sil1  (Proteintech)

Journal: Nutrients

Article Title: Neuroprotective Effects of Desert Milk Exosomes in LPS-Induced Cognitive Decline: Role of Microglial M2 Polarization and AMPK Signaling

doi: 10.3390/nu18020315

Figure Lengend Snippet: Quality assessment of proteome data by label-free quantification. ( A ) Principal component analysis. ( B ) Hierarchical clustering analysis of differential protein expression profiles between D-Exo and ND-Exo. Red = Exosomes proteins with higher expression, green = Exosomes proteins with lower expression. ( C ) Difference expression pattern between D-Exo and ND-Exo. FDR = false discovery rate; FC = fold change. ( D ) The SIL1, FN1 protein with representative image by WB. ( E , F ) Expression of SIL1 and FN1 proteins in D-Exo and ND-Exo by WB method. Data are presented as mean ± SEM ( n = 3 per group). Statistically significant differences were indicated: * p < 0.05, ** p < 0.01, *** p < 0.001, ns > 0.05.

Article Snippet: Following blocking with 5% BSA, the membranes were incubated overnight at 4 °C with the primary antibody for FN1 (cat. #15613-1-AP, Proteintech, Shanghai, China), SIL1 (cat. #24110-1-AP, Proteintech, Shanghai, China), AMPK (cat. #10929-2-AP, Proteintech, Shanghai, China), phospho-AMPK (cat. #80209-6-RR, Proteintech, Shanghai, China), and GAPDH (cat. #10494-1-AP, Proteintech, Shanghai, China).

Techniques: Quantitative Proteomics, Expressing

Journal: Molecular Neurobiology

Article Title: Systematic Phenotyping and Molecular Analysis of the Woozy Mouse: A Preclinical Model of Cerebellar Ataxia

doi: 10.1007/s12035-025-05577-y

Figure Lengend Snippet: Progression of cerebellar damage shown over the weeks. Latency to fall in the overall population ( a ), male ( b ), female ( c ), Sil1 ht ( d ), and Sil1 wz ( e ) mice. Data are represented as scattered dot plots (mean ± SEM, of each group) and expressed as the percentage of the maximum time for the individual animal. Sil1 wz = green circles; Sil1 ht = blue circles. Significant differences are indicated (*p < 0.05, **p < 0.01, ***p < 0.005, ****p < 0.001)

Article Snippet: Sil1 homozygous (woozy) mice ( Sil1 wz ) were produced by crossing Sil1 heterozygous mice ( Sil1 ht ) (CXB5/By- Sil1 wz /J, JAX stock #003777), supplied by The Jackson Laboratory (Maine, USA).

Techniques:

Journal: Molecular Neurobiology

Article Title: Systematic Phenotyping and Molecular Analysis of the Woozy Mouse: A Preclinical Model of Cerebellar Ataxia

doi: 10.1007/s12035-025-05577-y

Figure Lengend Snippet: The beam walking test highlights the coordination problems manifested by the Sil1 wz mice. Time to traverse the bar and number of contralateral falls in the overall population ( a , d ), male ( b , e ), and female ( c , f ) mice. Data are represented as scattered dot plots (mean ± SEM, of each group). Sil1 wz = green circles; Sil1 ht = blue circles. Significant differences are indicated (*p < 0.05, **p < 0.01, ***p < 0.005, ****p < 0.001)

Article Snippet: Sil1 homozygous (woozy) mice ( Sil1 wz ) were produced by crossing Sil1 heterozygous mice ( Sil1 ht ) (CXB5/By- Sil1 wz /J, JAX stock #003777), supplied by The Jackson Laboratory (Maine, USA).

Techniques:

Journal: Molecular Neurobiology

Article Title: Systematic Phenotyping and Molecular Analysis of the Woozy Mouse: A Preclinical Model of Cerebellar Ataxia

doi: 10.1007/s12035-025-05577-y

Figure Lengend Snippet: Genotype- and sex-dependent impairments in the pole test manifested by the Sil1 wz mice. Turning (T-turn) and total (T-total) time at the 14 th and 16 th week of life in the overall population ( a ), male ( b ), female ( c ), Sil1 ht ( d ), and Sil1 wz ( e ) mice. Data are represented as scattered dot plots (mean ± SEM, of each group). Sil1 wz = green circles; Sil1 ht = blue circles; Males = blue circles; Females = red circles. Significant differences are indicated (*p < 0.05, **p < 0.01, ***p < 0.005)

Article Snippet: Sil1 homozygous (woozy) mice ( Sil1 wz ) were produced by crossing Sil1 heterozygous mice ( Sil1 ht ) (CXB5/By- Sil1 wz /J, JAX stock #003777), supplied by The Jackson Laboratory (Maine, USA).

Techniques:

Journal: Molecular Neurobiology

Article Title: Systematic Phenotyping and Molecular Analysis of the Woozy Mouse: A Preclinical Model of Cerebellar Ataxia

doi: 10.1007/s12035-025-05577-y

Figure Lengend Snippet: Muscular coordination impairment highlighted by the increased immobility in the Sil1 wz mice. Latency to fall, number of episodes, and immobility time for the individual parameter scored in the overall population ( a , d , g ), male ( b , e , h ), and female ( c , f , i ) mice. Data are represented as scattered dot plots (mean ± SEM, of each group). Sil1 wz = green circles; Sil1 ht = blue circles. Significant differences are indicated (*p < 0.05, ***p < 0.005)

Article Snippet: Sil1 homozygous (woozy) mice ( Sil1 wz ) were produced by crossing Sil1 heterozygous mice ( Sil1 ht ) (CXB5/By- Sil1 wz /J, JAX stock #003777), supplied by The Jackson Laboratory (Maine, USA).

Techniques:

Journal: Molecular Neurobiology

Article Title: Systematic Phenotyping and Molecular Analysis of the Woozy Mouse: A Preclinical Model of Cerebellar Ataxia

doi: 10.1007/s12035-025-05577-y

Figure Lengend Snippet: Genotype-specific correlation trend in the motor and cognitive tests. Spearman’s correlation analysis between the individual values of motor (Rotarod, Beam walking, Inverted screen, Pole) and cognitive (Nesting) tests considering the overall population ( a ), Sil1 ht ( b ), and Sil1 wz ( c ) mice. Cells filled in green to red gradient of the heat maps (upper part) represent Spearman’s r; cells filled in yellow to red gradient (lower part) represent p values (empty cells stand for p values greater than 0.05). The stars show the missed correlation between two parameters in the same test (blue) or in different tests (green) comparing the two experimental groups. BW = Beam Walking; IS = Inverted screen test; PT = Pole test; NB = Nesting building test

Article Snippet: Sil1 homozygous (woozy) mice ( Sil1 wz ) were produced by crossing Sil1 heterozygous mice ( Sil1 ht ) (CXB5/By- Sil1 wz /J, JAX stock #003777), supplied by The Jackson Laboratory (Maine, USA).

Techniques:

Journal: Molecular Neurobiology

Article Title: Systematic Phenotyping and Molecular Analysis of the Woozy Mouse: A Preclinical Model of Cerebellar Ataxia

doi: 10.1007/s12035-025-05577-y

Figure Lengend Snippet: Cross sectional area differences in the glycolytic but not in the oxidative muscles between the Sil1 wz and Sil1 ht mice. Hematoxylin & Eosin staining of gastrocnemius ( a and b ) and soleus ( d and e ) cross sections. Cross-sectional area (CSA—µm 2 ) of gastrocnemius ( c ) and soleus ( f ) muscular fibres measured in 26-week-old Sil1 ht and Sil1 wz mice. Data are represented as scattered dot plots (mean ± SEM, of each group). Sil1 wz = green circles; Sil1 ht = blue circles. Significant differences are indicated (****p < 0.001). Scale bar corresponds to 100 µm

Article Snippet: Sil1 homozygous (woozy) mice ( Sil1 wz ) were produced by crossing Sil1 heterozygous mice ( Sil1 ht ) (CXB5/By- Sil1 wz /J, JAX stock #003777), supplied by The Jackson Laboratory (Maine, USA).

Techniques: Muscles, Staining

Journal: Molecular Neurobiology

Article Title: Systematic Phenotyping and Molecular Analysis of the Woozy Mouse: A Preclinical Model of Cerebellar Ataxia

doi: 10.1007/s12035-025-05577-y

Figure Lengend Snippet: Increased levels of proteins associated with the unfolded protein response and involved in the proteolysis process in the Sil1 wz mice. Western Blot analysis performed in 26-week-old Sil1 ht and Sil1 wz mice ( a ). Protein fold change (relative to Gapdh) observed in the quadriceps ( b ) and soleus ( c ) of Sil1 ht and Sil1 wz mice. Significant differences are indicated (*p < 0.005, **p < 0.01)

Article Snippet: Sil1 homozygous (woozy) mice ( Sil1 wz ) were produced by crossing Sil1 heterozygous mice ( Sil1 ht ) (CXB5/By- Sil1 wz /J, JAX stock #003777), supplied by The Jackson Laboratory (Maine, USA).

Techniques: Western Blot

Journal: eLife

Article Title: UGGT1-mediated reglucosylation of N -glycan competes with ER-associated degradation of unstable and misfolded glycoproteins

doi: 10.7554/eLife.93117

Figure Lengend Snippet:

Article Snippet: Antibody , anti-Sil1; Rabbit polyclonal , GeneTex , Cat#:GTX116755; RRID: AB_10617803 , WB (1:1000).

Techniques: Recombinant

Journal: BMC Molecular and Cell Biology

Article Title: Role of layilin in regulating mitochondria-mediated apoptosis: a study on B cell lymphoma (BCL)-2 family proteins

doi: 10.1186/s12860-024-00521-9

Figure Lengend Snippet: (A) Localization of laylin in A172 cells. Representative super-resolution images were obtained from double immunostaining for layilin (green) and TOMM20 (red) as a mitochondrial marker. Scale bar = 20 μm. (B) In the Z-stack analysis, orthogonal projections of the area enclosed by a dotted line in the right panel of Fig. 1 (A) were enlarged. Scale bar = 2 μm

Article Snippet: Two different siRNA sequence were employed to target human layilin mRNA: siL1 (nucleotides 1019–1043, AAGCUGCCUUGAAUCUGGCCUACAU) and siL2 (nucleotides 1564–1588, CACAGAAGGUCUAUGAACAAGCUUA) based on NM_001258390.1 (Invitrogen).

Techniques: Double Immunostaining, Marker

Journal: BMC Molecular and Cell Biology

Article Title: Role of layilin in regulating mitochondria-mediated apoptosis: a study on B cell lymphoma (BCL)-2 family proteins

doi: 10.1186/s12860-024-00521-9

Figure Lengend Snippet: Effects of laylin-KD on the levels of BCL-2 family proteins in A172 cells. (A) A172 cells were transfected with control siRNA (siC) and 2 kinds of layilin siRNA (siL1 and siL2). The protein samples extracted from whole cells underwent western blotting. ( B and C ) Band intensities were quantified using densitometry. The intensities of layilin, BAD, BAK, BAX, BIM, BCL-2, and BCL-X L bands were normalized to β-actin bands. The average normalized intensity in the ‘siC’ samples set as 1.0. (D) The BCL-2/BAX ratios were calculated with the “siC” samples as the reference (defined as 1.0). (E) RNA extracted from the cells used for reverse transcription and subject to qPCR to estimate the mRNA levels of layilin, BAD, BCL-2, and GAPDH. Measured mRNA levels of layilin, BAD, and BCL-2 were normalized to GAPDH. In each panel, the average of the normalized or corrected values in siC-transfected samples was defined as 1.0 ( n = 3 in each condition). Mean values with SD are presented. * p < 0.05, ** p < 0.01

Article Snippet: Two different siRNA sequence were employed to target human layilin mRNA: siL1 (nucleotides 1019–1043, AAGCUGCCUUGAAUCUGGCCUACAU) and siL2 (nucleotides 1564–1588, CACAGAAGGUCUAUGAACAAGCUUA) based on NM_001258390.1 (Invitrogen).

Techniques: Transfection, Control, Western Blot, Reverse Transcription

Journal: BMC Molecular and Cell Biology

Article Title: Role of layilin in regulating mitochondria-mediated apoptosis: a study on B cell lymphoma (BCL)-2 family proteins

doi: 10.1186/s12860-024-00521-9

Figure Lengend Snippet: Effects of laylin-KD on mitochondrial membrane potential. (A) A172 cells, transfected with siL1, siL2 or siC, were plated on 35 mm glass-based dishes. After 24 h, the culture medium was replaced with serum-free RPMI containing MT-1. Following a 30 min incubation, the cells were washed with HBSS, cultured with serum-free RPMI containing 5 µM FCCP for 30 min, and then fixed in PBS containing 4% paraformaldehyde. MT-1 was visualized using a fluorescence microscope. Scale bars: 100 μm. (B) The fluorescence intensity of MT-1 was measured using the BZ-II Analyzer Ver. 1.42. Brightness levels were quantified by calculating the sum of fluorescence intensity for all pixels. The average of brightness levels in the ‘siC, FCCP (-)’ samples, which were transfected with siC, were defined as 1.0 ( n = 3 in each condition). Mean values with SD are presented. * p < 0.05, ** p < 0.01 (closed bars vs. open bars), †† p < 0.01 (vs. siC, closed bars), ‡‡ p < 0.01 (vs. siC, open bars)

Article Snippet: Two different siRNA sequence were employed to target human layilin mRNA: siL1 (nucleotides 1019–1043, AAGCUGCCUUGAAUCUGGCCUACAU) and siL2 (nucleotides 1564–1588, CACAGAAGGUCUAUGAACAAGCUUA) based on NM_001258390.1 (Invitrogen).

Techniques: Membrane, Transfection, Incubation, Cell Culture, Fluorescence, Microscopy

Journal: BMC Molecular and Cell Biology

Article Title: Role of layilin in regulating mitochondria-mediated apoptosis: a study on B cell lymphoma (BCL)-2 family proteins

doi: 10.1186/s12860-024-00521-9

Figure Lengend Snippet: Effects of laylin-KD on apoptosis-related proteins and DNA fragmentation. A172 cells were transfected with control siRNA (siC) and 2 kinds of layilin siRNA (siL1 and siL2). After 24 h, the culture medium was replaced with RPMI containing 50 µM STS. (A) Three hours later, cells were subjected to Annexin V and PI assay. The intensity of cell membrane-bound Annexin V and DNA-bound PI were expressed in RLU (relative luminescence units) and RFU (relative fluorescence units), respectively. (B) Four hours later, the protein samples extracted from the whole cells were subjected to western blotting. ( C and D ) Intensity of detected bands was measured by densitometry. The measured intensity of the layilin, cleaved CASP-3, cleaved CASP-6, cleaved CASP-7, and cleaved PARP1 bands was normalized using that of β-actin bands. The average of the normalized intensity of the layilin, cleaved CASP-3, cleaved CASP-6, cleaved CASP-7, and cleaved PARP1 bands in the ‘siC, STS (-)’ samples was defined as 1.0. Mean values with SD are presented. * p < 0.05, ** p < 0.01. (E) A172 cells, transfected with siL-1, siL-2 or siC (1.0 × 10 6 cells) in RPMI containing 10% FBS, were plated on Φ100 mm dishes. The cells were cultured with RPMI containing 400 µM STS for 4 h. Then, fragmented DNA isolated from the cells was subjected to agarose gel electrophoresis (left). DNA in the gels was visualized under ultraviolet light after staining with ethidium bromide and photographed. The intensity of the detected DNA bands was measured by densitometry. The average of the DNA fragmentation levels in the ‘siC, STS (-)’ samples was defined as 1.0 ( n = 3 in each condition). Mean values with SD are shown. * p < 0.05, ** p < 0.01 (siC vs. siL1, closed), † p < 0.05, †† p < 0.01 (siC vs. siL2, closed)

Article Snippet: Two different siRNA sequence were employed to target human layilin mRNA: siL1 (nucleotides 1019–1043, AAGCUGCCUUGAAUCUGGCCUACAU) and siL2 (nucleotides 1564–1588, CACAGAAGGUCUAUGAACAAGCUUA) based on NM_001258390.1 (Invitrogen).

Techniques: Transfection, Control, Membrane, Fluorescence, Western Blot, Cell Culture, Isolation, Agarose Gel Electrophoresis, Staining