Review



peif1a  (TaKaRa)


Bioz Verified Symbol TaKaRa is a verified supplier
Bioz Manufacturer Symbol TaKaRa manufactures this product  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 94

    Structured Review

    TaKaRa peif1a
    Peif1a, supplied by TaKaRa, used in various techniques. Bioz Stars score: 94/100, based on 385 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/peif1a/pGFP+Vector/pm36459969-218-27-25
    Average 94 stars, based on 385 article reviews
    peif1a - by Bioz Stars, 2026-09
    94/100 stars

    Images

    Related Articles

    Plasmid Preparation:

    Article Title: A reference human induced pluripotent stem cell line for large-scale collaborative studies.
    Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER KOLF2.1J The Jackson Laboratory hPSCreg: WTSli018-B-12 KUCG3 Wellcome Trust Institute custom NCRM1 NINDS Human Cell and Data Repository RRID: CVCL_1E71 NCRM5 NINDS Human Cell and Data Repository RRID: CVCL_1E75 PGP1 Synthego RRID: CVCL_F182 LNGPI1 NIH custom NN0003932 NINDS Human Cell and Data Repository RRID: CVCL_SA24 NN0004297 NINDS Human Cell and Data Repository RRID: CVCL_SA24 APOE3 ALSTEM iPS26 11a Harvard University RRID: CVCL_8987 ND50003 NINDS Human Cell and Data Repository RRID: CVCL_EZ99 ND50004 NINDS Human Cell and Data Repository RRID: CVCL_FA00 0524-1 Stanford University School of Medicine RRID: CVCL_B5FW Bioni010-C-13 European Bank for Induced Pluripotent Stem Cells RRID: CVCL_RF90 A18944 Thermo Fisher A18944 RBi001 Sigma Aldrich RRID: CVCL_9S35 Ctrl1 Wray lab Sposito et al. (2015) H9 WiCell RRID: CVCL_1240 CVB Coriell Institute RRID: CVCL_1N86 WTC11 Coriell Institute RRID: CVCL_Y803 SFC065 European Bank for Induced Pluripotent Stem Cells RRID: CVCL_RC67 Oligonucleotides sgRNA to ARID2 (AAAAGATCACTTGCTA ATGCCGG) Synthego Synthetic sgRNA Kit, modified wild-type ARID2 sequence (ACGTATGCAC TCTCCTATCAAATGAAAGCAAGCACGTCA TGCAACTTGAAAAAGATCCTAAAATCATC ACTTTACTACTTGCTAATGCCGGGGTGTT TGACGACAGTAAGTTTTAAGCTG IDT Alt-R HDR Donor Oligo Forward PCR primer for ARID2 (TTGGCAAT GATGGCCAAATGGTATG) IDT custom Reverse PCR primer for ARID2 (AAAACCCA CAACTAGCAAA) IDT custom Forward Sanger sequencing primer for ARID2 (GTCAAAGTTATGGGCTGTCC) IDT custom Reverse Sanger primer for ARID2 (GTTGACA AACAAAAAGTACTTTCTCC) IDT custom Cas9 sgRNA to TIMP3 (CCAGGAGCGCTTA CCGATGT/CGG) Synthego Synthetic sgRNA Kit, modified Plasmids PB-TO-hNGN2 Addgene 172,115 PB-TO-hNIL Addgene 172,113 pEIF1a::Transposase Addgene 172,116 (Continued on next page) e4 Cell Stem Cell 29, 1685–1702.e1–e22, December 1, 2022 .. REAGENT or RESOURCE SOURCE IDENTIFIER PG13-mCherry Addgene 16,442 pCMV-hyPBase Wellcome Trust Sanger Institute custom PB-PG13-mCherry-EF1a-PuroR-EGFP custom custom 4xmito-mEmerald Addgene 54,160 pLenti-PGK-LifeAct-GFP-W Addgene 51,010 pEGFP vector Clontech 632,370 pEIF1a::Cox8(1-26)::eGFP Twist Technologies custom pTetO-Ngn2-Puro Addgene 52,047 FUDGW-rtTa Addgene 19,780 MK-EF1a-mScarlet custom Tian et al. 2019 pUCM-CLYBL-hNIL Addgene 105,841 pZT-C13-R1 Addgene 62,197 pZT-C13-L1 Addgene 62,196 Software and algorithms Code for scRNA-seq and array-based genotyping analyses GitHub https://doi.org/10.5281/zenodo.7086734 HaplotypeCaller, PairedSingleSampleWf, and JointGenotypingWf workflows Github https://github.com/gatk-workflows/broad- prod-wgs-germline-snps-indels ANNOVAR Wang et al. 2010 PLINK (v1.9) Kunkle et al. 2019 Manta algorithm (Version 1.6.0) Github https://github.com/Illumina/manta Structural variant tool kit Github https://github.com/broadinstitute/gatk-sv 10x Genomics LongRanger 10X Genomics https://support.10xgenomics.com/genome- exome/software/pipelines/latest/using/wgs SeqManPro DNAStar https://www.dnastar.com/software/ lasergene/molecular-biology/ Synthego ICE Synthego https://ice.synthego.com/ GenomeStudio Software Illumina https://www.illumina.com/techniques/ microarrays/array-data-analysis-experimentaldesign/genomestudio.html GWASTools package Gogarten et al. 2012 samtools (v1.14) Danecek et al. 2021 IGV 2.11.9 Robinson et al. 2017 DropletUtils R package Lun et al. 2019 logNormCounts function Lun, McCarthy, and Marioni 2016 CellCycleScoring function from Seurat R package Hao et al. 2021 scds R package Bais and Kostka 2020 Batchelor R package Haghverdi et al. 2018 Uniform Mani-fold Approximation and Projection (UMAP) two-dimensional embedding McInnes et al. 2018 Louvain method (cluster_louvain function) Csárdi and Nepusz 2006 10x Genomics VarTrix and Vireo tools Huang, McCarthy, and Stegle 2019 .. REAGENT or RESOURCE SOURCE IDENTIFIER PG13-mCherry Addgene 16,442 pCMV-hyPBase Wellcome Trust Sanger Institute custom PB-PG13-mCherry-EF1a-PuroR-EGFP custom custom 4xmito-mEmerald Addgene 54,160 pLenti-PGK-LifeAct-GFP-W Addgene 51,010 pEGFP vector Clontech 632,370 pEIF1a::Cox8(1-26)::eGFP Twist Technologies custom pTetO-Ngn2-Puro Addgene 52,047 FUDGW-rtTa Addgene 19,780 MK-EF1a-mScarlet custom Tian et al. 2019 pUCM-CLYBL-hNIL Addgene 105,841 pZT-C13-R1 Addgene 62,197 pZT-C13-L1 Addgene 62,196 Software and algorithms Code for scRNA-seq and array-based genotyping analyses GitHub https://doi.org/10.5281/zenodo.7086734 HaplotypeCaller, PairedSingleSampleWf, and JointGenotypingWf workflows Github https://github.com/gatk-workflows/broad- prod-wgs-germline-snps-indels ANNOVAR Wang et al. 2010 PLINK (v1.9) Kunkle et al. 2019 Manta algorithm (Version 1.6.0) Github https://github.com/Illumina/manta Structural variant tool kit Github https://github.com/broadinstitute/gatk-sv 10x Genomics LongRanger 10X Genomics https://support.10xgenomics.com/genome- exome/software/pipelines/latest/using/wgs SeqManPro DNAStar https://www.dnastar.com/software/ lasergene/molecular-biology/ Synthego ICE Synthego https://ice.synthego.com/ GenomeStudio Software Illumina https://www.illumina.com/techniques/ microarrays/array-data-analysis-experimentaldesign/genomestudio.html GWASTools package Gogarten et al. 2012 samtools (v1.14) Danecek et al. 2021 IGV 2.11.9 Robinson et al. 2017 DropletUtils R package Lun et al. 2019 logNormCounts function Lun, McCarthy, and Marioni 2016 CellCycleScoring function from Seurat R package Hao et al. 2021 scds R package Bais and Kostka 2020 Batchelor R package Haghverdi et al. 2018 Uniform Mani-fold Approximation and Projection (UMAP) two-dimensional embedding McInnes et al. 2018 Louvain method (cluster_louvain function) Csárdi and Nepusz 2006 10x Genomics VarTrix and Vireo tools Huang, McCarthy, and Stegle 2019

    Software:

    Article Title: A reference human induced pluripotent stem cell line for large-scale collaborative studies.
    Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER KOLF2.1J The Jackson Laboratory hPSCreg: WTSli018-B-12 KUCG3 Wellcome Trust Institute custom NCRM1 NINDS Human Cell and Data Repository RRID: CVCL_1E71 NCRM5 NINDS Human Cell and Data Repository RRID: CVCL_1E75 PGP1 Synthego RRID: CVCL_F182 LNGPI1 NIH custom NN0003932 NINDS Human Cell and Data Repository RRID: CVCL_SA24 NN0004297 NINDS Human Cell and Data Repository RRID: CVCL_SA24 APOE3 ALSTEM iPS26 11a Harvard University RRID: CVCL_8987 ND50003 NINDS Human Cell and Data Repository RRID: CVCL_EZ99 ND50004 NINDS Human Cell and Data Repository RRID: CVCL_FA00 0524-1 Stanford University School of Medicine RRID: CVCL_B5FW Bioni010-C-13 European Bank for Induced Pluripotent Stem Cells RRID: CVCL_RF90 A18944 Thermo Fisher A18944 RBi001 Sigma Aldrich RRID: CVCL_9S35 Ctrl1 Wray lab Sposito et al. (2015) H9 WiCell RRID: CVCL_1240 CVB Coriell Institute RRID: CVCL_1N86 WTC11 Coriell Institute RRID: CVCL_Y803 SFC065 European Bank for Induced Pluripotent Stem Cells RRID: CVCL_RC67 Oligonucleotides sgRNA to ARID2 (AAAAGATCACTTGCTA ATGCCGG) Synthego Synthetic sgRNA Kit, modified wild-type ARID2 sequence (ACGTATGCAC TCTCCTATCAAATGAAAGCAAGCACGTCA TGCAACTTGAAAAAGATCCTAAAATCATC ACTTTACTACTTGCTAATGCCGGGGTGTT TGACGACAGTAAGTTTTAAGCTG IDT Alt-R HDR Donor Oligo Forward PCR primer for ARID2 (TTGGCAAT GATGGCCAAATGGTATG) IDT custom Reverse PCR primer for ARID2 (AAAACCCA CAACTAGCAAA) IDT custom Forward Sanger sequencing primer for ARID2 (GTCAAAGTTATGGGCTGTCC) IDT custom Reverse Sanger primer for ARID2 (GTTGACA AACAAAAAGTACTTTCTCC) IDT custom Cas9 sgRNA to TIMP3 (CCAGGAGCGCTTA CCGATGT/CGG) Synthego Synthetic sgRNA Kit, modified Plasmids PB-TO-hNGN2 Addgene 172,115 PB-TO-hNIL Addgene 172,113 pEIF1a::Transposase Addgene 172,116 (Continued on next page) e4 Cell Stem Cell 29, 1685–1702.e1–e22, December 1, 2022 .. REAGENT or RESOURCE SOURCE IDENTIFIER PG13-mCherry Addgene 16,442 pCMV-hyPBase Wellcome Trust Sanger Institute custom PB-PG13-mCherry-EF1a-PuroR-EGFP custom custom 4xmito-mEmerald Addgene 54,160 pLenti-PGK-LifeAct-GFP-W Addgene 51,010 pEGFP vector Clontech 632,370 pEIF1a::Cox8(1-26)::eGFP Twist Technologies custom pTetO-Ngn2-Puro Addgene 52,047 FUDGW-rtTa Addgene 19,780 MK-EF1a-mScarlet custom Tian et al. 2019 pUCM-CLYBL-hNIL Addgene 105,841 pZT-C13-R1 Addgene 62,197 pZT-C13-L1 Addgene 62,196 Software and algorithms Code for scRNA-seq and array-based genotyping analyses GitHub https://doi.org/10.5281/zenodo.7086734 HaplotypeCaller, PairedSingleSampleWf, and JointGenotypingWf workflows Github https://github.com/gatk-workflows/broad- prod-wgs-germline-snps-indels ANNOVAR Wang et al. 2010 PLINK (v1.9) Kunkle et al. 2019 Manta algorithm (Version 1.6.0) Github https://github.com/Illumina/manta Structural variant tool kit Github https://github.com/broadinstitute/gatk-sv 10x Genomics LongRanger 10X Genomics https://support.10xgenomics.com/genome- exome/software/pipelines/latest/using/wgs SeqManPro DNAStar https://www.dnastar.com/software/ lasergene/molecular-biology/ Synthego ICE Synthego https://ice.synthego.com/ GenomeStudio Software Illumina https://www.illumina.com/techniques/ microarrays/array-data-analysis-experimentaldesign/genomestudio.html GWASTools package Gogarten et al. 2012 samtools (v1.14) Danecek et al. 2021 IGV 2.11.9 Robinson et al. 2017 DropletUtils R package Lun et al. 2019 logNormCounts function Lun, McCarthy, and Marioni 2016 CellCycleScoring function from Seurat R package Hao et al. 2021 scds R package Bais and Kostka 2020 Batchelor R package Haghverdi et al. 2018 Uniform Mani-fold Approximation and Projection (UMAP) two-dimensional embedding McInnes et al. 2018 Louvain method (cluster_louvain function) Csárdi and Nepusz 2006 10x Genomics VarTrix and Vireo tools Huang, McCarthy, and Stegle 2019 .. REAGENT or RESOURCE SOURCE IDENTIFIER PG13-mCherry Addgene 16,442 pCMV-hyPBase Wellcome Trust Sanger Institute custom PB-PG13-mCherry-EF1a-PuroR-EGFP custom custom 4xmito-mEmerald Addgene 54,160 pLenti-PGK-LifeAct-GFP-W Addgene 51,010 pEGFP vector Clontech 632,370 pEIF1a::Cox8(1-26)::eGFP Twist Technologies custom pTetO-Ngn2-Puro Addgene 52,047 FUDGW-rtTa Addgene 19,780 MK-EF1a-mScarlet custom Tian et al. 2019 pUCM-CLYBL-hNIL Addgene 105,841 pZT-C13-R1 Addgene 62,197 pZT-C13-L1 Addgene 62,196 Software and algorithms Code for scRNA-seq and array-based genotyping analyses GitHub https://doi.org/10.5281/zenodo.7086734 HaplotypeCaller, PairedSingleSampleWf, and JointGenotypingWf workflows Github https://github.com/gatk-workflows/broad- prod-wgs-germline-snps-indels ANNOVAR Wang et al. 2010 PLINK (v1.9) Kunkle et al. 2019 Manta algorithm (Version 1.6.0) Github https://github.com/Illumina/manta Structural variant tool kit Github https://github.com/broadinstitute/gatk-sv 10x Genomics LongRanger 10X Genomics https://support.10xgenomics.com/genome- exome/software/pipelines/latest/using/wgs SeqManPro DNAStar https://www.dnastar.com/software/ lasergene/molecular-biology/ Synthego ICE Synthego https://ice.synthego.com/ GenomeStudio Software Illumina https://www.illumina.com/techniques/ microarrays/array-data-analysis-experimentaldesign/genomestudio.html GWASTools package Gogarten et al. 2012 samtools (v1.14) Danecek et al. 2021 IGV 2.11.9 Robinson et al. 2017 DropletUtils R package Lun et al. 2019 logNormCounts function Lun, McCarthy, and Marioni 2016 CellCycleScoring function from Seurat R package Hao et al. 2021 scds R package Bais and Kostka 2020 Batchelor R package Haghverdi et al. 2018 Uniform Mani-fold Approximation and Projection (UMAP) two-dimensional embedding McInnes et al. 2018 Louvain method (cluster_louvain function) Csárdi and Nepusz 2006 10x Genomics VarTrix and Vireo tools Huang, McCarthy, and Stegle 2019

    Variant Assay:

    Article Title: A reference human induced pluripotent stem cell line for large-scale collaborative studies.
    Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER KOLF2.1J The Jackson Laboratory hPSCreg: WTSli018-B-12 KUCG3 Wellcome Trust Institute custom NCRM1 NINDS Human Cell and Data Repository RRID: CVCL_1E71 NCRM5 NINDS Human Cell and Data Repository RRID: CVCL_1E75 PGP1 Synthego RRID: CVCL_F182 LNGPI1 NIH custom NN0003932 NINDS Human Cell and Data Repository RRID: CVCL_SA24 NN0004297 NINDS Human Cell and Data Repository RRID: CVCL_SA24 APOE3 ALSTEM iPS26 11a Harvard University RRID: CVCL_8987 ND50003 NINDS Human Cell and Data Repository RRID: CVCL_EZ99 ND50004 NINDS Human Cell and Data Repository RRID: CVCL_FA00 0524-1 Stanford University School of Medicine RRID: CVCL_B5FW Bioni010-C-13 European Bank for Induced Pluripotent Stem Cells RRID: CVCL_RF90 A18944 Thermo Fisher A18944 RBi001 Sigma Aldrich RRID: CVCL_9S35 Ctrl1 Wray lab Sposito et al. (2015) H9 WiCell RRID: CVCL_1240 CVB Coriell Institute RRID: CVCL_1N86 WTC11 Coriell Institute RRID: CVCL_Y803 SFC065 European Bank for Induced Pluripotent Stem Cells RRID: CVCL_RC67 Oligonucleotides sgRNA to ARID2 (AAAAGATCACTTGCTA ATGCCGG) Synthego Synthetic sgRNA Kit, modified wild-type ARID2 sequence (ACGTATGCAC TCTCCTATCAAATGAAAGCAAGCACGTCA TGCAACTTGAAAAAGATCCTAAAATCATC ACTTTACTACTTGCTAATGCCGGGGTGTT TGACGACAGTAAGTTTTAAGCTG IDT Alt-R HDR Donor Oligo Forward PCR primer for ARID2 (TTGGCAAT GATGGCCAAATGGTATG) IDT custom Reverse PCR primer for ARID2 (AAAACCCA CAACTAGCAAA) IDT custom Forward Sanger sequencing primer for ARID2 (GTCAAAGTTATGGGCTGTCC) IDT custom Reverse Sanger primer for ARID2 (GTTGACA AACAAAAAGTACTTTCTCC) IDT custom Cas9 sgRNA to TIMP3 (CCAGGAGCGCTTA CCGATGT/CGG) Synthego Synthetic sgRNA Kit, modified Plasmids PB-TO-hNGN2 Addgene 172,115 PB-TO-hNIL Addgene 172,113 pEIF1a::Transposase Addgene 172,116 (Continued on next page) e4 Cell Stem Cell 29, 1685–1702.e1–e22, December 1, 2022 .. REAGENT or RESOURCE SOURCE IDENTIFIER PG13-mCherry Addgene 16,442 pCMV-hyPBase Wellcome Trust Sanger Institute custom PB-PG13-mCherry-EF1a-PuroR-EGFP custom custom 4xmito-mEmerald Addgene 54,160 pLenti-PGK-LifeAct-GFP-W Addgene 51,010 pEGFP vector Clontech 632,370 pEIF1a::Cox8(1-26)::eGFP Twist Technologies custom pTetO-Ngn2-Puro Addgene 52,047 FUDGW-rtTa Addgene 19,780 MK-EF1a-mScarlet custom Tian et al. 2019 pUCM-CLYBL-hNIL Addgene 105,841 pZT-C13-R1 Addgene 62,197 pZT-C13-L1 Addgene 62,196 Software and algorithms Code for scRNA-seq and array-based genotyping analyses GitHub https://doi.org/10.5281/zenodo.7086734 HaplotypeCaller, PairedSingleSampleWf, and JointGenotypingWf workflows Github https://github.com/gatk-workflows/broad- prod-wgs-germline-snps-indels ANNOVAR Wang et al. 2010 PLINK (v1.9) Kunkle et al. 2019 Manta algorithm (Version 1.6.0) Github https://github.com/Illumina/manta Structural variant tool kit Github https://github.com/broadinstitute/gatk-sv 10x Genomics LongRanger 10X Genomics https://support.10xgenomics.com/genome- exome/software/pipelines/latest/using/wgs SeqManPro DNAStar https://www.dnastar.com/software/ lasergene/molecular-biology/ Synthego ICE Synthego https://ice.synthego.com/ GenomeStudio Software Illumina https://www.illumina.com/techniques/ microarrays/array-data-analysis-experimentaldesign/genomestudio.html GWASTools package Gogarten et al. 2012 samtools (v1.14) Danecek et al. 2021 IGV 2.11.9 Robinson et al. 2017 DropletUtils R package Lun et al. 2019 logNormCounts function Lun, McCarthy, and Marioni 2016 CellCycleScoring function from Seurat R package Hao et al. 2021 scds R package Bais and Kostka 2020 Batchelor R package Haghverdi et al. 2018 Uniform Mani-fold Approximation and Projection (UMAP) two-dimensional embedding McInnes et al. 2018 Louvain method (cluster_louvain function) Csárdi and Nepusz 2006 10x Genomics VarTrix and Vireo tools Huang, McCarthy, and Stegle 2019 .. REAGENT or RESOURCE SOURCE IDENTIFIER PG13-mCherry Addgene 16,442 pCMV-hyPBase Wellcome Trust Sanger Institute custom PB-PG13-mCherry-EF1a-PuroR-EGFP custom custom 4xmito-mEmerald Addgene 54,160 pLenti-PGK-LifeAct-GFP-W Addgene 51,010 pEGFP vector Clontech 632,370 pEIF1a::Cox8(1-26)::eGFP Twist Technologies custom pTetO-Ngn2-Puro Addgene 52,047 FUDGW-rtTa Addgene 19,780 MK-EF1a-mScarlet custom Tian et al. 2019 pUCM-CLYBL-hNIL Addgene 105,841 pZT-C13-R1 Addgene 62,197 pZT-C13-L1 Addgene 62,196 Software and algorithms Code for scRNA-seq and array-based genotyping analyses GitHub https://doi.org/10.5281/zenodo.7086734 HaplotypeCaller, PairedSingleSampleWf, and JointGenotypingWf workflows Github https://github.com/gatk-workflows/broad- prod-wgs-germline-snps-indels ANNOVAR Wang et al. 2010 PLINK (v1.9) Kunkle et al. 2019 Manta algorithm (Version 1.6.0) Github https://github.com/Illumina/manta Structural variant tool kit Github https://github.com/broadinstitute/gatk-sv 10x Genomics LongRanger 10X Genomics https://support.10xgenomics.com/genome- exome/software/pipelines/latest/using/wgs SeqManPro DNAStar https://www.dnastar.com/software/ lasergene/molecular-biology/ Synthego ICE Synthego https://ice.synthego.com/ GenomeStudio Software Illumina https://www.illumina.com/techniques/ microarrays/array-data-analysis-experimentaldesign/genomestudio.html GWASTools package Gogarten et al. 2012 samtools (v1.14) Danecek et al. 2021 IGV 2.11.9 Robinson et al. 2017 DropletUtils R package Lun et al. 2019 logNormCounts function Lun, McCarthy, and Marioni 2016 CellCycleScoring function from Seurat R package Hao et al. 2021 scds R package Bais and Kostka 2020 Batchelor R package Haghverdi et al. 2018 Uniform Mani-fold Approximation and Projection (UMAP) two-dimensional embedding McInnes et al. 2018 Louvain method (cluster_louvain function) Csárdi and Nepusz 2006 10x Genomics VarTrix and Vireo tools Huang, McCarthy, and Stegle 2019



    Similar Products

    94
    TaKaRa peif1a
    Peif1a, supplied by TaKaRa, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/peif1a/pGFP+Vector/pm36459969-218-27-25
    Average 94 stars, based on 1 article reviews
    peif1a - by Bioz Stars, 2026-09
    94/100 stars
      Buy from Supplier

    93
    Addgene inc paper addgene 197092 peif1a transposase michael ward addgene 172116 software
    Paper Addgene 197092 Peif1a Transposase Michael Ward Addgene 172116 Software, supplied by Addgene inc, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/peif1a/pGC204+(Plasmid+%2319709)/pm37651231-122-85-86
    Average 93 stars, based on 1 article reviews
    paper addgene 197092 peif1a transposase michael ward addgene 172116 software - by Bioz Stars, 2026-09
    93/100 stars
      Buy from Supplier

    90
    Addgene inc peif1a
    Peif1a, supplied by Addgene inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/peif1a/pHAGE-BRAF-L245F+(Plasmid+%23116172)/pm36459969-216-221-222
    Average 90 stars, based on 1 article reviews
    peif1a - by Bioz Stars, 2026-09
    90/100 stars
      Buy from Supplier

    90
    Addgene inc peif1a::transposase
    Peif1a/Transposase, supplied by Addgene inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/peif1a/paper+addgene+197092+peif1a+transposase+michael+ward+addgene+172116+software/pm36459969-217-221-222
    Average 90 stars, based on 1 article reviews
    peif1a::transposase - by Bioz Stars, 2026-09
    90/100 stars
      Buy from Supplier

    Image Search Results