Review



1ap rabbit anti ppt2 proteintech  (Proteintech)


Bioz Verified Symbol Proteintech is a verified supplier  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 92

    Structured Review

    Proteintech 1ap rabbit anti ppt2 proteintech
    1ap Rabbit Anti Ppt2 Proteintech, supplied by Proteintech, used in various techniques. Bioz Stars score: 92/100, based on 3 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/1ap rabbit anti ppt2 proteintech/product/Proteintech
    Average 92 stars, based on 3 article reviews
    1ap rabbit anti ppt2 proteintech - by Bioz Stars, 2026-05
    92/100 stars

    Images



    Similar Products

    92
    Proteintech 1ap rabbit anti ppt2 proteintech
    1ap Rabbit Anti Ppt2 Proteintech, supplied by Proteintech, used in various techniques. Bioz Stars score: 92/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/1ap rabbit anti ppt2 proteintech/product/Proteintech
    Average 92 stars, based on 1 article reviews
    1ap rabbit anti ppt2 proteintech - by Bioz Stars, 2026-05
    92/100 stars
      Buy from Supplier

    92
    Proteintech rabbit anti ppt2
    Reagents and tools table
    Rabbit Anti Ppt2, supplied by Proteintech, used in various techniques. Bioz Stars score: 92/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/rabbit anti ppt2/product/Proteintech
    Average 92 stars, based on 1 article reviews
    rabbit anti ppt2 - by Bioz Stars, 2026-05
    92/100 stars
      Buy from Supplier

    92
    Proteintech 1ap
    Reagents and tools table
    1ap, supplied by Proteintech, used in various techniques. Bioz Stars score: 92/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/1ap/product/Proteintech
    Average 92 stars, based on 1 article reviews
    1ap - by Bioz Stars, 2026-05
    92/100 stars
      Buy from Supplier

    92
    Proteintech anti ppt2
    Reagents and tools table
    Anti Ppt2, supplied by Proteintech, used in various techniques. Bioz Stars score: 92/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/anti ppt2/product/Proteintech
    Average 92 stars, based on 1 article reviews
    anti ppt2 - by Bioz Stars, 2026-05
    92/100 stars
      Buy from Supplier

    90
    Ribobio co synthetic sirna oligonucleotides targeting ppt2
    The <t> PPT2 </t> protein levels in the OC and normal ovary tissues
    Synthetic Sirna Oligonucleotides Targeting Ppt2, supplied by Ribobio co, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/synthetic sirna oligonucleotides targeting ppt2/product/Ribobio co
    Average 90 stars, based on 1 article reviews
    synthetic sirna oligonucleotides targeting ppt2 - by Bioz Stars, 2026-05
    90/100 stars
      Buy from Supplier

    90
    Sangon Biotech custom primers ppt2 (f: ggacttcgggtgcgcgtt, r: gaagagcccatgcaccacga
    The <t> PPT2 </t> protein levels in the OC and normal ovary tissues
    Custom Primers Ppt2 (F: Ggacttcgggtgcgcgtt, R: Gaagagcccatgcaccacga, supplied by Sangon Biotech, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/custom primers ppt2 (f: ggacttcgggtgcgcgtt, r: gaagagcccatgcaccacga/product/Sangon Biotech
    Average 90 stars, based on 1 article reviews
    custom primers ppt2 (f: ggacttcgggtgcgcgtt, r: gaagagcccatgcaccacga - by Bioz Stars, 2026-05
    90/100 stars
      Buy from Supplier

    92
    Proteintech ppt2
    Expression of depalmitoylases in skeletal muscle and myoblasts. ( A ) Heatmap reveals depalmitoylase gene expression regulation in mouse skeletal muscle 24 hours after pDNA delivery compared to control muscle, n = 4–5 per group. ( B ) Western blots showing the effect of pDNA electrotransfer on <t>PPT2</t> protein levels in C2C12 myoblasts, n = 3. **** p < 0.0001, *** p < 0.001, ** p < 0.01, * p < 0.05 compared to the control. Control, naïve cells or tissues; EP, pulse application; pDNA, gWiz Luc; pDNA+EP, pDNA electrotransfer.
    Ppt2, supplied by Proteintech, used in various techniques. Bioz Stars score: 92/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/ppt2/product/Proteintech
    Average 92 stars, based on 1 article reviews
    ppt2 - by Bioz Stars, 2026-05
    92/100 stars
      Buy from Supplier

    90
    honeywell international precision pressure transducer (ppt2) pressure transducer
    Overview of Instruments Deployed on ACT‐America Flight Campaigns
    Precision Pressure Transducer (Ppt2) Pressure Transducer, supplied by honeywell international, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/precision pressure transducer (ppt2) pressure transducer/product/honeywell international
    Average 90 stars, based on 1 article reviews
    precision pressure transducer (ppt2) pressure transducer - by Bioz Stars, 2026-05
    90/100 stars
      Buy from Supplier

    90
    honeywell international precision pressure transducer ppt2
    Overview of Instruments Deployed on ACT‐America Flight Campaigns
    Precision Pressure Transducer Ppt2, supplied by honeywell international, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/precision pressure transducer ppt2/product/honeywell international
    Average 90 stars, based on 1 article reviews
    precision pressure transducer ppt2 - by Bioz Stars, 2026-05
    90/100 stars
      Buy from Supplier

    90
    Vigene Biosciences plasmids overexpressing ppt2
    <t>PPT2</t> is downregulated in ccRCC and has significant correlations with patients' survival. (A) Heat map depicting PPT family mRNA expression of all cases from TCGA database; red signifies high expression, yellow signifies medium expression, blue signifies low expression. (B) Comparison of PPT family mRNA expression in paired and in non-paired groups. (C-D) The mRNA expression of PPT2 and PPT1 was divided into low expression group and high expression group respectively on the basis of the median, the survival rate of two corresponding groups was evaluated with Kaplan Meier method and tested by using log rank test.
    Plasmids Overexpressing Ppt2, supplied by Vigene Biosciences, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/plasmids overexpressing ppt2/product/Vigene Biosciences
    Average 90 stars, based on 1 article reviews
    plasmids overexpressing ppt2 - by Bioz Stars, 2026-05
    90/100 stars
      Buy from Supplier

    Image Search Results


    Reagents and tools table

    Journal: EMBO Reports

    Article Title: Palmitoylation by ZDHHC4 inhibits TRPV1-mediated nociception

    doi: 10.1038/s44319-024-00317-0

    Figure Lengend Snippet: Reagents and tools table

    Article Snippet: Rabbit anti-PPT2 , Proteintech , Cat# 15429-1AP.

    Techniques: Control, Recombinant, Plasmid Preparation, Sequencing, shRNA, Virus, Software, cDNA Synthesis, SYBR Green Assay

    Reagents and tools table

    Journal: EMBO Reports

    Article Title: Palmitoylation by ZDHHC4 inhibits TRPV1-mediated nociception

    doi: 10.1038/s44319-024-00317-0

    Figure Lengend Snippet: Reagents and tools table

    Article Snippet: Rabbit anti-PPT2 , Proteintech , Cat# 15429-1AP.

    Techniques: Control, Recombinant, Plasmid Preparation, Sequencing, shRNA, Virus, Software, cDNA Synthesis, SYBR Green Assay

    The  PPT2  protein levels in the OC and normal ovary tissues

    Journal: Journal of Ovarian Research

    Article Title: Investigating PPT2’s role in ovarian cancer prognosis and immunotherapy outcomes

    doi: 10.1186/s13048-024-01527-9

    Figure Lengend Snippet: The PPT2 protein levels in the OC and normal ovary tissues

    Article Snippet: Synthetic siRNA oligonucleotides targeting PPT2 were designed and synthesized by RiboBio (Guangzhou, China).

    Techniques: Expressing

    The expression status of PPT2 in OC single-cell database. ( A - D ) The expression of PPT2 was lower in malignant cell type in OC datasets EMTAB8107, GSE147082, GSE151214, and GSE154600

    Journal: Journal of Ovarian Research

    Article Title: Investigating PPT2’s role in ovarian cancer prognosis and immunotherapy outcomes

    doi: 10.1186/s13048-024-01527-9

    Figure Lengend Snippet: The expression status of PPT2 in OC single-cell database. ( A - D ) The expression of PPT2 was lower in malignant cell type in OC datasets EMTAB8107, GSE147082, GSE151214, and GSE154600

    Article Snippet: Synthetic siRNA oligonucleotides targeting PPT2 were designed and synthesized by RiboBio (Guangzhou, China).

    Techniques: Expressing

    The prognosis value of PPT2 in OC. ( A - B ) Kaplan-Meier survival curve for comparing the high and low expression of PPT2 in an in-house OC cohort associated with OS, and PFS respectively. ( C ) Kaplan-Meier survival curves for comparing the high and low expression of PPT2 associated with OS in datasets GSE23554, GSE26712, GSE32063, GSE51088, GSE63885, GSE140082, and TCGA respectively. ( D ) Kaplan-Meier survival curves for comparing the high and low expression of PPT2 associated with PFS in datasets GSE32063, and GSE140082 respectively. ( E ) Kaplan-Meier survival curves for comparing the high and low expression of PPT2 in the TCGA dataset associated with DSS. ( F ) Cox regression survival analysis in pan-cancer

    Journal: Journal of Ovarian Research

    Article Title: Investigating PPT2’s role in ovarian cancer prognosis and immunotherapy outcomes

    doi: 10.1186/s13048-024-01527-9

    Figure Lengend Snippet: The prognosis value of PPT2 in OC. ( A - B ) Kaplan-Meier survival curve for comparing the high and low expression of PPT2 in an in-house OC cohort associated with OS, and PFS respectively. ( C ) Kaplan-Meier survival curves for comparing the high and low expression of PPT2 associated with OS in datasets GSE23554, GSE26712, GSE32063, GSE51088, GSE63885, GSE140082, and TCGA respectively. ( D ) Kaplan-Meier survival curves for comparing the high and low expression of PPT2 associated with PFS in datasets GSE32063, and GSE140082 respectively. ( E ) Kaplan-Meier survival curves for comparing the high and low expression of PPT2 in the TCGA dataset associated with DSS. ( F ) Cox regression survival analysis in pan-cancer

    Article Snippet: Synthetic siRNA oligonucleotides targeting PPT2 were designed and synthesized by RiboBio (Guangzhou, China).

    Techniques: Expressing

    PPT2 served as an independent prognostic factor in OC ( A - C ) Univariate and multivariate Cox regression analysis for OS in datasets GSE140082, TCGA, and GSE32063. ( D ) Univariate and multivariate Cox regression analysis for PFS in dataset GSE32063. ( E ) Nomogram predicting 1-year, 3-year and 5-year survival. * p < 0.05, ** p < 0.01, and *** p < 0.001. ( F ) Calibration curves for 1-year, 3-year and 5-year survival probability. ( G ) The 1-year (0.711), 3-year (0.643), 5-year (0.647) ROC curves predicted by the nomogram score

    Journal: Journal of Ovarian Research

    Article Title: Investigating PPT2’s role in ovarian cancer prognosis and immunotherapy outcomes

    doi: 10.1186/s13048-024-01527-9

    Figure Lengend Snippet: PPT2 served as an independent prognostic factor in OC ( A - C ) Univariate and multivariate Cox regression analysis for OS in datasets GSE140082, TCGA, and GSE32063. ( D ) Univariate and multivariate Cox regression analysis for PFS in dataset GSE32063. ( E ) Nomogram predicting 1-year, 3-year and 5-year survival. * p < 0.05, ** p < 0.01, and *** p < 0.001. ( F ) Calibration curves for 1-year, 3-year and 5-year survival probability. ( G ) The 1-year (0.711), 3-year (0.643), 5-year (0.647) ROC curves predicted by the nomogram score

    Article Snippet: Synthetic siRNA oligonucleotides targeting PPT2 were designed and synthesized by RiboBio (Guangzhou, China).

    Techniques:

    Functional Analysis of PPT2 in OC. ( A ) Highly enriched hallmark pathways in the low PPT2 expression group (all p < 0.05, FDR < 0.25, |NES| > 1). ( B ) The global PPT2 highly correlated genes identified by Spearman’s test in the TCGA cohort (LinkedOmics). ( C ) The top 50 positively and 50 negatively correlated significant genes of PPT2 were presented in the heatmap. ( D ) The hub genes (VPS52, RGL2, SLC39A7, PFDN6, COL11A2, RXRB, ZBTB9, RING1, WDR46, and CUTA) associated with PPT2 were identified in OC by CytoHubb

    Journal: Journal of Ovarian Research

    Article Title: Investigating PPT2’s role in ovarian cancer prognosis and immunotherapy outcomes

    doi: 10.1186/s13048-024-01527-9

    Figure Lengend Snippet: Functional Analysis of PPT2 in OC. ( A ) Highly enriched hallmark pathways in the low PPT2 expression group (all p < 0.05, FDR < 0.25, |NES| > 1). ( B ) The global PPT2 highly correlated genes identified by Spearman’s test in the TCGA cohort (LinkedOmics). ( C ) The top 50 positively and 50 negatively correlated significant genes of PPT2 were presented in the heatmap. ( D ) The hub genes (VPS52, RGL2, SLC39A7, PFDN6, COL11A2, RXRB, ZBTB9, RING1, WDR46, and CUTA) associated with PPT2 were identified in OC by CytoHubb

    Article Snippet: Synthetic siRNA oligonucleotides targeting PPT2 were designed and synthesized by RiboBio (Guangzhou, China).

    Techniques: Functional Assay, Expressing

    Correlation of PPT2 expression with immune infiltration level in OC. ( A ) The abundance of different immune cells and immune pathways in the low and high expression of PPT2. ( B ) Comparison of tumor microenvironment (TME) scores between the low and high expression of PPT2. ( C ) Immune infiltration scores of different cells associated with PPT2 expression by different algorithms. ( D ) Correlation between the PPT2 expression and some representative immune infiltration cell scores. * p < 0.05, ** p < 0.01, and *** p < 0.001

    Journal: Journal of Ovarian Research

    Article Title: Investigating PPT2’s role in ovarian cancer prognosis and immunotherapy outcomes

    doi: 10.1186/s13048-024-01527-9

    Figure Lengend Snippet: Correlation of PPT2 expression with immune infiltration level in OC. ( A ) The abundance of different immune cells and immune pathways in the low and high expression of PPT2. ( B ) Comparison of tumor microenvironment (TME) scores between the low and high expression of PPT2. ( C ) Immune infiltration scores of different cells associated with PPT2 expression by different algorithms. ( D ) Correlation between the PPT2 expression and some representative immune infiltration cell scores. * p < 0.05, ** p < 0.01, and *** p < 0.001

    Article Snippet: Synthetic siRNA oligonucleotides targeting PPT2 were designed and synthesized by RiboBio (Guangzhou, China).

    Techniques: Expressing, Comparison

    Evaluation of sensitivity to chemotherapy for PPT2

    Journal: Journal of Ovarian Research

    Article Title: Investigating PPT2’s role in ovarian cancer prognosis and immunotherapy outcomes

    doi: 10.1186/s13048-024-01527-9

    Figure Lengend Snippet: Evaluation of sensitivity to chemotherapy for PPT2

    Article Snippet: Synthetic siRNA oligonucleotides targeting PPT2 were designed and synthesized by RiboBio (Guangzhou, China).

    Techniques:

    PPT2 reduced proliferation and invasion of OC cells. ( A - B ) Stable overexpression of PPT2 in OVCAR3 and A2780 cells. The expression of PPT2 was verified at both mRNA and protein levels. ( C ) Overexpression of PPT2 impaired the colony-forming ability of OVCAR3 cells. ( D ) Overexpression of PPT2 significantly reduced the proliferation rate of OVCAR3 cells. ( E ) Transwell assay results showed that overexpression of PPT2 could significantly decreased the invasion of OVCAR3 cells. ( F ) Overexpression of PPT2 impaired the colony-forming ability of A2780 cells. ( G ) Overexpression of PPT2 significantly reduced the proliferation rate of A2780 cells. ( H ) Transwell assay results showed that overexpression of PPT2 could significantly decreased the invasion of A2780 cells. * p < 0.05, ** p < 0.01, and *** p < 0.001

    Journal: Journal of Ovarian Research

    Article Title: Investigating PPT2’s role in ovarian cancer prognosis and immunotherapy outcomes

    doi: 10.1186/s13048-024-01527-9

    Figure Lengend Snippet: PPT2 reduced proliferation and invasion of OC cells. ( A - B ) Stable overexpression of PPT2 in OVCAR3 and A2780 cells. The expression of PPT2 was verified at both mRNA and protein levels. ( C ) Overexpression of PPT2 impaired the colony-forming ability of OVCAR3 cells. ( D ) Overexpression of PPT2 significantly reduced the proliferation rate of OVCAR3 cells. ( E ) Transwell assay results showed that overexpression of PPT2 could significantly decreased the invasion of OVCAR3 cells. ( F ) Overexpression of PPT2 impaired the colony-forming ability of A2780 cells. ( G ) Overexpression of PPT2 significantly reduced the proliferation rate of A2780 cells. ( H ) Transwell assay results showed that overexpression of PPT2 could significantly decreased the invasion of A2780 cells. * p < 0.05, ** p < 0.01, and *** p < 0.001

    Article Snippet: Synthetic siRNA oligonucleotides targeting PPT2 were designed and synthesized by RiboBio (Guangzhou, China).

    Techniques: Over Expression, Expressing, Transwell Assay

    PPT2 promoted proliferation and invasion of OC cells. ( A - B ) Decreased expression of PPT2 in OVCAR8 and OVCA433 cells. The expression of PPT2 was verified at both mRNA and protein levels. ( C ) Decreased expression of PPT2 promoted the colony-forming ability of OVCAR8 cells. ( D ) Decreased expression of PPT2 significantly promoted the proliferation rate of OVCAR8 cells. ( E ) Transwell assay results showed that decreased expression of PPT2 could significantly promoted the invasion of OVCAR8 cells. ( F ) Decreased expression of PPT2 promoted the colony-forming ability of OVCA433 cells. ( G ) Decreased expression of PPT2 significantly promoted the proliferation rate of OVCA433 cells. ( H ) Transwell assay results showed that decreased expression of PPT2 could significantly promoted the invasion of OVCA433 cells. * p < 0.05, ** p < 0.01, and *** p < 0.001

    Journal: Journal of Ovarian Research

    Article Title: Investigating PPT2’s role in ovarian cancer prognosis and immunotherapy outcomes

    doi: 10.1186/s13048-024-01527-9

    Figure Lengend Snippet: PPT2 promoted proliferation and invasion of OC cells. ( A - B ) Decreased expression of PPT2 in OVCAR8 and OVCA433 cells. The expression of PPT2 was verified at both mRNA and protein levels. ( C ) Decreased expression of PPT2 promoted the colony-forming ability of OVCAR8 cells. ( D ) Decreased expression of PPT2 significantly promoted the proliferation rate of OVCAR8 cells. ( E ) Transwell assay results showed that decreased expression of PPT2 could significantly promoted the invasion of OVCAR8 cells. ( F ) Decreased expression of PPT2 promoted the colony-forming ability of OVCA433 cells. ( G ) Decreased expression of PPT2 significantly promoted the proliferation rate of OVCA433 cells. ( H ) Transwell assay results showed that decreased expression of PPT2 could significantly promoted the invasion of OVCA433 cells. * p < 0.05, ** p < 0.01, and *** p < 0.001

    Article Snippet: Synthetic siRNA oligonucleotides targeting PPT2 were designed and synthesized by RiboBio (Guangzhou, China).

    Techniques: Expressing, Transwell Assay

    The  PPT2  protein levels in the OC and normal ovary tissues

    Journal: Journal of Ovarian Research

    Article Title: Investigating PPT2’s role in ovarian cancer prognosis and immunotherapy outcomes

    doi: 10.1186/s13048-024-01527-9

    Figure Lengend Snippet: The PPT2 protein levels in the OC and normal ovary tissues

    Article Snippet: Custom primers for PPT2 (F: GGACTTCGGGTGCGCGTT, R: GAAGAGCCCATGCACCACGA) and β-actin (F: GTGGCCGAGGACTTTGATTG, R: CCTGTAACAACGCATCTCATATT) were acquired from Sangon Biotech Co. Ltd. (Shanghai, China).

    Techniques: Expressing

    The expression status of PPT2 in OC single-cell database. ( A - D ) The expression of PPT2 was lower in malignant cell type in OC datasets EMTAB8107, GSE147082, GSE151214, and GSE154600

    Journal: Journal of Ovarian Research

    Article Title: Investigating PPT2’s role in ovarian cancer prognosis and immunotherapy outcomes

    doi: 10.1186/s13048-024-01527-9

    Figure Lengend Snippet: The expression status of PPT2 in OC single-cell database. ( A - D ) The expression of PPT2 was lower in malignant cell type in OC datasets EMTAB8107, GSE147082, GSE151214, and GSE154600

    Article Snippet: Custom primers for PPT2 (F: GGACTTCGGGTGCGCGTT, R: GAAGAGCCCATGCACCACGA) and β-actin (F: GTGGCCGAGGACTTTGATTG, R: CCTGTAACAACGCATCTCATATT) were acquired from Sangon Biotech Co. Ltd. (Shanghai, China).

    Techniques: Expressing

    The prognosis value of PPT2 in OC. ( A - B ) Kaplan-Meier survival curve for comparing the high and low expression of PPT2 in an in-house OC cohort associated with OS, and PFS respectively. ( C ) Kaplan-Meier survival curves for comparing the high and low expression of PPT2 associated with OS in datasets GSE23554, GSE26712, GSE32063, GSE51088, GSE63885, GSE140082, and TCGA respectively. ( D ) Kaplan-Meier survival curves for comparing the high and low expression of PPT2 associated with PFS in datasets GSE32063, and GSE140082 respectively. ( E ) Kaplan-Meier survival curves for comparing the high and low expression of PPT2 in the TCGA dataset associated with DSS. ( F ) Cox regression survival analysis in pan-cancer

    Journal: Journal of Ovarian Research

    Article Title: Investigating PPT2’s role in ovarian cancer prognosis and immunotherapy outcomes

    doi: 10.1186/s13048-024-01527-9

    Figure Lengend Snippet: The prognosis value of PPT2 in OC. ( A - B ) Kaplan-Meier survival curve for comparing the high and low expression of PPT2 in an in-house OC cohort associated with OS, and PFS respectively. ( C ) Kaplan-Meier survival curves for comparing the high and low expression of PPT2 associated with OS in datasets GSE23554, GSE26712, GSE32063, GSE51088, GSE63885, GSE140082, and TCGA respectively. ( D ) Kaplan-Meier survival curves for comparing the high and low expression of PPT2 associated with PFS in datasets GSE32063, and GSE140082 respectively. ( E ) Kaplan-Meier survival curves for comparing the high and low expression of PPT2 in the TCGA dataset associated with DSS. ( F ) Cox regression survival analysis in pan-cancer

    Article Snippet: Custom primers for PPT2 (F: GGACTTCGGGTGCGCGTT, R: GAAGAGCCCATGCACCACGA) and β-actin (F: GTGGCCGAGGACTTTGATTG, R: CCTGTAACAACGCATCTCATATT) were acquired from Sangon Biotech Co. Ltd. (Shanghai, China).

    Techniques: Expressing

    PPT2 served as an independent prognostic factor in OC ( A - C ) Univariate and multivariate Cox regression analysis for OS in datasets GSE140082, TCGA, and GSE32063. ( D ) Univariate and multivariate Cox regression analysis for PFS in dataset GSE32063. ( E ) Nomogram predicting 1-year, 3-year and 5-year survival. * p < 0.05, ** p < 0.01, and *** p < 0.001. ( F ) Calibration curves for 1-year, 3-year and 5-year survival probability. ( G ) The 1-year (0.711), 3-year (0.643), 5-year (0.647) ROC curves predicted by the nomogram score

    Journal: Journal of Ovarian Research

    Article Title: Investigating PPT2’s role in ovarian cancer prognosis and immunotherapy outcomes

    doi: 10.1186/s13048-024-01527-9

    Figure Lengend Snippet: PPT2 served as an independent prognostic factor in OC ( A - C ) Univariate and multivariate Cox regression analysis for OS in datasets GSE140082, TCGA, and GSE32063. ( D ) Univariate and multivariate Cox regression analysis for PFS in dataset GSE32063. ( E ) Nomogram predicting 1-year, 3-year and 5-year survival. * p < 0.05, ** p < 0.01, and *** p < 0.001. ( F ) Calibration curves for 1-year, 3-year and 5-year survival probability. ( G ) The 1-year (0.711), 3-year (0.643), 5-year (0.647) ROC curves predicted by the nomogram score

    Article Snippet: Custom primers for PPT2 (F: GGACTTCGGGTGCGCGTT, R: GAAGAGCCCATGCACCACGA) and β-actin (F: GTGGCCGAGGACTTTGATTG, R: CCTGTAACAACGCATCTCATATT) were acquired from Sangon Biotech Co. Ltd. (Shanghai, China).

    Techniques:

    Functional Analysis of PPT2 in OC. ( A ) Highly enriched hallmark pathways in the low PPT2 expression group (all p < 0.05, FDR < 0.25, |NES| > 1). ( B ) The global PPT2 highly correlated genes identified by Spearman’s test in the TCGA cohort (LinkedOmics). ( C ) The top 50 positively and 50 negatively correlated significant genes of PPT2 were presented in the heatmap. ( D ) The hub genes (VPS52, RGL2, SLC39A7, PFDN6, COL11A2, RXRB, ZBTB9, RING1, WDR46, and CUTA) associated with PPT2 were identified in OC by CytoHubb

    Journal: Journal of Ovarian Research

    Article Title: Investigating PPT2’s role in ovarian cancer prognosis and immunotherapy outcomes

    doi: 10.1186/s13048-024-01527-9

    Figure Lengend Snippet: Functional Analysis of PPT2 in OC. ( A ) Highly enriched hallmark pathways in the low PPT2 expression group (all p < 0.05, FDR < 0.25, |NES| > 1). ( B ) The global PPT2 highly correlated genes identified by Spearman’s test in the TCGA cohort (LinkedOmics). ( C ) The top 50 positively and 50 negatively correlated significant genes of PPT2 were presented in the heatmap. ( D ) The hub genes (VPS52, RGL2, SLC39A7, PFDN6, COL11A2, RXRB, ZBTB9, RING1, WDR46, and CUTA) associated with PPT2 were identified in OC by CytoHubb

    Article Snippet: Custom primers for PPT2 (F: GGACTTCGGGTGCGCGTT, R: GAAGAGCCCATGCACCACGA) and β-actin (F: GTGGCCGAGGACTTTGATTG, R: CCTGTAACAACGCATCTCATATT) were acquired from Sangon Biotech Co. Ltd. (Shanghai, China).

    Techniques: Functional Assay, Expressing

    Correlation of PPT2 expression with immune infiltration level in OC. ( A ) The abundance of different immune cells and immune pathways in the low and high expression of PPT2. ( B ) Comparison of tumor microenvironment (TME) scores between the low and high expression of PPT2. ( C ) Immune infiltration scores of different cells associated with PPT2 expression by different algorithms. ( D ) Correlation between the PPT2 expression and some representative immune infiltration cell scores. * p < 0.05, ** p < 0.01, and *** p < 0.001

    Journal: Journal of Ovarian Research

    Article Title: Investigating PPT2’s role in ovarian cancer prognosis and immunotherapy outcomes

    doi: 10.1186/s13048-024-01527-9

    Figure Lengend Snippet: Correlation of PPT2 expression with immune infiltration level in OC. ( A ) The abundance of different immune cells and immune pathways in the low and high expression of PPT2. ( B ) Comparison of tumor microenvironment (TME) scores between the low and high expression of PPT2. ( C ) Immune infiltration scores of different cells associated with PPT2 expression by different algorithms. ( D ) Correlation between the PPT2 expression and some representative immune infiltration cell scores. * p < 0.05, ** p < 0.01, and *** p < 0.001

    Article Snippet: Custom primers for PPT2 (F: GGACTTCGGGTGCGCGTT, R: GAAGAGCCCATGCACCACGA) and β-actin (F: GTGGCCGAGGACTTTGATTG, R: CCTGTAACAACGCATCTCATATT) were acquired from Sangon Biotech Co. Ltd. (Shanghai, China).

    Techniques: Expressing, Comparison

    Evaluation of sensitivity to chemotherapy for PPT2

    Journal: Journal of Ovarian Research

    Article Title: Investigating PPT2’s role in ovarian cancer prognosis and immunotherapy outcomes

    doi: 10.1186/s13048-024-01527-9

    Figure Lengend Snippet: Evaluation of sensitivity to chemotherapy for PPT2

    Article Snippet: Custom primers for PPT2 (F: GGACTTCGGGTGCGCGTT, R: GAAGAGCCCATGCACCACGA) and β-actin (F: GTGGCCGAGGACTTTGATTG, R: CCTGTAACAACGCATCTCATATT) were acquired from Sangon Biotech Co. Ltd. (Shanghai, China).

    Techniques:

    PPT2 reduced proliferation and invasion of OC cells. ( A - B ) Stable overexpression of PPT2 in OVCAR3 and A2780 cells. The expression of PPT2 was verified at both mRNA and protein levels. ( C ) Overexpression of PPT2 impaired the colony-forming ability of OVCAR3 cells. ( D ) Overexpression of PPT2 significantly reduced the proliferation rate of OVCAR3 cells. ( E ) Transwell assay results showed that overexpression of PPT2 could significantly decreased the invasion of OVCAR3 cells. ( F ) Overexpression of PPT2 impaired the colony-forming ability of A2780 cells. ( G ) Overexpression of PPT2 significantly reduced the proliferation rate of A2780 cells. ( H ) Transwell assay results showed that overexpression of PPT2 could significantly decreased the invasion of A2780 cells. * p < 0.05, ** p < 0.01, and *** p < 0.001

    Journal: Journal of Ovarian Research

    Article Title: Investigating PPT2’s role in ovarian cancer prognosis and immunotherapy outcomes

    doi: 10.1186/s13048-024-01527-9

    Figure Lengend Snippet: PPT2 reduced proliferation and invasion of OC cells. ( A - B ) Stable overexpression of PPT2 in OVCAR3 and A2780 cells. The expression of PPT2 was verified at both mRNA and protein levels. ( C ) Overexpression of PPT2 impaired the colony-forming ability of OVCAR3 cells. ( D ) Overexpression of PPT2 significantly reduced the proliferation rate of OVCAR3 cells. ( E ) Transwell assay results showed that overexpression of PPT2 could significantly decreased the invasion of OVCAR3 cells. ( F ) Overexpression of PPT2 impaired the colony-forming ability of A2780 cells. ( G ) Overexpression of PPT2 significantly reduced the proliferation rate of A2780 cells. ( H ) Transwell assay results showed that overexpression of PPT2 could significantly decreased the invasion of A2780 cells. * p < 0.05, ** p < 0.01, and *** p < 0.001

    Article Snippet: Custom primers for PPT2 (F: GGACTTCGGGTGCGCGTT, R: GAAGAGCCCATGCACCACGA) and β-actin (F: GTGGCCGAGGACTTTGATTG, R: CCTGTAACAACGCATCTCATATT) were acquired from Sangon Biotech Co. Ltd. (Shanghai, China).

    Techniques: Over Expression, Expressing, Transwell Assay

    PPT2 promoted proliferation and invasion of OC cells. ( A - B ) Decreased expression of PPT2 in OVCAR8 and OVCA433 cells. The expression of PPT2 was verified at both mRNA and protein levels. ( C ) Decreased expression of PPT2 promoted the colony-forming ability of OVCAR8 cells. ( D ) Decreased expression of PPT2 significantly promoted the proliferation rate of OVCAR8 cells. ( E ) Transwell assay results showed that decreased expression of PPT2 could significantly promoted the invasion of OVCAR8 cells. ( F ) Decreased expression of PPT2 promoted the colony-forming ability of OVCA433 cells. ( G ) Decreased expression of PPT2 significantly promoted the proliferation rate of OVCA433 cells. ( H ) Transwell assay results showed that decreased expression of PPT2 could significantly promoted the invasion of OVCA433 cells. * p < 0.05, ** p < 0.01, and *** p < 0.001

    Journal: Journal of Ovarian Research

    Article Title: Investigating PPT2’s role in ovarian cancer prognosis and immunotherapy outcomes

    doi: 10.1186/s13048-024-01527-9

    Figure Lengend Snippet: PPT2 promoted proliferation and invasion of OC cells. ( A - B ) Decreased expression of PPT2 in OVCAR8 and OVCA433 cells. The expression of PPT2 was verified at both mRNA and protein levels. ( C ) Decreased expression of PPT2 promoted the colony-forming ability of OVCAR8 cells. ( D ) Decreased expression of PPT2 significantly promoted the proliferation rate of OVCAR8 cells. ( E ) Transwell assay results showed that decreased expression of PPT2 could significantly promoted the invasion of OVCAR8 cells. ( F ) Decreased expression of PPT2 promoted the colony-forming ability of OVCA433 cells. ( G ) Decreased expression of PPT2 significantly promoted the proliferation rate of OVCA433 cells. ( H ) Transwell assay results showed that decreased expression of PPT2 could significantly promoted the invasion of OVCA433 cells. * p < 0.05, ** p < 0.01, and *** p < 0.001

    Article Snippet: Custom primers for PPT2 (F: GGACTTCGGGTGCGCGTT, R: GAAGAGCCCATGCACCACGA) and β-actin (F: GTGGCCGAGGACTTTGATTG, R: CCTGTAACAACGCATCTCATATT) were acquired from Sangon Biotech Co. Ltd. (Shanghai, China).

    Techniques: Expressing, Transwell Assay

    Expression of depalmitoylases in skeletal muscle and myoblasts. ( A ) Heatmap reveals depalmitoylase gene expression regulation in mouse skeletal muscle 24 hours after pDNA delivery compared to control muscle, n = 4–5 per group. ( B ) Western blots showing the effect of pDNA electrotransfer on PPT2 protein levels in C2C12 myoblasts, n = 3. **** p < 0.0001, *** p < 0.001, ** p < 0.01, * p < 0.05 compared to the control. Control, naïve cells or tissues; EP, pulse application; pDNA, gWiz Luc; pDNA+EP, pDNA electrotransfer.

    Journal: Pharmaceutics

    Article Title: Pulsed Electric Fields Induce STING Palmitoylation and Polymerization Independently of Plasmid DNA Electrotransfer

    doi: 10.3390/pharmaceutics16030363

    Figure Lengend Snippet: Expression of depalmitoylases in skeletal muscle and myoblasts. ( A ) Heatmap reveals depalmitoylase gene expression regulation in mouse skeletal muscle 24 hours after pDNA delivery compared to control muscle, n = 4–5 per group. ( B ) Western blots showing the effect of pDNA electrotransfer on PPT2 protein levels in C2C12 myoblasts, n = 3. **** p < 0.0001, *** p < 0.001, ** p < 0.01, * p < 0.05 compared to the control. Control, naïve cells or tissues; EP, pulse application; pDNA, gWiz Luc; pDNA+EP, pDNA electrotransfer.

    Article Snippet: Polyclonal antibody information and dilution ratio are as follows: TMEM173/STING (19851-1-AP, Proteintech, Rosemont, IL, USA) at 1:500 dilution, zDHHC1 (PA5-113194, Thermo Fisher Scientific) at 1:1000 dilution, zDHHC7 (PA5-116795, Thermo Fisher Scientific) at 1:1000 dilution, zDHHC21 (PA5-25096, Thermo Fisher Scientific) at 1:1000 dilution and PPT2 (15429-1-AP, Proteintech, Rosemont, IL, USA) at 1:500 dilution.

    Techniques: Expressing, Gene Expression, Control, Western Blot, Electrotransfer

    Overview of Instruments Deployed on ACT‐America Flight Campaigns

    Journal: Earth and Space Science (Hoboken, N.j.)

    Article Title: Atmospheric Carbon and Transport – America (ACT‐America) Data Sets: Description, Management, and Delivery

    doi: 10.1029/2020EA001634

    Figure Lengend Snippet: Overview of Instruments Deployed on ACT‐America Flight Campaigns

    Article Snippet: In situ continuous meteorological sensors , MIS , Meteorological Instrument Suite (MIS) Models: Honeywell Precision Pressure Transducer (PPT2) pressure transducer, Rosemount de‐iced total air temperature probe, and Edgetech Vigilant 137 hygrometer with 3‐stage TEC chilled mirror , Total and static atmospheric temperature, dew‐point temperature, atmospheric pressure (Davis et al., ) , 1 Hz , , , C‐130; B‐200 , All.

    Techniques: Sampling, In Situ, Spectroscopy

    Overview of Instruments Deployed on ACT‐America Flight Campaigns

    Journal: Earth and Space Science (Hoboken, N.j.)

    Article Title: Atmospheric Carbon and Transport – America (ACT‐America) Data Sets: Description, Management, and Delivery

    doi: 10.1029/2020EA001634

    Figure Lengend Snippet: Overview of Instruments Deployed on ACT‐America Flight Campaigns

    Article Snippet: In situ continuous meteorological sensors , MIS , Meteorological Instrument Suite (MIS) Models: Honeywell Precision Pressure Transducer (PPT2) pressure transducer, Rosemount de‐iced total air temperature probe, and Edgetech Vigilant 137 hygrometer with 3‐stage TEC chilled mirror , Total and static atmospheric temperature, dew‐point temperature, atmospheric pressure (Davis et al., ) , 1 Hz , , , C‐130; B‐200 , All.

    Techniques: Sampling, In Situ, Spectroscopy, Aerosol

    PPT2 is downregulated in ccRCC and has significant correlations with patients' survival. (A) Heat map depicting PPT family mRNA expression of all cases from TCGA database; red signifies high expression, yellow signifies medium expression, blue signifies low expression. (B) Comparison of PPT family mRNA expression in paired and in non-paired groups. (C-D) The mRNA expression of PPT2 and PPT1 was divided into low expression group and high expression group respectively on the basis of the median, the survival rate of two corresponding groups was evaluated with Kaplan Meier method and tested by using log rank test.

    Journal: Journal of Cancer

    Article Title: Overexpression of PPT2 Represses the Clear Cell Renal Cell Carcinoma Progression by Reducing Epithelial-to-mesenchymal Transition

    doi: 10.7150/jca.36477

    Figure Lengend Snippet: PPT2 is downregulated in ccRCC and has significant correlations with patients' survival. (A) Heat map depicting PPT family mRNA expression of all cases from TCGA database; red signifies high expression, yellow signifies medium expression, blue signifies low expression. (B) Comparison of PPT family mRNA expression in paired and in non-paired groups. (C-D) The mRNA expression of PPT2 and PPT1 was divided into low expression group and high expression group respectively on the basis of the median, the survival rate of two corresponding groups was evaluated with Kaplan Meier method and tested by using log rank test.

    Article Snippet: Plasmids overexpressing PPT2 were constructed in Vigene Biosciences (Shangdong, China) and then purchased.

    Techniques: Expressing, Comparison

    Univariate and multivariate analyses for patient overall survival

    Journal: Journal of Cancer

    Article Title: Overexpression of PPT2 Represses the Clear Cell Renal Cell Carcinoma Progression by Reducing Epithelial-to-mesenchymal Transition

    doi: 10.7150/jca.36477

    Figure Lengend Snippet: Univariate and multivariate analyses for patient overall survival

    Article Snippet: Plasmids overexpressing PPT2 were constructed in Vigene Biosciences (Shangdong, China) and then purchased.

    Techniques: Expressing

    Clinicopathological parameters and their correlations with  PPT2  mRNA expression

    Journal: Journal of Cancer

    Article Title: Overexpression of PPT2 Represses the Clear Cell Renal Cell Carcinoma Progression by Reducing Epithelial-to-mesenchymal Transition

    doi: 10.7150/jca.36477

    Figure Lengend Snippet: Clinicopathological parameters and their correlations with PPT2 mRNA expression

    Article Snippet: Plasmids overexpressing PPT2 were constructed in Vigene Biosciences (Shangdong, China) and then purchased.

    Techniques: Expressing

    The PPT2 expression may be considered as a diagnostic biomarker for ccRCC patients. The ROC curve analyses of PPT2 mRNA expression in subgroups of ccRCC patients show PPT2 expression is of significance in distinguishing ccRCC from normal renal tissues (A), M0 from M1 (B), G1+G2 from G3+G4 (C), T1+T2 from T3+T4 (D), TNM I+II from TNM III+IV (E), the recurred/progressed from the disease-free (F).

    Journal: Journal of Cancer

    Article Title: Overexpression of PPT2 Represses the Clear Cell Renal Cell Carcinoma Progression by Reducing Epithelial-to-mesenchymal Transition

    doi: 10.7150/jca.36477

    Figure Lengend Snippet: The PPT2 expression may be considered as a diagnostic biomarker for ccRCC patients. The ROC curve analyses of PPT2 mRNA expression in subgroups of ccRCC patients show PPT2 expression is of significance in distinguishing ccRCC from normal renal tissues (A), M0 from M1 (B), G1+G2 from G3+G4 (C), T1+T2 from T3+T4 (D), TNM I+II from TNM III+IV (E), the recurred/progressed from the disease-free (F).

    Article Snippet: Plasmids overexpressing PPT2 were constructed in Vigene Biosciences (Shangdong, China) and then purchased.

    Techniques: Expressing, Diagnostic Assay, Biomarker Discovery

    PPT2 expression is downregulated both in clinical ccRCC samples and in renal cancer cell lines. 32 pairs of postoperative clinical samples were collected, Western Blot (A), qRT-PCR (B) and IHC (C) were conducted in clinical ccRCC samples and in matched adjacent normal tissues. (D-E) Western Blot and qRT-PCR were also conducted to investigate PPT2 expression in cell lines 293, 786-O, A-498, ACHN, CAKi-1 and OS-RC.

    Journal: Journal of Cancer

    Article Title: Overexpression of PPT2 Represses the Clear Cell Renal Cell Carcinoma Progression by Reducing Epithelial-to-mesenchymal Transition

    doi: 10.7150/jca.36477

    Figure Lengend Snippet: PPT2 expression is downregulated both in clinical ccRCC samples and in renal cancer cell lines. 32 pairs of postoperative clinical samples were collected, Western Blot (A), qRT-PCR (B) and IHC (C) were conducted in clinical ccRCC samples and in matched adjacent normal tissues. (D-E) Western Blot and qRT-PCR were also conducted to investigate PPT2 expression in cell lines 293, 786-O, A-498, ACHN, CAKi-1 and OS-RC.

    Article Snippet: Plasmids overexpressing PPT2 were constructed in Vigene Biosciences (Shangdong, China) and then purchased.

    Techniques: Expressing, Western Blot, Quantitative RT-PCR

    Overexpression of PPT2 inhibits cell proliferation, migration and invasion in vitro . (A-B) The efficiency of PPT2 overexpression in cell lines A-498 and CAKi-1 transfected with expression vectors of PPT2 was verified with Western Blot and qRT-PCR, relative gene expression was determined using the comparative delta-delta CT method. (C) CCK-8 assays revealed cell growth curves of A498 and CAKi-1 cells. (D-E) Migration and invasion assays for ccRCC cell lines A498 and CAKi-1, representative photographs were taken at ×200 magnification; number of cells was counted in ten random images from each group. (F-G) Representative micrographs of wound healing assays of cell lines A-498 and CAKi-1, wound closures were photographed at 0, 12 and 24 hours after wounding, representative photographs were taken at ×100 magnification.

    Journal: Journal of Cancer

    Article Title: Overexpression of PPT2 Represses the Clear Cell Renal Cell Carcinoma Progression by Reducing Epithelial-to-mesenchymal Transition

    doi: 10.7150/jca.36477

    Figure Lengend Snippet: Overexpression of PPT2 inhibits cell proliferation, migration and invasion in vitro . (A-B) The efficiency of PPT2 overexpression in cell lines A-498 and CAKi-1 transfected with expression vectors of PPT2 was verified with Western Blot and qRT-PCR, relative gene expression was determined using the comparative delta-delta CT method. (C) CCK-8 assays revealed cell growth curves of A498 and CAKi-1 cells. (D-E) Migration and invasion assays for ccRCC cell lines A498 and CAKi-1, representative photographs were taken at ×200 magnification; number of cells was counted in ten random images from each group. (F-G) Representative micrographs of wound healing assays of cell lines A-498 and CAKi-1, wound closures were photographed at 0, 12 and 24 hours after wounding, representative photographs were taken at ×100 magnification.

    Article Snippet: Plasmids overexpressing PPT2 were constructed in Vigene Biosciences (Shangdong, China) and then purchased.

    Techniques: Over Expression, Migration, In Vitro, Transfection, Expressing, Western Blot, Quantitative RT-PCR, Gene Expression, CCK-8 Assay

    Decreased expression of PPT2 facilitates EMT in ccRCC in vitro . (A-C) GSEA was performed to investigate the biological pathways involved in PPT2 regulation on the basis of TCGA database. (D-E) The alterations of EMT markers (E-cadherin, Vimentin, Snail1 and N-cadherin) were tested with Western Blot and qRT-PCR.

    Journal: Journal of Cancer

    Article Title: Overexpression of PPT2 Represses the Clear Cell Renal Cell Carcinoma Progression by Reducing Epithelial-to-mesenchymal Transition

    doi: 10.7150/jca.36477

    Figure Lengend Snippet: Decreased expression of PPT2 facilitates EMT in ccRCC in vitro . (A-C) GSEA was performed to investigate the biological pathways involved in PPT2 regulation on the basis of TCGA database. (D-E) The alterations of EMT markers (E-cadherin, Vimentin, Snail1 and N-cadherin) were tested with Western Blot and qRT-PCR.

    Article Snippet: Plasmids overexpressing PPT2 were constructed in Vigene Biosciences (Shangdong, China) and then purchased.

    Techniques: Expressing, In Vitro, Western Blot, Quantitative RT-PCR