anti vimentin (Proteintech)
Proteintech is a verified supplier 
96
Structured Review
Proteintech
anti vimentin
Anti Vimentin, supplied by Proteintech, used in various techniques. Bioz Stars score: 96/100, based on 2464 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/vim/Vimentin+Antibody/pm42813854-87-63-64
Average 96 stars, based on 2464 article reviews
Anti Vimentin, supplied by Proteintech, used in various techniques. Bioz Stars score: 96/100, based on 2464 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/vim/Vimentin+Antibody/pm42813854-87-63-64
Average 96 stars, based on 2464 article reviews
anti vimentin - by Bioz Stars,
2026-10
96/100 stars
Images
Related Articles
Immunohistochemistry:Article Title: Machine learning-based integration develops a hypoxia-derived signature for improving outcomes in glioma Article Snippet: .. IHC assays were conducted utilizing primary antibodies targeting CD8 (Proteintech, China), PD-1 (Proteintech, China), HIF1A (CST, United States), Ki67(CST, United States), STAT3 (Proteintech, China), Western Blot:Article Title: PPP1CA promotes hepatocellular carcinoma progression in a YAP1-dependent way. Article Snippet: Hepatocellular carcinoma (HCC) exhibits high incidence, malignancy, and mortality rates.. Inactivation of the Hippo pathway has been implicated in the acquisition of malignant characteristics in HCC.. The present study identifies upregulation of protein phosphatase 1 catalytic subunit alpha (PPP1CA) in HCC tissues, with elevated PPP1CA expression correlating with poor prognosis in patients with HCC. Incubation:Article Title: PPP1CA promotes hepatocellular carcinoma progression in a YAP1-dependent way. Article Snippet: Hepatocellular carcinoma (HCC) exhibits high incidence, malignancy, and mortality rates.. Inactivation of the Hippo pathway has been implicated in the acquisition of malignant characteristics in HCC.. The present study identifies upregulation of protein phosphatase 1 catalytic subunit alpha (PPP1CA) in HCC tissues, with elevated PPP1CA expression correlating with poor prognosis in patients with HCC. Article Title: Transcriptomic comparison of avian auditory and vestibular sensory epithelia Article Snippet: .. The samples were immersed in a blocking buffer containing 1% BSA for 30 minutes, followed by an overnight incubation with primary antibodies (MYO7A (1:500, Proteus Biosciences), Article Title: Integrated Multi‐Omics and Experimental Validation Unveil the GZMK/NF‐κB Axis Driving Inflammation and Fibroblast Proliferation in Rosacea: A Novel Drug Target Selection Strategy Article Snippet: .. For immunofluorescence staining, the slice was incubated in a solution containing primary antibodies of Ki67 (Proteintech, 84 432–1- RR, China) and Blocking Assay:Article Title: Transcriptomic comparison of avian auditory and vestibular sensory epithelia Article Snippet: .. The samples were immersed in a blocking buffer containing 1% BSA for 30 minutes, followed by an overnight incubation with primary antibodies (MYO7A (1:500, Proteus Biosciences), Gentle:Article Title: Transcriptomic comparison of avian auditory and vestibular sensory epithelia Article Snippet: .. The samples were immersed in a blocking buffer containing 1% BSA for 30 minutes, followed by an overnight incubation with primary antibodies (MYO7A (1:500, Proteus Biosciences), other:Article Title: Lactate production by tumor-resident Staphylococcus promotes metastatic colonization in lung adenocarcinoma. Article Snippet: For transduction, lentivirus (Guiding sequence for shNDRG1-1: GCACATTGTGAATGACATGAA; shNDRG1-2: TGCTCTAAACAAC CCTGAGAT) and transducing vectors were purchased from Genechem. Immunofluorescence:Article Title: Integrated Multi‐Omics and Experimental Validation Unveil the GZMK/NF‐κB Axis Driving Inflammation and Fibroblast Proliferation in Rosacea: A Novel Drug Target Selection Strategy Article Snippet: .. For immunofluorescence staining, the slice was incubated in a solution containing primary antibodies of Ki67 (Proteintech, 84 432–1- RR, China) and Staining:Article Title: Integrated Multi‐Omics and Experimental Validation Unveil the GZMK/NF‐κB Axis Driving Inflammation and Fibroblast Proliferation in Rosacea: A Novel Drug Target Selection Strategy Article Snippet: .. For immunofluorescence staining, the slice was incubated in a solution containing primary antibodies of Ki67 (Proteintech, 84 432–1- RR, China) and Labeling:Article Title: Integrated Multi‐Omics and Experimental Validation Unveil the GZMK/NF‐κB Axis Driving Inflammation and Fibroblast Proliferation in Rosacea: A Novel Drug Target Selection Strategy Article Snippet: .. For immunofluorescence staining, the slice was incubated in a solution containing primary antibodies of Ki67 (Proteintech, 84 432–1- RR, China) and |