lamp2a  (Proteintech)

Journal: The Journal of Biological Chemistry

Article Title: USP10 inhibits the degradation of α-synuclein, a pathogenic factor associated with Parkinson's disease, by inhibiting chaperone-mediated autophagy

doi: 10.1016/j.jbc.2025.110292

Figure Lengend Snippet: USP10-KD induces degradation of α-synuclein (α-syn) by CMA. A – C , ATG7 KO or control HeLa cells were transfected with siRNA targeting USP10, LAMP2, or their combination (siUSP10/siLAMP2), or a nontargeting siRNA. Whole-cell lysates were analyzed by Western blotting using anti-α-syn, anti-USP10, anti-LAMP2A, anti-ATG7, and anti-β-actin antibodies. The ratios of the α-synn and LAMP2A bands to the β-actin band were measured by densitometry, and the means and SD from three experiments are presented in B and C . The significance of the differences was assessed by a one-way ANOVA followed by Tukey's multiple comparisons test. ∗∗ p < 0.01; ∗∗∗ p < 0.001; and ∗∗∗∗ p < 0.0001; ns, not significant. D – F , SH-SY5Y cells were transfected with siRNA targeting LAMP2, USP10, or a control siRNA. Whole-cell lysates were analyzed by Western blotting using anti-α-syn, anti-LAMP2A, anti-USP10, and anti-β-actin antibodies. The ratios of the α-syn and LAMP2A bands to the β-actin band were measured by densitometry, and the mean and SD from three experiments are presented in E and F , respectively. The significance of the differences was assessed by a one-way ANOVA followed by Tukey's multiple comparisons test. ∗ p < 0.05; ∗∗ p < 0.01; and ∗∗∗∗ p < 0.0001. G – I , SH-SY5Y cells were transfected with siRNA against LAMP2A, USP10, or control nontargeting siRNA. Whole-cell lysates were characterized by Western blot analysis using anti-α-syn, anti-LAMP2A, anti-USP10, and anti-β-actin antibodies. The ratio of the α-syn or LAMP2A bands relative to the β-actin bands was measured by densitometry scanning, and the mean and SD from three experiments are presented in H and I , respectively. The significance of the differences was assessed by a one-way ANOVA followed by Tukey's multiple comparisons test. ∗ p < 0.05; ∗∗ p < 0.001; and ∗∗∗∗ p < 0.0001. J – L , 293T cells were transfected with USP10 siRNA or control nontargeting siRNA, with or without the LAMP2A expression plasmid. Whole-cell lysates were characterized by Western blot analysis using anti-α-syn, anti-LAMP2A, anti-USP10, and anti-β-actin antibodies. The ratio of the α-syn or LAMP2A bands relative to the β-actin bands was measured by densitometry scanning, and the mean and SD from three experiments are presented in K and L , respectively. The significance of the differences was assessed by a one-way ANOVA followed by Tukey's multiple comparisons test. ns, nonsignificant, ∗ p < 0.05; ∗∗ p < 0.01; and ∗∗∗∗ p < 0.0001. M and N , SH-SY5Y cells were transfected with USP10 siRNA or a nontargeting siRNA. Prior to harvesting, the cells were treated with 25 μM VER-155008 for 24 h. Whole-cell lysates were analyzed by Western blotting using anti-α-syn, anti-USP10, anti-HSP70-1, and anti-β-actin antibodies. The ratio of α-syn bands to β-actin bands was measured by densitometry, and the means and SD from three experiments are presented at N . The significance of the differences was assessed by a one-way ANOVA followed by Tukey's multiple comparisons test. ∗∗ p < 0.01. USP10-KD, ubiquitin-specific protease 10 knockdown. CMA, chaperone-mediated autophagy; LAMP2A, lysosome-associated membrane protein 2A; USP10-KD, ubiquitin-specific protease 10 knockdown.

Article Snippet: Custom sequence siRNA against LAMP2A was ordered from Eurofins (GCACCAUCAUGCUGGAUAUAU/AUAUAGGCUGCAUGACCAUG). siRNAs were transfected into cells using Lipofectamine RNAiMAX reagent, according to the manufacturer’s protocol (Thermo Fisher Scientific).

Techniques: Control, Transfection, Western Blot, Expressing, Plasmid Preparation, Ubiquitin Proteomics, Knockdown, Membrane

Journal: The Journal of Biological Chemistry

Article Title: USP10 inhibits the degradation of α-synuclein, a pathogenic factor associated with Parkinson's disease, by inhibiting chaperone-mediated autophagy

doi: 10.1016/j.jbc.2025.110292

Figure Lengend Snippet: Perinuclear clustering of LAMP2A-positive lysosomes in USP10-KD cells. A , a schematic representation of perinuclear lysosome measurement. B – D , SH-SY5Y cells grown on cover slips were transfected with siRNA targeting USP10 or a control siRNA and subsequently stained with anti-LAMP1 ( green ) and anti-USP10 ( red ) antibodies, followed by staining with Hoechst 33258 ( blue ). The perinuclear localization of lysosomes was analyzed by measuring the fluorescence intensity around the center of the nucleus compared with the intensity near the cell border ( C ) and by assessing the relative proximity of lysosome dots to the nuclear border ( D ) in USP10-KD cells compared with control cells. The significance of the differences was assessed using unpaired two-sample t test. ∗∗ p < 0.01; ∗∗∗ p < 0.001. Scale bars represent 10 μm. E – G , SH-SY5Y cells grown on coverslips were transfected with siRNA targeting USP10 and stained with anti-LAMP1 ( green ) and anti-LAMP2 ( red ) antibodies, and nuclei were stained with Hoechst 33258 ( blue ). The perinuclear localization of lysosomes was analyzed by measuring the fluorescence intensity around the center of the nucleus compared with the intensity near the cell border ( F ) and by assessing the relative proximity of lysosome dots to the nuclear border ( G ) in USP10-KD cells compared with control cells. The significance of the differences was assessed using unpaired two-sample t test.∗∗ p < 0.01; ∗∗∗ p < 0.001. Scale bars represent 10 μm. LAMP2A, lysosome-associated membrane protein 2A; USP10-KD, ubiquitin-specific protease 10 knockdown.

Article Snippet: Custom sequence siRNA against LAMP2A was ordered from Eurofins (GCACCAUCAUGCUGGAUAUAU/AUAUAGGCUGCAUGACCAUG). siRNAs were transfected into cells using Lipofectamine RNAiMAX reagent, according to the manufacturer’s protocol (Thermo Fisher Scientific).

Techniques: Transfection, Control, Staining, Fluorescence, Membrane, Ubiquitin Proteomics, Knockdown

Journal: The Journal of Biological Chemistry

Article Title: USP10 inhibits the degradation of α-synuclein, a pathogenic factor associated with Parkinson's disease, by inhibiting chaperone-mediated autophagy

doi: 10.1016/j.jbc.2025.110292

Figure Lengend Snippet: USP10-KD increase degradation of CMA-targeted probe. A , schematic of the CMA degradation probe experiment. The Halo-tag was fused to a GFP protein containing the CMA motif. Upon addition of the TMR ligand, Halo-tag became resistant to lysosomal degradation, allowing measurement by Western blotting. B and C , SH-SY5Y cells expressing Halo-GFP or Halo-GFP-CMA were transfected with siRNA against LAMP2A, USP10, their combination (USP10/LAMP2A), or a nontargeting siRNA. Cells were incubated with the TMR ligand for 20 min at 24 h prior to collection, and whole-cell lysates were prepared. Western blot analysis was performed using anti-Halo-tag, anti-LAMP2A, anti-USP10, and anti-β-actin antibodies. The ratio of cleaved Halo bands relative to β-actin bands was measured by densitometry scanning, and the mean and SD from three experiments are presented in C . The significance of the differences was assessed by a one-way ANOVA followed by Tukey's multiple comparisons test. ∗ p < 0.05; ∗∗ p < 0.01; ns, not significant. D and E , the Halo-GFP or Halo-GFP-CMA plasmids was transfected into ATG7-KO HeLa cells together with LAMP2A siRNA, USP10 siRNA, or a combination of the two (USP10/LAMP2A). Cells were incubated with the TMR ligand for 20 min 24 h prior to cell collection, and whole-cell lysates were prepared. Western blot analysis was performed using anti-Halo-tag, anti-LAMP2A, anti-USP10, and anti-β-actin antibodies. The ratio of cleaved Halo bands relative to β-actin bands was measured by densitometry scanning, and the mean and SD from three experiments are presented in E . The significance of the differences was assessed by a one-way ANOVA followed by Tukey's multiple comparisons test. ∗ p < 0.05; ∗∗∗ p < 0.001. CMA, chaperone-mediated autophagy; LAMP2A, lysosome-associated membrane protein 2A; USP10-KD, ubiquitin-specific protease 10 knockdown.

Article Snippet: Custom sequence siRNA against LAMP2A was ordered from Eurofins (GCACCAUCAUGCUGGAUAUAU/AUAUAGGCUGCAUGACCAUG). siRNAs were transfected into cells using Lipofectamine RNAiMAX reagent, according to the manufacturer’s protocol (Thermo Fisher Scientific).

Techniques: Western Blot, Expressing, Transfection, Incubation, Membrane, Ubiquitin Proteomics, Knockdown

Journal: The Journal of Biological Chemistry

Article Title: USP10 inhibits the degradation of α-synuclein, a pathogenic factor associated with Parkinson's disease, by inhibiting chaperone-mediated autophagy

doi: 10.1016/j.jbc.2025.110292

Figure Lengend Snippet: USP10-KD promotes CMA degradation of WT α-synuclein (α-syn) and Parkinson's disease–associated α-syn mutants in SH-SY5Y cells. A and B , SH-SY5Y cells stably expressing WT or mutant α-syn were transfected with USP10 siRNA, a combination of USP10 siRNA and LAMP2 siRNA (siUSP10/siLAMP2), or nontargeting siRNA. Whole-cell lysates were analyzed by Western blotting using anti-α-syn, anti-USP10, anti-LAMP2A, and anti-β-actin antibodies. The ratio of α-syn bands relative to β-actin bands was measured by densitometry scanning, with the means and SD from three experiments presented in B . The significance of the differences was assessed by a one-way ANOVA followed by Tukey's multiple comparisons test. ∗ p < 0.05; ∗∗ p < 0.01; ns, not significant. CMA, chaperone-mediated autophagy; LAMP2A, lysosome-associated membrane protein 2A; USP10-KD, ubiquitin-specific protease 10 knockdown.

Article Snippet: Custom sequence siRNA against LAMP2A was ordered from Eurofins (GCACCAUCAUGCUGGAUAUAU/AUAUAGGCUGCAUGACCAUG). siRNAs were transfected into cells using Lipofectamine RNAiMAX reagent, according to the manufacturer’s protocol (Thermo Fisher Scientific).

Techniques: Stable Transfection, Expressing, Mutagenesis, Transfection, Western Blot, Membrane, Ubiquitin Proteomics, Knockdown

Journal: The Journal of Biological Chemistry

Article Title: USP10 inhibits the degradation of α-synuclein, a pathogenic factor associated with Parkinson's disease, by inhibiting chaperone-mediated autophagy

doi: 10.1016/j.jbc.2025.110292

Figure Lengend Snippet: Spautin-1 treatment decreases α-synuclein (α-syn) degradation in LAMP2A-dependent manner. A and B , 293T cells were transfected with HA-USP10, HA-CA-XUSP10, or HA-empty plasmid. Whole-cell lysates were analyzed by Western blotting using anti-α-syn, anti-USP10, anti-HA, and anti-β-actin antibodies. The ratio of α-syn bands relative to β-actin bands was measured by densitometry scanning, and the mean and SD from three experiments are presented in B . The significance of the differences was assessed by a one-way ANOVA followed by Tukey's multiple comparisons test. ∗∗ p < 0.01; ns, not significant. C and D , SH-SY5Y cells were transfected with siRNA targeting LAMP2A and treated with 10 μM Spautin-1 for 36 h. Whole-cell lysates were analyzed by Western blotting using anti-α-syn, anti-LAMP2A, anti-USP10, and anti-β-actin antibodies. The ratio of α-syn bands relative to β-actin bands was measured by densitometry scanning, and the mean and SD from three experiments are presented in D . The significance of the differences was assessed by a one-way ANOVA followed by Tukey's multiple comparisons test. ∗∗ p < 0.01; ∗∗∗ p < 0.001. E , proposed research model. USP10 removes ubiquitin molecules from protein X. The deubiquitinated protein X suppresses CMA by reducing the amount of LAMP2A and HSP70-1 and increases the amount of α-syn. Abnormal inhibition of CMA promotes the accumulation and aggregation of α-syn, the formation of α-syn fibril/oligomer and Lewy bodies, and α-syn fibril/oligomer are involved in the onset and progression of PD. Conversely, the inhibition of USP10 activity by Spautin-1 increases ubiquitinated protein X, increases CMA activity, and promotes the degradation of α-syn. This cascade ultimately reduces the level of α-syn and reduces the aggregation of α-syn. CMA, chaperone-mediated autophagy; HA, hemagglutinin; HSP70, heat shock response 70; LAMP2A, lysosome-associated membrane protein 2A; PD, Parkinson's disease; USP10, ubiquitin-specific protease 10.

Article Snippet: Custom sequence siRNA against LAMP2A was ordered from Eurofins (GCACCAUCAUGCUGGAUAUAU/AUAUAGGCUGCAUGACCAUG). siRNAs were transfected into cells using Lipofectamine RNAiMAX reagent, according to the manufacturer’s protocol (Thermo Fisher Scientific).

Techniques: Transfection, Plasmid Preparation, Western Blot, Ubiquitin Proteomics, Inhibition, Activity Assay, Membrane

Journal: EMBO Molecular Medicine

Article Title: Small molecule disruption of RARα/NCoR1 interaction inhibits chaperone-mediated autophagy in cancer

doi: 10.1038/s44321-025-00254-y

Figure Lengend Snippet: ( A ) Table of our five NSCLC cells lines, their CMA activity, and status of oncogenes. ( B ) Representative immunoblot for LAMP2A (left) and quantification of LAMP2A levels (right) in the indicated NSCLC cell lines and non-tumorigenic control BEAS-2B cells normalized to levels of BEAS-2B cells in each experiment (right). n = 5–6 independent experiments. (**** P ≤ 0.0001). ( C–F ) Transcriptional analysis of CMA-related genes ( C ), calculated CMA z-score ( D ), expression (as z-score) of CMA effectors, positive regulators, and negative regulators ( E ), and NCoR1/RARα ratio ( F ), in 17 non-tumorigenic lung cell lines and 15 NSCLC-derived cell lines. The heat map in ( C ) shows differential gene expression. Cell lines are listed in Appendix Table . Data from (Hruz et al, ). ( D ): ** P = 0.0031; ( E ): *** P = 0.0001, **** P ≤ 0.0001, * P = 0.0403, *** P = 0.0004, *** P = 0.0005, * P = 0.0108, ** P = 0.0012; ( F ): ** P = 0.0029). Data information: All values are mean + SEM or individual data points to represent individual samples. One-way ANOVA ( B ), unpaired two-tailed t test ( D , F ), or multiple unpaired t tests with individual variances and Bonferroni post-hoc analysis ( E ) were performed. are available online for this figure.

Article Snippet: LAMP2A sgRNA reverse primer , Fisher Scientific Custom DNA Oligonucleotides , 5’-aaacctatgggcacaaggaagttgc-3’.

Techniques: Activity Assay, Western Blot, Control, Expressing, Derivative Assay, Gene Expression, Two Tailed Test

Journal: EMBO Molecular Medicine

Article Title: Small molecule disruption of RARα/NCoR1 interaction inhibits chaperone-mediated autophagy in cancer

doi: 10.1038/s44321-025-00254-y

Figure Lengend Snippet: ( A ) Representative immunoblot for RARβ (top) and RARγ (bottom) of streptavidin pulldowns (left) and flowthrough (right) of A549 cellular lysate incubated without additions or with biotin-CIM7 (50 µM). This experiment was repeated twice with consistent results. ( B ) TRANSFAC and JASPAR PWMs obtained through analysis with Enrichr of genes significantly altered upon CIM7 treatment in the presence of AHT RARα in A549 cells. ( C ) Heat map as Z-score of the full proteome of A549 cells untreated (none) or treated with CIM7 in presence or not of lysosomal proteolysis inhibitors (N/L). Top quadrant is shown in Fig. . ( D ) Log2 fold changes (logFC) in rates of lysosomal degradation in untreated against CIM7-treted A549 cells. ( E ) Heat map (of z-scores) of changes in the subset of proteins degraded in lysosomes in A549 cells untreated (WT), in presence of CIM7 or upon LAMP2A knockdown (L2AKD). ( F ) Percentage of lysosome-degraded proteins in A549 cells displaying inhibited lysosomal degradation in the same cells as in ( E ). ( G ) Gene Ontology enrichment of CMA substrates whose degradation is inhibited (left) or not (right) by CIM7 treatment in WT A549 cells, as predicted by STRING analysis. Bar coloring corresponds to false discovery rate (FDR). are available online for this figure.

Article Snippet: LAMP2A sgRNA reverse primer , Fisher Scientific Custom DNA Oligonucleotides , 5’-aaacctatgggcacaaggaagttgc-3’.

Techniques: Western Blot, Incubation, Knockdown

Journal: EMBO Molecular Medicine

Article Title: Small molecule disruption of RARα/NCoR1 interaction inhibits chaperone-mediated autophagy in cancer

doi: 10.1038/s44321-025-00254-y

Figure Lengend Snippet: ( A ) Heatmap (as z-score) of the proteome degraded in lysosomes in A549 cells (increased levels in presence of ammonium chloride and leupeptin (N/L)) and effect of 5 µM CIM7 treatment. ( B ) STRING analysis of proteins in A549 cells displaying significant ( P < 0.05) changes in levels upon treatment with CIM7 compared to untreated A549 cells. The top five protein clusters are marked with dashed circles and labelled. ( C ) Gene Ontology enrichment of all proteins changing significantly ( >1.2-fold or <0.8-fold change versus DMSO, P < 0.05 based on unpaired two-tailed t-test) upon treatment with CIM7 in WT A549 cells as predicted by STRING analysis. Bar coloring corresponds to false discovery rate (FDR). ( D ) Heatmap (as z-score) of the proteome degraded in lysosomes in A549 cells (increased levels in presence of ammonium chloride and leupeptin (N/L) compared to N/L induced changes in LAMP2A knock-down (KD) or CIM7 treated A549 cells. ( E ) Representative examples of CMA substrates (no longer degraded in lysosomes in L2AKD A549 cells) whose degradation is also inhibited by CIM7. Values are mean + SEM and individual values. Data Information: All values are mean of three independent experiments. .

Article Snippet: LAMP2A sgRNA reverse primer , Fisher Scientific Custom DNA Oligonucleotides , 5’-aaacctatgggcacaaggaagttgc-3’.

Techniques: Two Tailed Test, Knockdown