Journal: Scientific Reports
Article Title: Effect of Antifibrotic MicroRNAs Crosstalk on the Action of N-acetyl-seryl-aspartyl-lysyl-proline in Diabetes-related Kidney Fibrosis
doi: 10.1038/srep29884
Figure Lengend Snippet: ( A–C ) Gene expression studies by qPCR analysis of miR-29s after transfection of scramble control and mimetic constructs (mim-miR-let-7b and mim-miR-let-7c) in the presence of TGFβ2 in the HMVECs. ( A ) miR-29a-3p. ( B ) miR-29b-3p. ( C ) miR-29c-3p. N = 5 were analyzed in data set. ( D–F ) Gene expression studies by qPCR analysis of miR-let-7s after transfection of scramble control and mimetic constructs (mim-miR-29a, mim-miR-29b and mim-miR-29c) in the presence of TGFβ2 in the HMVECs. ( D ) miR-let-7b-3p ( E ) miR-let-7c-3p. ( F ) miR-let-7f-3p. N = 6 were analyzed in data set. ( G–I ) Gene expression analysis of miR-29s after the transfection of scramble control, antagomirs (anti-miR-let-7b and anti-miR-let-7c) and TGFβ2 treated scramble control in the HMVECs. ( G ) miR-29a-3p ( H ) miR-29b-3p. ( I ) miR-29c-3p. N = 5 were analyzed in each data set. ( J-L ) Gene expression analysis of miR-let-7s after the transfection of scramble control, antagomirs (anti-miR-29a, anti-miR-29b and anti-miR-29c) and TGFβ2 treated scramble control in the HMVECs. ( J ) miR-let-7b-3p. ( K ) miR-let-7c-3p. ( L ) miR-let-7f-3p. N = 6 were analyzed in each data set. Hs_RNU6 was used as internal control. The data are expressed as the means ± s.e.m and are included in the graph.
Article Snippet: The HMVECs were transfected with 100 nM of antagomir for miR-29a, miR-29c (Fasmac, Japan), miR-29b inhibitor (Qiagen), or mimetics for miR29s (29a-3p: UAGCACCAUCUGAAAUCGGUUA, 29b-3p: UAGCACCAUUUGAAAUCAGUGUU, 29c-3p: UAGCACCAUUUGAAAUCGGUUA) using Lipofectamine 2000 transfection reagent (Invitrogen, Carlsbad, CA, USA), according to the manufacturer’s instructions.
Techniques: Gene Expression, Transfection, Control, Construct
