-47
Average 90 stars, based on 1 article reviews
empty nc vector (oe-nc - by Bioz Stars, 2026-09
90/100 stars

Images

Related Articles

other:

Article Title: Role of SIRT1/AMPK signaling in the proliferation, migration and invasion of renal cell carcinoma cells
Article Snippet: SIRT1 overexpression plasmids (3 and 5 mg; OE-SIRT1) and empty vector (OE-NC) (both from Shanghai GenePharma Co., Ltd.) were transfected into 786-O and ACHN cells for 20 min at room temperature using Lipofectamine ® 2000 transfection reagent (Beyotime Institute of Biotechnology) according to the manufacturer's instructions.

Article Title: GABRP Promotes the Metastasis of Pancreatic Cancer by Activation of the MEK/ERK Signaling Pathway.
Article Snippet: Pancreatic cancer remains the common cancer with the worst prognosis because of its late diagnosis and extensive metastasis.. This study aimed to investigate the effects of GABRP on pancreatic cancer metastasis and the molecular mechanism.. The expression of GABRP was measured using the quantitative real-time PCR and western blot.

Article Title: FTO Suppresses Proliferation and Induces Apoptosis of T98G Glioblastoma Cells via N6-methyladenosine Modification of GSTO1.
Article Snippet: and there is no standard treatment for recurrent patients [5].. Therefore, it is necessary to investigate novel therapeutic strategies for GBM.. An in-depth understanding of the pathogenesis of GBM is essential for the development of targeted therapy.

Article Title: Role of TRIM22 in ulcerative colitis and its underlying mechanisms
Article Snippet: The pGPH1 vector carrying short hairpin (sh)RNA plasmids (sh-TRIM30-1; 5′-CAGTATAGAAGTTACAATA-3′ and sh-TRIM30-2; 5′-GGTGAATATCTGTGCACAA-3′), a sh-TRIM22 plasmid (5′-GGAAGATGACATCAGACAA-3′), a sh-KLF2-1 plasmid (5′-GCACCGACGACGACCTCAA-3′) and sh-KLF2-2 plasmid (5′-GAAGCGCGGCCGCCGCTCTTG-3′), a negative control (NC) shRNA plasmid (sh-NC), pCDNA3.1 vector targeting KLF2 (Oe-KLF2) and an empty NC vector (Oe-NC) were all purchased from Shanghai GenePharma Co., Ltd. and were dissolved in sterile phosphate-buffered saline (PBS; Beyotime Institute of Biotechnology).

Article Title: Silencing of METTL3 inhibits m6A methylation of NEK7 to suppress pyrolysis in an HT-22 cell-based model of intracerebral hemorrhage.
Article Snippet: Intracerebral hemorrhage (ICH) induces severe neurological damage, and its progression is driven by METTL3.. This study aimed to investigate the role of METTL3 in ICH via in vitro experiments.. For this purpose, HT-22 cells were treated with hemin to mimic ICH in vitro, followed by evaluating cell pyroptosis using flow cytometry, lactic dehydrogenase release analysis, enzyme-linked immunosorbent assay, and western blotting.

Over Expression:

Article Title: Total glucosides of paeony protects THP-1 macrophages against monosodium urate-induced inflammation via MALAT1/miR-876-5p/NLRP3 signaling cascade in gouty arthritis.
Article Snippet: The intensities of protein bands were analyzed using Image Lab analysis software (Bio-Rad). .. NLRP3 overexpression plasmid (NLRP3), MALAT1 overexpression plasmid (MALAT1), empty vector (vector), MALAT1 small interfering RNA (si-MALAT1), NLRP3 siRNA (si-NLRP3), si-negative control (siNC), miR-876-5p mimics (miR-876–5p), miR-NC, miR-876-5p inhibitor (anti-miR-876-5p) and anti-NC were obtained from Genepharma (Shanghai, China). .. Transient transfection was performed using Lipofectamine® 3000 (Invitrogen).

Plasmid Preparation:

Article Title: Total glucosides of paeony protects THP-1 macrophages against monosodium urate-induced inflammation via MALAT1/miR-876-5p/NLRP3 signaling cascade in gouty arthritis.
Article Snippet: The intensities of protein bands were analyzed using Image Lab analysis software (Bio-Rad). .. NLRP3 overexpression plasmid (NLRP3), MALAT1 overexpression plasmid (MALAT1), empty vector (vector), MALAT1 small interfering RNA (si-MALAT1), NLRP3 siRNA (si-NLRP3), si-negative control (siNC), miR-876-5p mimics (miR-876–5p), miR-NC, miR-876-5p inhibitor (anti-miR-876-5p) and anti-NC were obtained from Genepharma (Shanghai, China). .. Transient transfection was performed using Lipofectamine® 3000 (Invitrogen).

Article Title: Insulin growth factor-1 promotes the proliferation and osteogenic differentiation of bone marrow mesenchymal stem cells through the Wnt/β-catenin pathway
Article Snippet: .. After 24 h, recombinant LV-small interfering (si)RNA-Wnt3a-mus (forward: AGTGCCTCGGAGATGGTGGTAG; reverse: GGGTTAGGTTCGCAGAAGTTGGG) lentivirus (GenePharma Co., Ltd.) or empty vector (GenePharma Co., Ltd.) lentivirus was added to the medium at a multiplicity of infection of 200 (MOI=200). ..

Small Interfering RNA:

Article Title: Total glucosides of paeony protects THP-1 macrophages against monosodium urate-induced inflammation via MALAT1/miR-876-5p/NLRP3 signaling cascade in gouty arthritis.
Article Snippet: The intensities of protein bands were analyzed using Image Lab analysis software (Bio-Rad). .. NLRP3 overexpression plasmid (NLRP3), MALAT1 overexpression plasmid (MALAT1), empty vector (vector), MALAT1 small interfering RNA (si-MALAT1), NLRP3 siRNA (si-NLRP3), si-negative control (siNC), miR-876-5p mimics (miR-876–5p), miR-NC, miR-876-5p inhibitor (anti-miR-876-5p) and anti-NC were obtained from Genepharma (Shanghai, China). .. Transient transfection was performed using Lipofectamine® 3000 (Invitrogen).

Control:

Article Title: Total glucosides of paeony protects THP-1 macrophages against monosodium urate-induced inflammation via MALAT1/miR-876-5p/NLRP3 signaling cascade in gouty arthritis.
Article Snippet: The intensities of protein bands were analyzed using Image Lab analysis software (Bio-Rad). .. NLRP3 overexpression plasmid (NLRP3), MALAT1 overexpression plasmid (MALAT1), empty vector (vector), MALAT1 small interfering RNA (si-MALAT1), NLRP3 siRNA (si-NLRP3), si-negative control (siNC), miR-876-5p mimics (miR-876–5p), miR-NC, miR-876-5p inhibitor (anti-miR-876-5p) and anti-NC were obtained from Genepharma (Shanghai, China). .. Transient transfection was performed using Lipofectamine® 3000 (Invitrogen).

Recombinant:

Article Title: Insulin growth factor-1 promotes the proliferation and osteogenic differentiation of bone marrow mesenchymal stem cells through the Wnt/β-catenin pathway
Article Snippet: .. After 24 h, recombinant LV-small interfering (si)RNA-Wnt3a-mus (forward: AGTGCCTCGGAGATGGTGGTAG; reverse: GGGTTAGGTTCGCAGAAGTTGGG) lentivirus (GenePharma Co., Ltd.) or empty vector (GenePharma Co., Ltd.) lentivirus was added to the medium at a multiplicity of infection of 200 (MOI=200). ..

Infection:

Article Title: Insulin growth factor-1 promotes the proliferation and osteogenic differentiation of bone marrow mesenchymal stem cells through the Wnt/β-catenin pathway
Article Snippet: .. After 24 h, recombinant LV-small interfering (si)RNA-Wnt3a-mus (forward: AGTGCCTCGGAGATGGTGGTAG; reverse: GGGTTAGGTTCGCAGAAGTTGGG) lentivirus (GenePharma Co., Ltd.) or empty vector (GenePharma Co., Ltd.) lentivirus was added to the medium at a multiplicity of infection of 200 (MOI=200). ..



Similar Products

90
Shanghai GenePharma empty vectors oe-nc
Empty Vectors Oe Nc, supplied by Shanghai GenePharma, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/empty+vector+(nc-oe/empty+vector/pm39843621-55-6-28
Average 90 stars, based on 1 article reviews
empty vectors oe-nc - by Bioz Stars, 2026-09
90/100 stars
  Buy from Supplier

90
Shanghai GenePharma empty vector (oe-nc
Empty Vector (Oe Nc, supplied by Shanghai GenePharma, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/empty+vector+(nc-oe/empty+vector/pm38408556-47-30-38
Average 90 stars, based on 1 article reviews
empty vector (oe-nc - by Bioz Stars, 2026-09
90/100 stars
  Buy from Supplier

90
Shanghai GenePharma empty control vectors oe-nc
Empty Control Vectors Oe Nc, supplied by Shanghai GenePharma, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/empty+vector+(nc-oe/empty+control+vectors+oe+nc/pm38564006-59-27-39
Average 90 stars, based on 1 article reviews
empty control vectors oe-nc - by Bioz Stars, 2026-09
90/100 stars
  Buy from Supplier

90
Genechem pcdna3.1 empty vector (oe-nc
Pcdna3.1 Empty Vector (Oe Nc, supplied by Genechem, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/empty+vector+(nc-oe/pcdna3+1/10__3164_slash_jcbn__23___118-64-13-31
Average 90 stars, based on 1 article reviews
pcdna3.1 empty vector (oe-nc - by Bioz Stars, 2026-09
90/100 stars
  Buy from Supplier

90
Genechem empty vectors (sh-nc/oe-nc)
Empty Vectors (Sh Nc/Oe Nc), supplied by Genechem, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/empty+vector+(nc-oe/empty+vectors++nc+/pmc10712134-158-21-0
Average 90 stars, based on 1 article reviews
empty vectors (sh-nc/oe-nc) - by Bioz Stars, 2026-09
90/100 stars
  Buy from Supplier

90
Shanghai GenePharma negative control empty vectors oe-nc
Negative Control Empty Vectors Oe Nc, supplied by Shanghai GenePharma, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/empty+vector+(nc-oe/negative+control+empty+vectors+oe+nc/pm37566188-33-23-31
Average 90 stars, based on 1 article reviews
negative control empty vectors oe-nc - by Bioz Stars, 2026-09
90/100 stars
  Buy from Supplier

90
Shanghai Genechem Ltd empty vector (oe‐nc
Empty Vector (Oe‐Nc, supplied by Shanghai Genechem Ltd, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/empty+vector+(nc-oe/empty+vector++lv+null/pm36840500-37-10-16
Average 90 stars, based on 1 article reviews
empty vector (oe‐nc - by Bioz Stars, 2026-09
90/100 stars
  Buy from Supplier

90
Shanghai GenePharma empty nc vector (oe-nc
Empty Nc Vector (Oe Nc, supplied by Shanghai GenePharma, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/empty+vector+(nc-oe/empty+vector/pmc09218723-45-40-47
Average 90 stars, based on 1 article reviews
empty nc vector (oe-nc - by Bioz Stars, 2026-09
90/100 stars
  Buy from Supplier

90
Obio Technology Corp Ltd empty vector (nc-oe
Empty Vector (Nc Oe, supplied by Obio Technology Corp Ltd, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/empty+vector+(nc-oe/empty+vector++lv+control/pmc09309501-70-9-14
Average 90 stars, based on 1 article reviews
empty vector (nc-oe - by Bioz Stars, 2026-09
90/100 stars
  Buy from Supplier

Image Search Results