empty nc vector (oe-nc (Shanghai GenePharma)
90
Structured Review
Shanghai GenePharma
empty nc vector (oe-nc
Empty Nc Vector (Oe Nc, supplied by Shanghai GenePharma, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/empty+vector+(nc-oe/empty+vector/pmc09218723-45-40-47
Average 90 stars, based on 1 article reviews
Empty Nc Vector (Oe Nc, supplied by Shanghai GenePharma, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/empty+vector+(nc-oe/empty+vector/pmc09218723-45-40-47
Average 90 stars, based on 1 article reviews
empty nc vector (oe-nc - by Bioz Stars,
2026-09
90/100 stars
Images
Related Articles
other:Article Title: Role of SIRT1/AMPK signaling in the proliferation, migration and invasion of renal cell carcinoma cells Article Snippet: SIRT1 overexpression plasmids (3 and 5 mg; OE-SIRT1) and empty vector (OE-NC) (both from Shanghai GenePharma Co., Ltd.) were transfected into 786-O and ACHN cells for 20 min at room temperature using Lipofectamine ® 2000 transfection reagent (Beyotime Institute of Biotechnology) according to the manufacturer's instructions. Article Title: GABRP Promotes the Metastasis of Pancreatic Cancer by Activation of the MEK/ERK Signaling Pathway. Article Snippet: Pancreatic cancer remains the common cancer with the worst prognosis because of its late diagnosis and extensive metastasis.. This study aimed to investigate the effects of GABRP on pancreatic cancer metastasis and the molecular mechanism.. The expression of GABRP was measured using the quantitative real-time PCR and western blot. Article Title: FTO Suppresses Proliferation and Induces Apoptosis of T98G Glioblastoma Cells via N6-methyladenosine Modification of GSTO1. Article Snippet: and there is no standard treatment for recurrent patients [5].. Therefore, it is necessary to investigate novel therapeutic strategies for GBM.. An in-depth understanding of the pathogenesis of GBM is essential for the development of targeted therapy. Article Title: Role of TRIM22 in ulcerative colitis and its underlying mechanisms Article Snippet: The pGPH1 vector carrying short hairpin (sh)RNA plasmids (sh-TRIM30-1; 5′-CAGTATAGAAGTTACAATA-3′ and sh-TRIM30-2; 5′-GGTGAATATCTGTGCACAA-3′), a sh-TRIM22 plasmid (5′-GGAAGATGACATCAGACAA-3′), a sh-KLF2-1 plasmid (5′-GCACCGACGACGACCTCAA-3′) and sh-KLF2-2 plasmid (5′-GAAGCGCGGCCGCCGCTCTTG-3′), a negative control (NC) shRNA plasmid (sh-NC), pCDNA3.1 vector targeting KLF2 (Oe-KLF2) and an empty NC vector (Oe-NC) were all purchased from Shanghai GenePharma Co., Ltd. and were dissolved in sterile phosphate-buffered saline (PBS; Beyotime Institute of Biotechnology). Article Title: Silencing of METTL3 inhibits m6A methylation of NEK7 to suppress pyrolysis in an HT-22 cell-based model of intracerebral hemorrhage. Article Snippet: Intracerebral hemorrhage (ICH) induces severe neurological damage, and its progression is driven by METTL3.. This study aimed to investigate the role of METTL3 in ICH via in vitro experiments.. For this purpose, HT-22 cells were treated with hemin to mimic ICH in vitro, followed by evaluating cell pyroptosis using flow cytometry, lactic dehydrogenase release analysis, enzyme-linked immunosorbent assay, and western blotting. Over Expression:Article Title: Total glucosides of paeony protects THP-1 macrophages against monosodium urate-induced inflammation via MALAT1/miR-876-5p/NLRP3 signaling cascade in gouty arthritis. Article Snippet: The intensities of protein bands were analyzed using Image Lab analysis software (Bio-Rad). .. NLRP3 overexpression plasmid (NLRP3), MALAT1 overexpression plasmid (MALAT1), Plasmid Preparation:Article Title: Total glucosides of paeony protects THP-1 macrophages against monosodium urate-induced inflammation via MALAT1/miR-876-5p/NLRP3 signaling cascade in gouty arthritis. Article Snippet: The intensities of protein bands were analyzed using Image Lab analysis software (Bio-Rad). .. NLRP3 overexpression plasmid (NLRP3), MALAT1 overexpression plasmid (MALAT1), Article Title: Insulin growth factor-1 promotes the proliferation and osteogenic differentiation of bone marrow mesenchymal stem cells through the Wnt/β-catenin pathway Article Snippet: .. After 24 h, recombinant LV-small interfering (si)RNA-Wnt3a-mus (forward: AGTGCCTCGGAGATGGTGGTAG; reverse: GGGTTAGGTTCGCAGAAGTTGGG) lentivirus (GenePharma Co., Ltd.) or Small Interfering RNA:Article Title: Total glucosides of paeony protects THP-1 macrophages against monosodium urate-induced inflammation via MALAT1/miR-876-5p/NLRP3 signaling cascade in gouty arthritis. Article Snippet: The intensities of protein bands were analyzed using Image Lab analysis software (Bio-Rad). .. NLRP3 overexpression plasmid (NLRP3), MALAT1 overexpression plasmid (MALAT1), Control:Article Title: Total glucosides of paeony protects THP-1 macrophages against monosodium urate-induced inflammation via MALAT1/miR-876-5p/NLRP3 signaling cascade in gouty arthritis. Article Snippet: The intensities of protein bands were analyzed using Image Lab analysis software (Bio-Rad). .. NLRP3 overexpression plasmid (NLRP3), MALAT1 overexpression plasmid (MALAT1), Recombinant:Article Title: Insulin growth factor-1 promotes the proliferation and osteogenic differentiation of bone marrow mesenchymal stem cells through the Wnt/β-catenin pathway Article Snippet: .. After 24 h, recombinant LV-small interfering (si)RNA-Wnt3a-mus (forward: AGTGCCTCGGAGATGGTGGTAG; reverse: GGGTTAGGTTCGCAGAAGTTGGG) lentivirus (GenePharma Co., Ltd.) or Infection:Article Title: Insulin growth factor-1 promotes the proliferation and osteogenic differentiation of bone marrow mesenchymal stem cells through the Wnt/β-catenin pathway Article Snippet: .. After 24 h, recombinant LV-small interfering (si)RNA-Wnt3a-mus (forward: AGTGCCTCGGAGATGGTGGTAG; reverse: GGGTTAGGTTCGCAGAAGTTGGG) lentivirus (GenePharma Co., Ltd.) or |