Review



dorsomorphin  (Tocris)


Bioz Verified Symbol Tocris is a verified supplier
Bioz Manufacturer Symbol Tocris manufactures this product  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
    • 96
      Buy from Supplier

    Structured Review

    Tocris dorsomorphin
    Dose-dependent effect of <t>dorsomorphin</t> on primitive streak formation. Chick embryos at EGK stage X-XI are cultured ex-ovo for 21 hours, with administration of different concentrations of dorsomorphin. (A-C) Representative images showing three types of morphology of the primitive streak: normal (A), truncated (B), and ring-shaped (C). cBRA expression marks primitive streak cells. Orientation of embryos is indicated in (A). (D) Numerical data of the morphological types at various concentrations of dorsomorphin (DM). n for each condition: 6, 6, 6, 7, 6, 8, 7, and 6, in order of increasing the concentration of dorsomorphin (0, 0.1, 0.25, 0.5, 1, 5, 10, and 20 μM). Chi-square test: p = 1.56e-08. Scale bars: 1 mm.
    Dorsomorphin, supplied by Tocris, used in various techniques. Bioz Stars score: 96/100, based on 540 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/dorsomorphin/Dorsomorphin+dihydrochloride/pmc12945622-29-1-2
    Average 96 stars, based on 540 article reviews
    dorsomorphin - by Bioz Stars, 2026-10
    96/100 stars

    Images

    1) Product Images from "RESEARCH NOTE: Effect of inhibition of bone morphogenetic protein signaling pathway by dorsomorphin on the establishment of embryo polarity"

    Article Title: RESEARCH NOTE: Effect of inhibition of bone morphogenetic protein signaling pathway by dorsomorphin on the establishment of embryo polarity

    Journal: Poultry Science

    doi: 10.1016/j.psj.2026.106644

    Dose-dependent effect of dorsomorphin on primitive streak formation. Chick embryos at EGK stage X-XI are cultured ex-ovo for 21 hours, with administration of different concentrations of dorsomorphin. (A-C) Representative images showing three types of morphology of the primitive streak: normal (A), truncated (B), and ring-shaped (C). cBRA expression marks primitive streak cells. Orientation of embryos is indicated in (A). (D) Numerical data of the morphological types at various concentrations of dorsomorphin (DM). n for each condition: 6, 6, 6, 7, 6, 8, 7, and 6, in order of increasing the concentration of dorsomorphin (0, 0.1, 0.25, 0.5, 1, 5, 10, and 20 μM). Chi-square test: p = 1.56e-08. Scale bars: 1 mm.
    Figure Legend Snippet: Dose-dependent effect of dorsomorphin on primitive streak formation. Chick embryos at EGK stage X-XI are cultured ex-ovo for 21 hours, with administration of different concentrations of dorsomorphin. (A-C) Representative images showing three types of morphology of the primitive streak: normal (A), truncated (B), and ring-shaped (C). cBRA expression marks primitive streak cells. Orientation of embryos is indicated in (A). (D) Numerical data of the morphological types at various concentrations of dorsomorphin (DM). n for each condition: 6, 6, 6, 7, 6, 8, 7, and 6, in order of increasing the concentration of dorsomorphin (0, 0.1, 0.25, 0.5, 1, 5, 10, and 20 μM). Chi-square test: p = 1.56e-08. Scale bars: 1 mm.

    Techniques Used: Cell Culture, Expressing, Concentration Assay

    Enhanced morphological change in isolated anterior cut-half embryos by dorsomorphin treatment . Isolated anterior cut-half embryos are cultured ex-ovo for 9 hours with administration of 0.02% DMSO (control) or 20 μM dorsomorphin. (A) 0.02% DMSO. (B) 20 μM dorsomorphin (DM). A’ and B’ are magnified views of the boxed region in (A) and (B), respectively. cVG1 expression marks the primitive-streak forming region. (C) Comparison of the angle of the groove between the control and DM treatment. Dots represent each data. n = 17 and 26 in the control and DM groups, respectively. Unpaired Student’s t-test (two-sided): **** p < 0.0001. Scale bars: 1 mm.
    Figure Legend Snippet: Enhanced morphological change in isolated anterior cut-half embryos by dorsomorphin treatment . Isolated anterior cut-half embryos are cultured ex-ovo for 9 hours with administration of 0.02% DMSO (control) or 20 μM dorsomorphin. (A) 0.02% DMSO. (B) 20 μM dorsomorphin (DM). A’ and B’ are magnified views of the boxed region in (A) and (B), respectively. cVG1 expression marks the primitive-streak forming region. (C) Comparison of the angle of the groove between the control and DM treatment. Dots represent each data. n = 17 and 26 in the control and DM groups, respectively. Unpaired Student’s t-test (two-sided): **** p < 0.0001. Scale bars: 1 mm.

    Techniques Used: Isolation, Cell Culture, Control, Expressing, Comparison

    Related Articles

    Cell Culture:

    Article Title: Attenuated interferon signalling in alveolar epithelium limits resistance to Streptococcus pyogenes
    Article Snippet: Cells were then dissociated using Gentle Cell Dissociation Reagent (StemCell Technologies, 100-0485) and replated on plates coated with growth factor-reduced Matrigel (Corning, 354277). .. Afterwards, cells were cultured in the anteriorisation media “DS/SB” (cSFDM with 2 μM Dorsomorphin (Tocris, 3093/10) and 10 μM SB431542 (Tocris, 1614)) for 3 days, with the first 24 hours also supplemented with 10 μM Y-27632 (Tocris, 1254). .. From day 6 of the differentiation, Cells were kept in “CBRa” (cSFDM with 3 μM CHIR99021 (Tocris, 4423), 10 ng/ml rhBMP4 (R&D Systems, 314-BP), and 100 nM Retinoic Acid (Sigma, R2625)) to induce NKX2-1 + lung progenitors.

    other:


    Article Title: Human iPSC-derived 2D cortical neurons and 3D cortical organoids show fetal brain proteomic similarity and distinct phosphoproteomic profiles
    Article Snippet: Next day, the cells were 90%–100% confluent and differentiation was initiated by changing medium to Neurobasal medium (DMEM/F12, Neurobasal, 1X B-27 minus vitamin A, 1X N2 supplement, 1X L-Glutamine, 1X Non-essential amino acids (NEAA), 50 μM β-mercapto-ethanol, 0.4X Penicillin/streptomycin) supplemented with 10 μM SB431542 (Tocris, cat# 1614) and 2 μM Dorsomorphin (Tocris, cat# 3093) for 12 days.

    Recombinant:

    Article Title: Nuclear Factor I genes drive chondrogenic cell-fate commitment
    Article Snippet: On Day 0, basal medium was supplemented with 30ng/ml Activin A (Miltenyibiotec), 4μM of CHIR99021 (Tocris), and 20ng/ml recombinant human fibroblast growth factor (basic, Peprotech). .. On day 1, cells were refreshed with basal medium supplemented with 2μM SB-505124 (Tocris), 3μM CHIR99021, 20 ng/ml recombinant human fibroblast growth factor, 4μM Dorsomorphin dihydrochloride (Tocris). .. On day 2 basal medium was supplemented with 2μM SB-505124, 1μM Wnt-C59 (Tocris), 500nM PD173074 (Tocris), and 4μM Dorsomorphin.

    Article Title: OGT regulates RNA-binding protein nucleocytoplasmic partitioning, but this fails in amyotrophic lateral sclerosis.
    Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies Mouse monoclonal anti-PTBP1 Proteintech Cat#67462-1-Ig; RRID: AB_2882692 Rabbit polyclonal anti-PTBP1 Proteintech Cat#12582-1-AP; RRID: AB_2176402 Rabbit polyclonal anti-U2AF65 Abcam Cat#ab37530; RRID: AB_883336 Mouse monoclonal anti-hnRNPK Santa Cruz Cat#sc-28380; RRID: AB_627734 Rabbit polyclonal anti-TDP-43 Proteintech Cat#12892-1-AP; RRID: AB_2200505 Mouse monoclonal anti-FUS Santa Cruz Cat#sc-47711; RRID: AB_2105208 Rabbit polyclonal anti-SFPQ Abcam Cat#ab38148; RRID: AB_945424 Mouse monoclonal anti-U2AF35 Proteintech Cat#60289-1-Ig; RRID: AB_2858277 Chicken polyclonal anti-beta III Tubulin Abcam Cat#ab41489; RRID: AB_727049 Mouse monoclonal anti-OGT Santa Cruz Cat#sc-74546; RRID: AB_2157067 Mouse monoclonal anti-O-GlcNAc RL2 Abcam Cat#ab2739; RRID: AB_303264 Chemicals, peptides, and recombinant proteins Essential 8 Medium Gibco Cat#A1517001 Geltrex Gibco Cat#A1413302 UltraPure EDTA Invitrogen Cat#15575020 DMEM/F12 Gibco Cat#31330038 Neurobasal Medium Gibco Cat#12348017 N-2 Supplement Gibco Cat#17502001 B27 Supplement Gibco Cat#12587001 GlutaMAX Supplement Thermo Scientific Cat#35050038 MEM Non-Essential Amino Acids Gibco Cat#11140050 β-Mercaptoethanol Gibco Cat#21985023 Human insulin Sigma-Aldrich Cat#I9278 Dorsomorphin Tocris Cat3093 SB431542 Tocris Cat#1614 CHIR99021 Tocris Cat#4423 Retinoic Acid Sigma-Aldrich Cat#R2625 Purmorphamine Sigma-Aldrich Cat#540220 Compound E Tocris Cat#6476 Lipofectamine RNAiMAX Transfection Reagent Invitrogen Cat#13778150 SYBR Green Mastermix Applied Biosystems Cat#4309155 Tris-HCl Buffer, pH 7.5 Invitrogen Cat#15567027 NaCl Invitrogen Cat#AM9760G NP-40 Detergent Solution Thermo Scientific Cat#85124 EDTA Invitrogen Cat#AM9260G cOmplete Protease Inhibitor Cocktail Roche Cat#4693159001 NuPAGE Reducing Agent Invitrogen Cat#NP0009 NuPAGE LDS Sample Buffer Invitrogen Cat#NP0007 NuPAGE MOPS SDS Running Buffer Invitrogen Cat#NP0001 Paraformaldehyde Thermo Scientific Cat#043368.9M PBS Gibco Cat#10010015 Bovine Serum Albumin Sigma-Aldrich Cat#A7906 Triton X-100 Thermo Scientific Cat#9002-93-1 (Continued on next page) iScience 29, 117807, November 20, 2026 11 .. REAGENT or RESOURCE SOURCE IDENTIFIER Thiamet G Sigma-Aldrich Cat#SML0244 Critical commercial assays Maxwell RSC simplyRNA Cells Kit Promega Cat#AS1390 SuperScript IV First-Strand Synthesis System Invitrogen Cat#18091050 Pierce BCA Protein Assay Kit Thermo Scientific Cat#23227 Revert Total Protein Stain Kit LICORbio Cat#926-11016 ECL Western Blotting Detection Reagent Cytiva Cat#RPN2232 Deposited data Existing RBP CLIP data ENCODE https://www.encodeproject.org/ Original Western blot images This paper Mendeley Data: https://doi.org/10.17632/854xtzypt4.1 Experimental models: Cell lines Human: CTRL1 iPSC line Thermo Fisher Scientific Cat#A18945 Human: CTRL2 iPSC line Ludtmann et al.44 (Wray lab) N/A Human: CTRL3 iPSC line Cedars-Sinai CS0002iCTR-nxx; RRID: CVCL_E8CP Human: CTRL4 iPSC line NIH CRM CRMi003-A, RRID: CVCL_1E71 Human: VCPmut1 R155C iPSC line Ludtmann et al.44 (Wray lab) N/A Human: VCPmut2 R155C iPSC line Ludtmann et al.44 (Wray lab) N/A Human: VCPmut3 R191Q iPSC line Ludtmann et al.44 (Wray lab) N/A Human: VCPmut4 R191Q iPSC line Ludtmann et al.44 (Wray lab) N/A Human: TARDBPmut1 G298S iPSC line Cedars-Sinai CS47iALS-TDPnxx Human: TARDBPmut2 G298S iPSC line Target ALS TALSTDP-47.10; RRID: CVCL_FA03 Oligonucleotides ASO-OGT sequence: GTGGCAGTTACAAACCCGTTACCAT Parra et al.29 N/A ASO-NC sequence: TTAGTTTAATCACGCTCG This paper N/A Primer: OGT IRT Forward: GAAGCCAAGGTAGGTGTTTGA Tyzack et al.27 N/A Primer: OGT IRT Reverse: AAGAGTTGAAGACTTGGCAAA Tyzack et al.27 N/A Primer: OGT PCT Forward: TTCGCAGTGACCTGGGGAAC This paper N/A Primer: OGT PCT Reverse: CACAGCCAAGATTACTCCAAGC This paper N/A Primer: GAPDH Forward: ATGACATCAAGAAGGTGGTG This paper N/A Primer: GAPDH Reverse: CATACCAGGAAATGAGCTTG This paper N/A Software and algorithms Image Lab v6 Bio-Rad GraphPad Prism v11 Dotmatics https://www.graphpad.com/ R Project for Statistical Computing v4 CRAN RRID: SCR_001905 STAR v2.7 RNA-STAR RRID:SCR_004463 Cutadapt Martin45 RRID:SCR_011841 FlowJo v11 Waters Biosciences https://www.flowjo.com/ Harmony High-Content Imaging and Analysis Software v5 Revvity Cat#HH17000019 CellProfiler v4 Broad Institute https://cellprofiler.org/ 12 iScience 29, 117807, November 20, 2026

    Saline:

    Article Title: RESEARCH NOTE: Effect of inhibition of bone morphogenetic protein signaling pathway by dorsomorphin on the establishment of embryo polarity
    Article Snippet: Stained embryos were imaged with an Olympus SZH10 stereomicroscope with a QImaging Retiga 2000R camera. .. For dorsomorphin (Tocris, 3093) treatment to the whole embryo, it was diluted first in phosphate-buffered saline (1:10 v:v) and then in albumen (9:10 v:v), which was used for ex ovo culture. ..

    Transfection:

    Article Title: OGT regulates RNA-binding protein nucleocytoplasmic partitioning, but this fails in amyotrophic lateral sclerosis.
    Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies Mouse monoclonal anti-PTBP1 Proteintech Cat#67462-1-Ig; RRID: AB_2882692 Rabbit polyclonal anti-PTBP1 Proteintech Cat#12582-1-AP; RRID: AB_2176402 Rabbit polyclonal anti-U2AF65 Abcam Cat#ab37530; RRID: AB_883336 Mouse monoclonal anti-hnRNPK Santa Cruz Cat#sc-28380; RRID: AB_627734 Rabbit polyclonal anti-TDP-43 Proteintech Cat#12892-1-AP; RRID: AB_2200505 Mouse monoclonal anti-FUS Santa Cruz Cat#sc-47711; RRID: AB_2105208 Rabbit polyclonal anti-SFPQ Abcam Cat#ab38148; RRID: AB_945424 Mouse monoclonal anti-U2AF35 Proteintech Cat#60289-1-Ig; RRID: AB_2858277 Chicken polyclonal anti-beta III Tubulin Abcam Cat#ab41489; RRID: AB_727049 Mouse monoclonal anti-OGT Santa Cruz Cat#sc-74546; RRID: AB_2157067 Mouse monoclonal anti-O-GlcNAc RL2 Abcam Cat#ab2739; RRID: AB_303264 Chemicals, peptides, and recombinant proteins Essential 8 Medium Gibco Cat#A1517001 Geltrex Gibco Cat#A1413302 UltraPure EDTA Invitrogen Cat#15575020 DMEM/F12 Gibco Cat#31330038 Neurobasal Medium Gibco Cat#12348017 N-2 Supplement Gibco Cat#17502001 B27 Supplement Gibco Cat#12587001 GlutaMAX Supplement Thermo Scientific Cat#35050038 MEM Non-Essential Amino Acids Gibco Cat#11140050 β-Mercaptoethanol Gibco Cat#21985023 Human insulin Sigma-Aldrich Cat#I9278 Dorsomorphin Tocris Cat3093 SB431542 Tocris Cat#1614 CHIR99021 Tocris Cat#4423 Retinoic Acid Sigma-Aldrich Cat#R2625 Purmorphamine Sigma-Aldrich Cat#540220 Compound E Tocris Cat#6476 Lipofectamine RNAiMAX Transfection Reagent Invitrogen Cat#13778150 SYBR Green Mastermix Applied Biosystems Cat#4309155 Tris-HCl Buffer, pH 7.5 Invitrogen Cat#15567027 NaCl Invitrogen Cat#AM9760G NP-40 Detergent Solution Thermo Scientific Cat#85124 EDTA Invitrogen Cat#AM9260G cOmplete Protease Inhibitor Cocktail Roche Cat#4693159001 NuPAGE Reducing Agent Invitrogen Cat#NP0009 NuPAGE LDS Sample Buffer Invitrogen Cat#NP0007 NuPAGE MOPS SDS Running Buffer Invitrogen Cat#NP0001 Paraformaldehyde Thermo Scientific Cat#043368.9M PBS Gibco Cat#10010015 Bovine Serum Albumin Sigma-Aldrich Cat#A7906 Triton X-100 Thermo Scientific Cat#9002-93-1 (Continued on next page) iScience 29, 117807, November 20, 2026 11 .. REAGENT or RESOURCE SOURCE IDENTIFIER Thiamet G Sigma-Aldrich Cat#SML0244 Critical commercial assays Maxwell RSC simplyRNA Cells Kit Promega Cat#AS1390 SuperScript IV First-Strand Synthesis System Invitrogen Cat#18091050 Pierce BCA Protein Assay Kit Thermo Scientific Cat#23227 Revert Total Protein Stain Kit LICORbio Cat#926-11016 ECL Western Blotting Detection Reagent Cytiva Cat#RPN2232 Deposited data Existing RBP CLIP data ENCODE https://www.encodeproject.org/ Original Western blot images This paper Mendeley Data: https://doi.org/10.17632/854xtzypt4.1 Experimental models: Cell lines Human: CTRL1 iPSC line Thermo Fisher Scientific Cat#A18945 Human: CTRL2 iPSC line Ludtmann et al.44 (Wray lab) N/A Human: CTRL3 iPSC line Cedars-Sinai CS0002iCTR-nxx; RRID: CVCL_E8CP Human: CTRL4 iPSC line NIH CRM CRMi003-A, RRID: CVCL_1E71 Human: VCPmut1 R155C iPSC line Ludtmann et al.44 (Wray lab) N/A Human: VCPmut2 R155C iPSC line Ludtmann et al.44 (Wray lab) N/A Human: VCPmut3 R191Q iPSC line Ludtmann et al.44 (Wray lab) N/A Human: VCPmut4 R191Q iPSC line Ludtmann et al.44 (Wray lab) N/A Human: TARDBPmut1 G298S iPSC line Cedars-Sinai CS47iALS-TDPnxx Human: TARDBPmut2 G298S iPSC line Target ALS TALSTDP-47.10; RRID: CVCL_FA03 Oligonucleotides ASO-OGT sequence: GTGGCAGTTACAAACCCGTTACCAT Parra et al.29 N/A ASO-NC sequence: TTAGTTTAATCACGCTCG This paper N/A Primer: OGT IRT Forward: GAAGCCAAGGTAGGTGTTTGA Tyzack et al.27 N/A Primer: OGT IRT Reverse: AAGAGTTGAAGACTTGGCAAA Tyzack et al.27 N/A Primer: OGT PCT Forward: TTCGCAGTGACCTGGGGAAC This paper N/A Primer: OGT PCT Reverse: CACAGCCAAGATTACTCCAAGC This paper N/A Primer: GAPDH Forward: ATGACATCAAGAAGGTGGTG This paper N/A Primer: GAPDH Reverse: CATACCAGGAAATGAGCTTG This paper N/A Software and algorithms Image Lab v6 Bio-Rad GraphPad Prism v11 Dotmatics https://www.graphpad.com/ R Project for Statistical Computing v4 CRAN RRID: SCR_001905 STAR v2.7 RNA-STAR RRID:SCR_004463 Cutadapt Martin45 RRID:SCR_011841 FlowJo v11 Waters Biosciences https://www.flowjo.com/ Harmony High-Content Imaging and Analysis Software v5 Revvity Cat#HH17000019 CellProfiler v4 Broad Institute https://cellprofiler.org/ 12 iScience 29, 117807, November 20, 2026

    SYBR Green Assay:

    Article Title: OGT regulates RNA-binding protein nucleocytoplasmic partitioning, but this fails in amyotrophic lateral sclerosis.
    Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies Mouse monoclonal anti-PTBP1 Proteintech Cat#67462-1-Ig; RRID: AB_2882692 Rabbit polyclonal anti-PTBP1 Proteintech Cat#12582-1-AP; RRID: AB_2176402 Rabbit polyclonal anti-U2AF65 Abcam Cat#ab37530; RRID: AB_883336 Mouse monoclonal anti-hnRNPK Santa Cruz Cat#sc-28380; RRID: AB_627734 Rabbit polyclonal anti-TDP-43 Proteintech Cat#12892-1-AP; RRID: AB_2200505 Mouse monoclonal anti-FUS Santa Cruz Cat#sc-47711; RRID: AB_2105208 Rabbit polyclonal anti-SFPQ Abcam Cat#ab38148; RRID: AB_945424 Mouse monoclonal anti-U2AF35 Proteintech Cat#60289-1-Ig; RRID: AB_2858277 Chicken polyclonal anti-beta III Tubulin Abcam Cat#ab41489; RRID: AB_727049 Mouse monoclonal anti-OGT Santa Cruz Cat#sc-74546; RRID: AB_2157067 Mouse monoclonal anti-O-GlcNAc RL2 Abcam Cat#ab2739; RRID: AB_303264 Chemicals, peptides, and recombinant proteins Essential 8 Medium Gibco Cat#A1517001 Geltrex Gibco Cat#A1413302 UltraPure EDTA Invitrogen Cat#15575020 DMEM/F12 Gibco Cat#31330038 Neurobasal Medium Gibco Cat#12348017 N-2 Supplement Gibco Cat#17502001 B27 Supplement Gibco Cat#12587001 GlutaMAX Supplement Thermo Scientific Cat#35050038 MEM Non-Essential Amino Acids Gibco Cat#11140050 β-Mercaptoethanol Gibco Cat#21985023 Human insulin Sigma-Aldrich Cat#I9278 Dorsomorphin Tocris Cat3093 SB431542 Tocris Cat#1614 CHIR99021 Tocris Cat#4423 Retinoic Acid Sigma-Aldrich Cat#R2625 Purmorphamine Sigma-Aldrich Cat#540220 Compound E Tocris Cat#6476 Lipofectamine RNAiMAX Transfection Reagent Invitrogen Cat#13778150 SYBR Green Mastermix Applied Biosystems Cat#4309155 Tris-HCl Buffer, pH 7.5 Invitrogen Cat#15567027 NaCl Invitrogen Cat#AM9760G NP-40 Detergent Solution Thermo Scientific Cat#85124 EDTA Invitrogen Cat#AM9260G cOmplete Protease Inhibitor Cocktail Roche Cat#4693159001 NuPAGE Reducing Agent Invitrogen Cat#NP0009 NuPAGE LDS Sample Buffer Invitrogen Cat#NP0007 NuPAGE MOPS SDS Running Buffer Invitrogen Cat#NP0001 Paraformaldehyde Thermo Scientific Cat#043368.9M PBS Gibco Cat#10010015 Bovine Serum Albumin Sigma-Aldrich Cat#A7906 Triton X-100 Thermo Scientific Cat#9002-93-1 (Continued on next page) iScience 29, 117807, November 20, 2026 11 .. REAGENT or RESOURCE SOURCE IDENTIFIER Thiamet G Sigma-Aldrich Cat#SML0244 Critical commercial assays Maxwell RSC simplyRNA Cells Kit Promega Cat#AS1390 SuperScript IV First-Strand Synthesis System Invitrogen Cat#18091050 Pierce BCA Protein Assay Kit Thermo Scientific Cat#23227 Revert Total Protein Stain Kit LICORbio Cat#926-11016 ECL Western Blotting Detection Reagent Cytiva Cat#RPN2232 Deposited data Existing RBP CLIP data ENCODE https://www.encodeproject.org/ Original Western blot images This paper Mendeley Data: https://doi.org/10.17632/854xtzypt4.1 Experimental models: Cell lines Human: CTRL1 iPSC line Thermo Fisher Scientific Cat#A18945 Human: CTRL2 iPSC line Ludtmann et al.44 (Wray lab) N/A Human: CTRL3 iPSC line Cedars-Sinai CS0002iCTR-nxx; RRID: CVCL_E8CP Human: CTRL4 iPSC line NIH CRM CRMi003-A, RRID: CVCL_1E71 Human: VCPmut1 R155C iPSC line Ludtmann et al.44 (Wray lab) N/A Human: VCPmut2 R155C iPSC line Ludtmann et al.44 (Wray lab) N/A Human: VCPmut3 R191Q iPSC line Ludtmann et al.44 (Wray lab) N/A Human: VCPmut4 R191Q iPSC line Ludtmann et al.44 (Wray lab) N/A Human: TARDBPmut1 G298S iPSC line Cedars-Sinai CS47iALS-TDPnxx Human: TARDBPmut2 G298S iPSC line Target ALS TALSTDP-47.10; RRID: CVCL_FA03 Oligonucleotides ASO-OGT sequence: GTGGCAGTTACAAACCCGTTACCAT Parra et al.29 N/A ASO-NC sequence: TTAGTTTAATCACGCTCG This paper N/A Primer: OGT IRT Forward: GAAGCCAAGGTAGGTGTTTGA Tyzack et al.27 N/A Primer: OGT IRT Reverse: AAGAGTTGAAGACTTGGCAAA Tyzack et al.27 N/A Primer: OGT PCT Forward: TTCGCAGTGACCTGGGGAAC This paper N/A Primer: OGT PCT Reverse: CACAGCCAAGATTACTCCAAGC This paper N/A Primer: GAPDH Forward: ATGACATCAAGAAGGTGGTG This paper N/A Primer: GAPDH Reverse: CATACCAGGAAATGAGCTTG This paper N/A Software and algorithms Image Lab v6 Bio-Rad GraphPad Prism v11 Dotmatics https://www.graphpad.com/ R Project for Statistical Computing v4 CRAN RRID: SCR_001905 STAR v2.7 RNA-STAR RRID:SCR_004463 Cutadapt Martin45 RRID:SCR_011841 FlowJo v11 Waters Biosciences https://www.flowjo.com/ Harmony High-Content Imaging and Analysis Software v5 Revvity Cat#HH17000019 CellProfiler v4 Broad Institute https://cellprofiler.org/ 12 iScience 29, 117807, November 20, 2026

    Protease Inhibitor:

    Article Title: OGT regulates RNA-binding protein nucleocytoplasmic partitioning, but this fails in amyotrophic lateral sclerosis.
    Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies Mouse monoclonal anti-PTBP1 Proteintech Cat#67462-1-Ig; RRID: AB_2882692 Rabbit polyclonal anti-PTBP1 Proteintech Cat#12582-1-AP; RRID: AB_2176402 Rabbit polyclonal anti-U2AF65 Abcam Cat#ab37530; RRID: AB_883336 Mouse monoclonal anti-hnRNPK Santa Cruz Cat#sc-28380; RRID: AB_627734 Rabbit polyclonal anti-TDP-43 Proteintech Cat#12892-1-AP; RRID: AB_2200505 Mouse monoclonal anti-FUS Santa Cruz Cat#sc-47711; RRID: AB_2105208 Rabbit polyclonal anti-SFPQ Abcam Cat#ab38148; RRID: AB_945424 Mouse monoclonal anti-U2AF35 Proteintech Cat#60289-1-Ig; RRID: AB_2858277 Chicken polyclonal anti-beta III Tubulin Abcam Cat#ab41489; RRID: AB_727049 Mouse monoclonal anti-OGT Santa Cruz Cat#sc-74546; RRID: AB_2157067 Mouse monoclonal anti-O-GlcNAc RL2 Abcam Cat#ab2739; RRID: AB_303264 Chemicals, peptides, and recombinant proteins Essential 8 Medium Gibco Cat#A1517001 Geltrex Gibco Cat#A1413302 UltraPure EDTA Invitrogen Cat#15575020 DMEM/F12 Gibco Cat#31330038 Neurobasal Medium Gibco Cat#12348017 N-2 Supplement Gibco Cat#17502001 B27 Supplement Gibco Cat#12587001 GlutaMAX Supplement Thermo Scientific Cat#35050038 MEM Non-Essential Amino Acids Gibco Cat#11140050 β-Mercaptoethanol Gibco Cat#21985023 Human insulin Sigma-Aldrich Cat#I9278 Dorsomorphin Tocris Cat3093 SB431542 Tocris Cat#1614 CHIR99021 Tocris Cat#4423 Retinoic Acid Sigma-Aldrich Cat#R2625 Purmorphamine Sigma-Aldrich Cat#540220 Compound E Tocris Cat#6476 Lipofectamine RNAiMAX Transfection Reagent Invitrogen Cat#13778150 SYBR Green Mastermix Applied Biosystems Cat#4309155 Tris-HCl Buffer, pH 7.5 Invitrogen Cat#15567027 NaCl Invitrogen Cat#AM9760G NP-40 Detergent Solution Thermo Scientific Cat#85124 EDTA Invitrogen Cat#AM9260G cOmplete Protease Inhibitor Cocktail Roche Cat#4693159001 NuPAGE Reducing Agent Invitrogen Cat#NP0009 NuPAGE LDS Sample Buffer Invitrogen Cat#NP0007 NuPAGE MOPS SDS Running Buffer Invitrogen Cat#NP0001 Paraformaldehyde Thermo Scientific Cat#043368.9M PBS Gibco Cat#10010015 Bovine Serum Albumin Sigma-Aldrich Cat#A7906 Triton X-100 Thermo Scientific Cat#9002-93-1 (Continued on next page) iScience 29, 117807, November 20, 2026 11 .. REAGENT or RESOURCE SOURCE IDENTIFIER Thiamet G Sigma-Aldrich Cat#SML0244 Critical commercial assays Maxwell RSC simplyRNA Cells Kit Promega Cat#AS1390 SuperScript IV First-Strand Synthesis System Invitrogen Cat#18091050 Pierce BCA Protein Assay Kit Thermo Scientific Cat#23227 Revert Total Protein Stain Kit LICORbio Cat#926-11016 ECL Western Blotting Detection Reagent Cytiva Cat#RPN2232 Deposited data Existing RBP CLIP data ENCODE https://www.encodeproject.org/ Original Western blot images This paper Mendeley Data: https://doi.org/10.17632/854xtzypt4.1 Experimental models: Cell lines Human: CTRL1 iPSC line Thermo Fisher Scientific Cat#A18945 Human: CTRL2 iPSC line Ludtmann et al.44 (Wray lab) N/A Human: CTRL3 iPSC line Cedars-Sinai CS0002iCTR-nxx; RRID: CVCL_E8CP Human: CTRL4 iPSC line NIH CRM CRMi003-A, RRID: CVCL_1E71 Human: VCPmut1 R155C iPSC line Ludtmann et al.44 (Wray lab) N/A Human: VCPmut2 R155C iPSC line Ludtmann et al.44 (Wray lab) N/A Human: VCPmut3 R191Q iPSC line Ludtmann et al.44 (Wray lab) N/A Human: VCPmut4 R191Q iPSC line Ludtmann et al.44 (Wray lab) N/A Human: TARDBPmut1 G298S iPSC line Cedars-Sinai CS47iALS-TDPnxx Human: TARDBPmut2 G298S iPSC line Target ALS TALSTDP-47.10; RRID: CVCL_FA03 Oligonucleotides ASO-OGT sequence: GTGGCAGTTACAAACCCGTTACCAT Parra et al.29 N/A ASO-NC sequence: TTAGTTTAATCACGCTCG This paper N/A Primer: OGT IRT Forward: GAAGCCAAGGTAGGTGTTTGA Tyzack et al.27 N/A Primer: OGT IRT Reverse: AAGAGTTGAAGACTTGGCAAA Tyzack et al.27 N/A Primer: OGT PCT Forward: TTCGCAGTGACCTGGGGAAC This paper N/A Primer: OGT PCT Reverse: CACAGCCAAGATTACTCCAAGC This paper N/A Primer: GAPDH Forward: ATGACATCAAGAAGGTGGTG This paper N/A Primer: GAPDH Reverse: CATACCAGGAAATGAGCTTG This paper N/A Software and algorithms Image Lab v6 Bio-Rad GraphPad Prism v11 Dotmatics https://www.graphpad.com/ R Project for Statistical Computing v4 CRAN RRID: SCR_001905 STAR v2.7 RNA-STAR RRID:SCR_004463 Cutadapt Martin45 RRID:SCR_011841 FlowJo v11 Waters Biosciences https://www.flowjo.com/ Harmony High-Content Imaging and Analysis Software v5 Revvity Cat#HH17000019 CellProfiler v4 Broad Institute https://cellprofiler.org/ 12 iScience 29, 117807, November 20, 2026



    Similar Products

    compound c  (MedChemExpress)
    96
    MedChemExpress compound c
    Compound C, supplied by MedChemExpress, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/dorsomorphin/Dorsomorphin+dihydrochloride/pm42894235-233-0-14
    Average 96 stars, based on 1 article reviews
    compound c - by Bioz Stars, 2026-10
    96/100 stars
    		  Buy from Supplier
    dorsomorphin  (Tocris)
    96
    Tocris dorsomorphin
    Dorsomorphin, supplied by Tocris, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/dorsomorphin/Dorsomorphin+dihydrochloride/pm42894639-125-139-140
    Average 96 stars, based on 1 article reviews
    dorsomorphin - by Bioz Stars, 2026-10
    96/100 stars
    		  Buy from Supplier
    dorsomorphin  (Selleck Chemicals)
    96
    Selleck Chemicals dorsomorphin
    Dorsomorphin, supplied by Selleck Chemicals, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/dorsomorphin/Dorsomorphin/pm42894543-265-9-13
    Average 96 stars, based on 1 article reviews
    dorsomorphin - by Bioz Stars, 2026-10
    96/100 stars
    		  Buy from Supplier
    ampk inhibitor dorsomorphin  (Selleck Chemicals)
    96
    Selleck Chemicals ampk inhibitor dorsomorphin
    Ampk Inhibitor Dorsomorphin, supplied by Selleck Chemicals, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/dorsomorphin/Dorsomorphin/pm42854879-60-20-26
    Average 96 stars, based on 1 article reviews
    ampk inhibitor dorsomorphin - by Bioz Stars, 2026-10
    96/100 stars
    		  Buy from Supplier
    dorsomorphin 2hcl  (Selleck Chemicals)
    96
    Selleck Chemicals dorsomorphin 2hcl
    Dorsomorphin 2hcl, supplied by Selleck Chemicals, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/dorsomorphin/Dorsomorphin/10__1186_slash_s13024___026___00998___2-491-12-20
    Average 96 stars, based on 1 article reviews
    dorsomorphin 2hcl - by Bioz Stars, 2026-10
    96/100 stars
    		  Buy from Supplier

    Image Search Results