polyethylenimine (MedChemExpress)
MedChemExpress is a verified supplier 
MedChemExpress manufactures this product 
97
Structured Review
MedChemExpress
polyethylenimine
Polyethylenimine, supplied by MedChemExpress, used in various techniques. Bioz Stars score: 97/100, based on 94 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/polyethylenimine/PEI+Transfection+Reagent/pm42606683-54-4-9
Average 97 stars, based on 94 article reviews
Polyethylenimine, supplied by MedChemExpress, used in various techniques. Bioz Stars score: 97/100, based on 94 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/polyethylenimine/PEI+Transfection+Reagent/pm42606683-54-4-9
Average 97 stars, based on 94 article reviews
polyethylenimine - by Bioz Stars,
2026-09
97/100 stars
Images
Related Articles
Construct:Article Title: Liver cancer derived high core fucosylation sEV elict malignancy by activating PI3K/AKT signaling pathway. Article Snippet: The primer sequences used were as follows: FUT8: sense: 5′‐CCGCTCGAGCGGGCCACCATGCGGCCATGGACTG‐3′ antisense: 5′‐GACATCTACTTCTCCCGAGACTAGGCGCCTAGGCGC‐3′ shRNA targeting FUT8 or LGALS3BP were subcloned into lentivirus vector PLVX-shRNA2-Puro (Takara). .. Sequences were listed below: sh-FUT8-1: sense: 5 ′ ‐ CCGGGTGTCTCAGTTTGTCAAATTTCTCGAGAAATTTGACAAACTGAGACACTTTTG ‐3′ antisense: 5 ′ ‐ CACAGAGTCAAACAGTTTAAAGAGCTCTTTAAACTGTTTGACTCTGTGAAAACTTAA AR TIC LE IN PR ES S ‐3′ sh-FUT8-2: sense: 5 ′ ‐ CCGGGGTGTGTAATATCAACAAATTCTCGAGAATTTGTTGATATTACACACCTTTTG ‐3′ antisense: 5 ′ ‐ CCACACATTATAGTTGTTTAAGAGCTCTTAAACAACTATAATGTGTGGAAAACTTAA ‐ 3′ sh-LGALS3BP-1: sense: 5 ′ ‐ CCGGCGGAAGTCACAACTGGTCTATCTCGAGATAGACCAGTTGTGACTTCCGTTTT TG‐3′ antisense: 5 ′ ‐ AATTCAAAAACGGAAGTCACAACTGGTCTATCTCGAGATAGACCAGTTGTGACTTC CG‐3′ sh-LGALS3BP-2: sense: 5 ′ ‐ CCGGGTACTTCTACTCCCGAAGGATCTCGAGATCCTTCGGGAGTAGAAGTACTTTT TG‐3′ antisense: 5 ′ ‐ AATTCAAAAAGTACTTCTACTCCCGAAGGATCTCGAGATCCTTCGGGAGTAGAAGT AC‐3′ For lentivirus production, HEK293T cells were seeded to reach 50%-60% AR TIC LE IN PR ES S confluency and co‐transfected with the respective constructed plasmids along with the packaging plasmid psPAX2 (Addgene, Cambridge, MA, USA) and the envelope plasmid pMD2.G (Addgene), using Plasmid Preparation:Article Title: Liver cancer derived high core fucosylation sEV elict malignancy by activating PI3K/AKT signaling pathway. Article Snippet: The primer sequences used were as follows: FUT8: sense: 5′‐CCGCTCGAGCGGGCCACCATGCGGCCATGGACTG‐3′ antisense: 5′‐GACATCTACTTCTCCCGAGACTAGGCGCCTAGGCGC‐3′ shRNA targeting FUT8 or LGALS3BP were subcloned into lentivirus vector PLVX-shRNA2-Puro (Takara). .. Sequences were listed below: sh-FUT8-1: sense: 5 ′ ‐ CCGGGTGTCTCAGTTTGTCAAATTTCTCGAGAAATTTGACAAACTGAGACACTTTTG ‐3′ antisense: 5 ′ ‐ CACAGAGTCAAACAGTTTAAAGAGCTCTTTAAACTGTTTGACTCTGTGAAAACTTAA AR TIC LE IN PR ES S ‐3′ sh-FUT8-2: sense: 5 ′ ‐ CCGGGGTGTGTAATATCAACAAATTCTCGAGAATTTGTTGATATTACACACCTTTTG ‐3′ antisense: 5 ′ ‐ CCACACATTATAGTTGTTTAAGAGCTCTTAAACAACTATAATGTGTGGAAAACTTAA ‐ 3′ sh-LGALS3BP-1: sense: 5 ′ ‐ CCGGCGGAAGTCACAACTGGTCTATCTCGAGATAGACCAGTTGTGACTTCCGTTTT TG‐3′ antisense: 5 ′ ‐ AATTCAAAAACGGAAGTCACAACTGGTCTATCTCGAGATAGACCAGTTGTGACTTC CG‐3′ sh-LGALS3BP-2: sense: 5 ′ ‐ CCGGGTACTTCTACTCCCGAAGGATCTCGAGATCCTTCGGGAGTAGAAGTACTTTT TG‐3′ antisense: 5 ′ ‐ AATTCAAAAAGTACTTCTACTCCCGAAGGATCTCGAGATCCTTCGGGAGTAGAAGT AC‐3′ For lentivirus production, HEK293T cells were seeded to reach 50%-60% AR TIC LE IN PR ES S confluency and co‐transfected with the respective constructed plasmids along with the packaging plasmid psPAX2 (Addgene, Cambridge, MA, USA) and the envelope plasmid pMD2.G (Addgene), using Article Title: Astrocytic AEBP1-NPAS3-LIPA pathway coordinates cholesterol homeostasis to regulate Alzheimer’s pathology Article Snippet: .. Lentiviral particles were produced in HEK293T cells by co-transfecting the pHAGE expression plasmid with the packaging plasmid psPAX2 and the envelope plasmid pMD2.G at a mass ratio of 1:1.5:1 (total DNA 24 μg), using Transfection:Article Title: Liver cancer derived high core fucosylation sEV elict malignancy by activating PI3K/AKT signaling pathway. Article Snippet: The primer sequences used were as follows: FUT8: sense: 5′‐CCGCTCGAGCGGGCCACCATGCGGCCATGGACTG‐3′ antisense: 5′‐GACATCTACTTCTCCCGAGACTAGGCGCCTAGGCGC‐3′ shRNA targeting FUT8 or LGALS3BP were subcloned into lentivirus vector PLVX-shRNA2-Puro (Takara). .. Sequences were listed below: sh-FUT8-1: sense: 5 ′ ‐ CCGGGTGTCTCAGTTTGTCAAATTTCTCGAGAAATTTGACAAACTGAGACACTTTTG ‐3′ antisense: 5 ′ ‐ CACAGAGTCAAACAGTTTAAAGAGCTCTTTAAACTGTTTGACTCTGTGAAAACTTAA AR TIC LE IN PR ES S ‐3′ sh-FUT8-2: sense: 5 ′ ‐ CCGGGGTGTGTAATATCAACAAATTCTCGAGAATTTGTTGATATTACACACCTTTTG ‐3′ antisense: 5 ′ ‐ CCACACATTATAGTTGTTTAAGAGCTCTTAAACAACTATAATGTGTGGAAAACTTAA ‐ 3′ sh-LGALS3BP-1: sense: 5 ′ ‐ CCGGCGGAAGTCACAACTGGTCTATCTCGAGATAGACCAGTTGTGACTTCCGTTTT TG‐3′ antisense: 5 ′ ‐ AATTCAAAAACGGAAGTCACAACTGGTCTATCTCGAGATAGACCAGTTGTGACTTC CG‐3′ sh-LGALS3BP-2: sense: 5 ′ ‐ CCGGGTACTTCTACTCCCGAAGGATCTCGAGATCCTTCGGGAGTAGAAGTACTTTT TG‐3′ antisense: 5 ′ ‐ AATTCAAAAAGTACTTCTACTCCCGAAGGATCTCGAGATCCTTCGGGAGTAGAAGT AC‐3′ For lentivirus production, HEK293T cells were seeded to reach 50%-60% AR TIC LE IN PR ES S confluency and co‐transfected with the respective constructed plasmids along with the packaging plasmid psPAX2 (Addgene, Cambridge, MA, USA) and the envelope plasmid pMD2.G (Addgene), using Article Title: Astrocytic AEBP1-NPAS3-LIPA pathway coordinates cholesterol homeostasis to regulate Alzheimer’s pathology Article Snippet: .. Lentiviral particles were produced in HEK293T cells by co-transfecting the pHAGE expression plasmid with the packaging plasmid psPAX2 and the envelope plasmid pMD2.G at a mass ratio of 1:1.5:1 (total DNA 24 μg), using Article Title: JUN–ENPP1–cGAS–STING axis mediates immune evasion and tumor progression in bladder cancer Article Snippet: Cells were cultured in RPMI 1640 or DMEM (Gibco) supplemented with 10% fetal bovine serum and 1% penicillin–streptomycin. .. The cells were incubated at 37 °C with 5% CO2, and the incubation time depended on the specific cell line and experimental requirements. shRNA–mediated knockdown and overexpression plasmids(Miaoling Bio, Wuhan, China) were transfected using Article Title: XYLB promotes malignant behaviors of triple-negative breast cancer via SUSD3 upregulation. Article Snippet: 1 Department of Pathology, School of Basic Medical Sciences, Southern Medical University, Guangzhou 510515, Guangdong, China Abstract Triple-negative breast cancer (TNBC) remains a clinically challenging breast cancer subtype because of its molecular heterogeneity, early recurrence, metastatic propensity, and limited targetable drivers.. Metabolic remodeling is increasingly recognized as a determinant of TNBC progression, but the contribution of pentose phosphate pathway-related enzymes to TNBC remains incompletely defined.. Here, we investigated the biological role of xylulokinase (XYLB), an enzyme that converts D-xylulose to xylulose-5-phosphate (Xu5P), and its downstream mechanisms in TNBC. Article Title: K542 acetylation promotes YTHDF2 binding to m6A-modified mRNAs and fosters colorectal cancer progression. Article Snippet: N6-methyladenosine (m6A) modification serves as a crucial regulator of diverse biological processes and disease progression.. A central player in m6A regulation is YT521-B homology domain family member 2 (YTHDF2), a well-characterized m6A-binding protein primarily involved in mRNA stabilization.. This study identifies lysine 542 (K542) as a critical acetylation site on YTHDF2, regulated by p300 as the acetyltransferase and SIRT2 as the deacetylase. Article Title: JUN-ENPP1-cGAS-STING axis mediates immune evasion and tumor progression in bladder cancer. Article Snippet: Cells were cultured in RPMI 1640 or DMEM (Gibco) supplemented with 10% fetal bovine serum and 1% penicillin–streptomycin. .. The cells were incubated at 37 °C with 5% CO2, and the incubation time depended on the specific cell line and experimental requirements. shRNA–mediated knockdown and overexpression plasmids(Miaoling Bio, Wuhan, China) were transfected using Produced:Article Title: Astrocytic AEBP1-NPAS3-LIPA pathway coordinates cholesterol homeostasis to regulate Alzheimer’s pathology Article Snippet: .. Lentiviral particles were produced in HEK293T cells by co-transfecting the pHAGE expression plasmid with the packaging plasmid psPAX2 and the envelope plasmid pMD2.G at a mass ratio of 1:1.5:1 (total DNA 24 μg), using Expressing:Article Title: Astrocytic AEBP1-NPAS3-LIPA pathway coordinates cholesterol homeostasis to regulate Alzheimer’s pathology Article Snippet: .. Lentiviral particles were produced in HEK293T cells by co-transfecting the pHAGE expression plasmid with the packaging plasmid psPAX2 and the envelope plasmid pMD2.G at a mass ratio of 1:1.5:1 (total DNA 24 μg), using Incubation:Article Title: JUN–ENPP1–cGAS–STING axis mediates immune evasion and tumor progression in bladder cancer Article Snippet: Cells were cultured in RPMI 1640 or DMEM (Gibco) supplemented with 10% fetal bovine serum and 1% penicillin–streptomycin. .. The cells were incubated at 37 °C with 5% CO2, and the incubation time depended on the specific cell line and experimental requirements. shRNA–mediated knockdown and overexpression plasmids(Miaoling Bio, Wuhan, China) were transfected using Article Title: JUN-ENPP1-cGAS-STING axis mediates immune evasion and tumor progression in bladder cancer. Article Snippet: Cells were cultured in RPMI 1640 or DMEM (Gibco) supplemented with 10% fetal bovine serum and 1% penicillin–streptomycin. .. The cells were incubated at 37 °C with 5% CO2, and the incubation time depended on the specific cell line and experimental requirements. shRNA–mediated knockdown and overexpression plasmids(Miaoling Bio, Wuhan, China) were transfected using shRNA:Article Title: JUN–ENPP1–cGAS–STING axis mediates immune evasion and tumor progression in bladder cancer Article Snippet: Cells were cultured in RPMI 1640 or DMEM (Gibco) supplemented with 10% fetal bovine serum and 1% penicillin–streptomycin. .. The cells were incubated at 37 °C with 5% CO2, and the incubation time depended on the specific cell line and experimental requirements. shRNA–mediated knockdown and overexpression plasmids(Miaoling Bio, Wuhan, China) were transfected using Article Title: JUN-ENPP1-cGAS-STING axis mediates immune evasion and tumor progression in bladder cancer. Article Snippet: Cells were cultured in RPMI 1640 or DMEM (Gibco) supplemented with 10% fetal bovine serum and 1% penicillin–streptomycin. .. The cells were incubated at 37 °C with 5% CO2, and the incubation time depended on the specific cell line and experimental requirements. shRNA–mediated knockdown and overexpression plasmids(Miaoling Bio, Wuhan, China) were transfected using Knockdown:Article Title: JUN–ENPP1–cGAS–STING axis mediates immune evasion and tumor progression in bladder cancer Article Snippet: Cells were cultured in RPMI 1640 or DMEM (Gibco) supplemented with 10% fetal bovine serum and 1% penicillin–streptomycin. .. The cells were incubated at 37 °C with 5% CO2, and the incubation time depended on the specific cell line and experimental requirements. shRNA–mediated knockdown and overexpression plasmids(Miaoling Bio, Wuhan, China) were transfected using Article Title: JUN-ENPP1-cGAS-STING axis mediates immune evasion and tumor progression in bladder cancer. Article Snippet: Cells were cultured in RPMI 1640 or DMEM (Gibco) supplemented with 10% fetal bovine serum and 1% penicillin–streptomycin. .. The cells were incubated at 37 °C with 5% CO2, and the incubation time depended on the specific cell line and experimental requirements. shRNA–mediated knockdown and overexpression plasmids(Miaoling Bio, Wuhan, China) were transfected using Over Expression:Article Title: JUN–ENPP1–cGAS–STING axis mediates immune evasion and tumor progression in bladder cancer Article Snippet: Cells were cultured in RPMI 1640 or DMEM (Gibco) supplemented with 10% fetal bovine serum and 1% penicillin–streptomycin. .. The cells were incubated at 37 °C with 5% CO2, and the incubation time depended on the specific cell line and experimental requirements. shRNA–mediated knockdown and overexpression plasmids(Miaoling Bio, Wuhan, China) were transfected using Article Title: JUN-ENPP1-cGAS-STING axis mediates immune evasion and tumor progression in bladder cancer. Article Snippet: Cells were cultured in RPMI 1640 or DMEM (Gibco) supplemented with 10% fetal bovine serum and 1% penicillin–streptomycin. .. The cells were incubated at 37 °C with 5% CO2, and the incubation time depended on the specific cell line and experimental requirements. shRNA–mediated knockdown and overexpression plasmids(Miaoling Bio, Wuhan, China) were transfected using |