mcol1a2 sv40 polya (Genechem)

About

News

Press Release

Team

Advisors

Partners

Contact

Bioz Stars

Bioz vStars

Buy from Supplier

Structured Review

Genechem mcol1a2 sv40 polya
Mcol1a2 Sv40 Polya, supplied by Genechem, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/polya/1a+a+a+a+a+chemicals+genechem+genechem+genechem+genechem+gfp+lenti+lenti+lenti+mcherry+mitodsred2+n+n+n+n+pgc+shrna+strains+virus/pmc13265906-27-0-3
Average 86 stars, based on 1 article reviews

mcol1a2 sv40 polya - by Bioz Stars, 2026-11

86/100 stars

Images

Ubiquitin Proteomics:

Article Title: LRP1 activated by AT2 cell-secreted MDK inhibits fibrotic ferroptosis in idiopathic pulmonary fibrosis
Article Snippet: .. Antibodies CTHRC1 Novus Cat#81744; RRID: AB_3414573 PDPN DSHB Cat# 8.1.1; RRID: AB_531893 SFTPC Merck Cat#ABC99; RRID: AB_2755001 ACSL4 CST Cat#9189 SLC7A11 CST Cat#12691; RRID: AB_2687474 GPX4 abcam Cat#ab125066; RRID: AB_10973901 FTH1 CST Cat#4393; RRID: AB_11217441 Beta-actin CST Cat#3700 LRP1 Invitrogen Cat#MA1-80192; RRID: AB_929727 MDK Invitrogen Cat#MA5-32538; RRID: AB_2809815 OTUB1 OriGene Cat#TA505150; RRID: AB_2622874 AKT Proteintech Cat#10176-2-AP; RRID: AB_2224574 p-AKT Proteintech Cat#66444-1-Ig; RRID: AB_2782958 p38 Proteintech Cat#14064-1-AP; RRID: AB_2878007 p-p38 Proteintech Cat#81212-2-RR; RRID: AB_3743373 Ubiquitin Invitrogen Cat#14-6078-82; RRID: AB_837154 Myc-Tag CST Cat#2276 FLAG Tag Sigma-Aldrich Cat#F3165; RRID: AB_259529 GST-Tag CST Cat#2624; RRID: AB_2189875 His-Tag CST Cat#2366; RRID: AB_2115719 HA-Tag CST Cat3724; RRID: AB_1549585 Bacterial and virus strains pAAV-SP-Cp-SV40 PolyA Genechem GCNV0402707 mCOL1A2-SV40 PolyA Genechem GCNV0402708 Chemicals, peptides, and recombinant proteins Bleomycin MedChemExpress HY-17565A PBS Gibico 20012027 4% paraformaldehyde Beyotime P0099 citrate buffer (pH 6.0) Thermo Fisher Scientific 005000 HRP-labelled goat anti-mouse/rabbit IgG abcam ab6721 DMEM Thermo Fisher Scientific 11965 FBS Thermo Fisher Scientific 10099141c Antibiotic-antimycotic Thermo Fisher Scientific 15240062 BODIPYTM 581/591 C11 fluorescence probe Thermo Fisher Scientific D3861 RIPA Lysis Buffer Beyotime P0013B Immunoprecipitation (IP) lysis buffer Thermo Fisher Scientific 87787 protein A/G-beads Thermo Fisher Scientific 88802 Critical commercial assays Hydroxyproline Assay Kit (Colorimetric) abcam ab222941 Human MDK ELISA Kit abcam ab193761 Mouse MDK ELISA Kit abcam ab279416 Masson’s trichrome staining Kit Solarbio G1340 (Continued on next page) iScience 29, 116212, June 19, 2026 e1 ..

FLAG-tag:

Virus:

Article Title: Hepatocyte BDNF Acts as a Novel Immune Checkpoint to Restrain TLR4‐Mediated Acute Hepatitis
Article Snippet: .. .5 Adeno-Associated Virus Construction and nfection he coding sequence of mouse mature BDNF fused to an Nerminal albumin signal peptide and a C-terminal 6 ×His tag SP-matureBDNF-6His) was obtained from Genechem (Shangai, China) and cloned into the AAV plasmid KV289 containing hepatocyte-specific TBG promoter (TBG-MCS-FT2A-EGFPPRE-BGH polyA) using AgeI restriction digestion followed by n-Fusion recombination. ..

Recombinant:

Fluorescence:

Lysis:

Immunoprecipitation:

Hydroxyproline Assay:

Enzyme-linked Immunosorbent Assay:

Staining:

other:

Article Title: Fibroblast growth factor-inducible 14 accelerates pulmonary fibrosis by inducing fibroblast senescence in mice.
Article Snippet: Mice and induction of PF Adult male C57BL/6J mice (8-10 weeks of age, 20-25 g) were purchased from Hunan SJA Laboratory Animal Co., Ltd (Hunan, China).

Sequencing:

Article Title: TCF21 promotes epithelial-to-mesenchymal transition and cytoskeleton reorganization in uterine development and endometriosis.
Article Snippet: .. The sequence Tcf21 was inserted downstream of EGFP with XhoI/XhoI to construct Pgr-promoter-EGFP-Tcf21-hGH polyA (GeneChem). ..

Clone Assay:

Bioprocessing:

Plasmid Preparation:

Produced:

Article Title: Fibroblast growth factor-inducible 14 accelerates pulmonary fibrosis by inducing fibroblast senescence in mice
Article Snippet: .. Packed empty adenovirus vectors (GV681, TBGp-EGFP-MIR155 [MCS]-SV40 PolyA) and adenovirus-mediated sh-Fn14 vectors (GATTCGGCTTGGTGTTGATGC) were designed and produced by GeneChem (Shanghai, China). ..

Review