Review

gsk650394 (MedChemExpress)

MedChemExpress is a verified supplier

MedChemExpress manufactures this product

About

News

Press Release

Team

Advisors

Partners

Contact

Bioz Stars

Bioz vStars

Buy from Supplier

Structured Review

MedChemExpress gsk650394
Gsk650394, supplied by MedChemExpress, used in various techniques. Bioz Stars score: 95/100, based on 43 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/gsk650394/GSK+650394/pmc13099944-27-7-13
Average 95 stars, based on 43 article reviews

gsk650394 - by Bioz Stars, 2026-10

95/100 stars

Images

RNA Extraction:

Article Title: RFWD2 Mitigates AD ‐Like Cognitive Impairments via the JNK – SGK1 Signaling Pathway in Mice
Article Snippet: .. The following is a list of all key reagents used in this study: DMEM basic (Gibco, Waltham, MA, USA), neurobasal medium [−] l ‐glutamine (Gibco), B‐27 serum‐free supplement (Gibco), GlutaMAX (Gibco), fetal bovine serum (Gibco), antibiotic‐antimycotic (Gibco), 0.25% EDTA‐containing phenol red trypsin (1 ×) (Gibco), poly‐ d ‐lysine (PDL) (Sigma‐Aldrich, St. Louis, MO, USA), SP600125 (MedChemExpress, Monmouth Junction, NJ, USA), GSK650394 (MedChemExpress), phosphatase inhibitor cocktail (Bioss, Woburn, MA, USA), RNA Extraction Kit (Vazyme, Nanjing, China), TUNEL (Cat. No: HY‐K1078; MedChemExpress), 2′, 7′‐dichlorodihydrofluorescein diacetate fluorescent probe (Cat: HY‐D0940; MedChemExpress), Annexin‐V‐FITC (Cat. No: HY‐K1073; MedChemExpress), Mitochondrial Membrane Potential Detection Kit (Beyotime Biotechnology, Shanghai, China), mouse monoclonal anti‐RFWD2 (Sigma‐Aldrich), rabbit polyclonal anti‐SGK1 (Wuhan Proteintech, Wuhan China), rabbit polyclonal anti‐phosphorylated JNK ( p ‐JNK) (Santa Cruz Biotechnology, Dallas, TX, USA), mouse polyclonal anti‐p‐Tau (Santa Cruz Biotechnology), rabbit polyclonal anti‐Kv1.4 (Invitrogen, Waltham, MA, USA), mouse monoclonal anti‐MAP‐2 (Santa Cruz Biotechnology), mouse polyclonal anti‐p‐JNK (Santa Cruz Biotechnology), rabbit polyclonal anti‐JNK3 (Abcam, Cambridge, UK), donkey anti‐rabbit Cy3 (The Jackson Laboratory, Bar Harbor, ME, USA), donkey anti‐mouse Alexa Fluor 488 (Invitrogen), Anti‐Fluorescence Quenching Mounting Medium (Invitrogen), PAGE Gel Rapid Preparation Kit (Yeasen Biotechnology, Shanghai, China), and bovine serum albumin (full component) (Solarbio, Beijing, China). .. The gene sequence (CTCAACTCCTACGAGGACAAA) of the previously verified effective RFWD2‐specific shRNA was obtained from the NCBI website, and the LV‐RFWD2‐shRNA‐mCherry lentivirus was constructed by GenePharma (Suzhou, China).

TUNEL Assay:

Membrane:

Polyacrylamide Gel Electrophoresis:

Mouse Assay:

Article Title: Hippocampal SGK1 promotes vulnerability to depression: the role of early life adversity, stress, and genetic risk
Article Snippet: .. Mice were injected intraperitoneally (i.p.) with the SGK1 inhibitor, GSK650394 (5 mg/kg; MedChem Express), 30 min before each defeat on each day of the 10-day CSDS paradigm. ..

Article Title: Hippocampal SGK1 promotes vulnerability to depression: the role of early life adversity, stress, and genetic risk.
Article Snippet: Serum and Glucocorticoid-regulated Kinase 1 (SGK1) is elevated in hippocampal neurons following glucocorticoid exposure and in peripheral blood of depressed patients.. However, its mechanistic role in psychopathology and its relevance to the human brain are unknown.. To address this gap, we investigated human postmortem brain tissue and found higher SGK1 expression in the hippocampus of depressed suicide decedents compared to healthy subjects who died of natural causes.

Injection:

other:

Article Title: Traditional Medicinal Plant Dahlia pinnata Selectively Suppresses TNF-α Expression Through Modulation of NF-κB and p38 Signaling.
Article Snippet: Additional compounds, including GSK2334470, MK-2206, GSK650394, and CHIR99021, were obtained from Apexbio (Hous- https://doi.org/10.3390/ijms27021122 ton, TX, USA), MedChemExpress (Monmouth Junction, NJ, USA), Selleckchem (Houston, TX, USA), and Tocris Bioscience (Bristol, UK), respectively.

Article Title: Traditional Medicinal Plant Dahlia pinnata Selectively Suppresses TNF-α Expression Through Modulation of NF-κB and p38 Signaling
Article Snippet: Additional compounds, including GSK2334470, MK-2206, GSK650394, and CHIR99021, were obtained from Apexbio (Houston, TX, USA), MedChemExpress (Monmouth Junction, NJ, USA), Selleckchem (Houston, TX, USA), and Tocris Bioscience (Bristol, UK), respectively.

Image Search Results

Inhibition of SGK1 attenuates apoptosis and oxidative stress in hyperosmotic-treated HCECs. ( A ) Quantitative analysis of cell viability ( n = 5). ( B ) Western blot analysis of SGK1, Bcl-2, Bax, and cCasp3. ( C ) Quantification of protein levels from B ( n = 3). ( D ) Flow cytometric analysis of apoptosis. ( E ) Apoptosis rate quantification ( n = 3). ( F ) Fluorescence images of intracellular ROS. Scale bar : 100 µm. ( G ) Flow cytometric measurement of ROS levels. ( H ) Quantitative analysis of ROS levels from G ( n = 3). ( I ) Measurement of MDA content ( n = 3). ( J ) CAT activity assay ( n = 3). ( K ) SOD activity assay ( n = 3). Data are presented as mean ± SD. * P < 0.05, ** P < 0.01, *** P < 0.001.

Journal: Investigative Ophthalmology & Visual Science

Article Title: Inhibition of SGK1 Alleviates Apoptosis and Oxidative Stress in Dry Eye Disease by Activating FoxO3a-Mediated Autophagy

doi: 10.1167/iovs.67.5.37

Figure Lengend Snippet: Inhibition of SGK1 attenuates apoptosis and oxidative stress in hyperosmotic-treated HCECs. ( A ) Quantitative analysis of cell viability ( n = 5). ( B ) Western blot analysis of SGK1, Bcl-2, Bax, and cCasp3. ( C ) Quantification of protein levels from B ( n = 3). ( D ) Flow cytometric analysis of apoptosis. ( E ) Apoptosis rate quantification ( n = 3). ( F ) Fluorescence images of intracellular ROS. Scale bar : 100 µm. ( G ) Flow cytometric measurement of ROS levels. ( H ) Quantitative analysis of ROS levels from G ( n = 3). ( I ) Measurement of MDA content ( n = 3). ( J ) CAT activity assay ( n = 3). ( K ) SOD activity assay ( n = 3). Data are presented as mean ± SD. * P < 0.05, ** P < 0.01, *** P < 0.001.

Article Snippet: The GSK650394 group received 5 μL of 5-mM GSK650394 eye drops (TargetMol Chemicals, Boston, MA, USA) twice daily, the rapamycin (RAPA; Selleck Chemicals, Shanghai, China) group received 5 μL of 0.25% RAPA eye drops twice daily, the dimethyl sulfoxide (DMSO; TargetMol Chemicals) group received 5 μL of PBS containing 0.1% DMSO twice daily serving as a solvent control, and the 3-methyladenine (3-MA; Selleck Chemicals) group received 5 μL of 0.5% 3-MA eye drops twice daily in addition to GSK650394 treatment.

Techniques: Inhibition, Analysis, Western Blot, Fluorescence, Activity Assay, FACS, Fluorescence Microscopy

Inhibition of SGK1 alleviates ocular surface damage in DED mice. ( A ) Immunofluorescence staining of SGK1 ( red ) and DAPI ( blue ) in mouse corneas. Scale bar : 50 µm. ( B ) Tear secretion analysis ( n = 5). ( C ) Corneal fluorescein staining (days 0, 7, and 14). ( D ) Clinical score quantification corresponding to C ( n = 5). ( E ) H&E staining of corneas on day 14. Scale bar : 50 µm. Also shown is quantification of corneal epithelial thickness ( n = 5). ( F ) PAS staining of conjunctival sections on day 14. Scale bar : 50 µm. Also shown is quantification of goblet cell density ( n = 5). ( G ) TUNEL assay of apoptotic corneal and conjunctival epithelia ( red ) with DAPI ( blue ). Scale bar : 50 µm. Also shown is quantification of TUNEL-positive cells ( n = 5). All data are presented as mean ± SD. ** P < 0.01, *** P < 0.001.

Journal: Investigative Ophthalmology & Visual Science

Article Title: Inhibition of SGK1 Alleviates Apoptosis and Oxidative Stress in Dry Eye Disease by Activating FoxO3a-Mediated Autophagy

doi: 10.1167/iovs.67.5.37

Figure Lengend Snippet: Inhibition of SGK1 alleviates ocular surface damage in DED mice. ( A ) Immunofluorescence staining of SGK1 ( red ) and DAPI ( blue ) in mouse corneas. Scale bar : 50 µm. ( B ) Tear secretion analysis ( n = 5). ( C ) Corneal fluorescein staining (days 0, 7, and 14). ( D ) Clinical score quantification corresponding to C ( n = 5). ( E ) H&E staining of corneas on day 14. Scale bar : 50 µm. Also shown is quantification of corneal epithelial thickness ( n = 5). ( F ) PAS staining of conjunctival sections on day 14. Scale bar : 50 µm. Also shown is quantification of goblet cell density ( n = 5). ( G ) TUNEL assay of apoptotic corneal and conjunctival epithelia ( red ) with DAPI ( blue ). Scale bar : 50 µm. Also shown is quantification of TUNEL-positive cells ( n = 5). All data are presented as mean ± SD. ** P < 0.01, *** P < 0.001.

Techniques: Inhibition, Immunofluorescence, Staining, Analysis, TUNEL Assay, H&E Stain

Inhibition of SGK1 promotes autophagy in DED. ( A ) Western blot analysis of p62 and LC3 in HCECs. ( B ) Quantification of protein levels from A ( n = 3). ( C ) Western blot analysis of p62 and LC3 in mouse corneal tissues ( n = 5 corneas per sample). ( D ) Quantification of protein levels from C ( n = 3). ( E ) Fluorescent images of HCECs transfected with mRFP-GFP-LC3 lentivirus, showing GFP-LC3 ( green ) and RFP-LC3 ( red ) signals. Scale bar : 10 µm. ( F ) Quantitative analysis of autolysosomes ( red puncta ) and autophagosomes ( yellow puncta ) from E ( n = 5). ( G ) TEM images of HCECs. Scale bar : 1 µm. A rrows indicate autophagic vacuoles, including autophagosomes and autolysosomes. All data are presented as mean ± SD. * P < 0.05, ** P < 0.01, *** P < 0.001.

Journal: Investigative Ophthalmology & Visual Science

Article Title: Inhibition of SGK1 Alleviates Apoptosis and Oxidative Stress in Dry Eye Disease by Activating FoxO3a-Mediated Autophagy

doi: 10.1167/iovs.67.5.37

Figure Lengend Snippet: Inhibition of SGK1 promotes autophagy in DED. ( A ) Western blot analysis of p62 and LC3 in HCECs. ( B ) Quantification of protein levels from A ( n = 3). ( C ) Western blot analysis of p62 and LC3 in mouse corneal tissues ( n = 5 corneas per sample). ( D ) Quantification of protein levels from C ( n = 3). ( E ) Fluorescent images of HCECs transfected with mRFP-GFP-LC3 lentivirus, showing GFP-LC3 ( green ) and RFP-LC3 ( red ) signals. Scale bar : 10 µm. ( F ) Quantitative analysis of autolysosomes ( red puncta ) and autophagosomes ( yellow puncta ) from E ( n = 5). ( G ) TEM images of HCECs. Scale bar : 1 µm. A rrows indicate autophagic vacuoles, including autophagosomes and autolysosomes. All data are presented as mean ± SD. * P < 0.05, ** P < 0.01, *** P < 0.001.

Techniques: Inhibition, Western Blot, Analysis, Transfection

Inhibition of SGK1 promotes autophagy through FoxO3a activation. ( A ) Co-IP and western blot analysis of SGK1 and FoxO3a in HCECs. ( B ) Western blot analysis of p -FoxO3a and FoxO3a in HCECs. ( C ) Quantification of protein levels from B ( n = 3). ( D ) Immunofluorescence staining of FoxO3a ( green ) and DAPI ( blue ) in HCECs. Scale bar : 5 µm. ( E ) Immunofluorescence staining of FoxO3a ( green ) and DAPI ( blue ) in mouse corneal epithelium. Scale bar : 50 µm. ( F ) Relative mRNA expression level of FoxO3a in HCECs ( n = 3). ( G ) Western blot analysis of FoxO3a protein in HCECs. ( H ) Quantification of FoxO3a protein levels from G ( n = 3). ( I ) Western blot analysis of FoxO3a, p62, and LC3 in HCECs. ( J ) Quantification of protein levels from I ( n = 3). ( K ) Fluorescent images of HCECs transfected with mRFP-GFP-LC3 lentivirus, showing GFP-LC3 ( green ) and RFP-LC3 ( red ) signals. Scale bar : 10 µm. ( L ) Quantitative analysis of autolysosomes ( red puncta ) and autophagosomes ( yellow puncta ) from K ( n = 5). ( M ) TEM images of HCECs. Scale bar : 1 µm. Arrows indicate autophagic vacuoles, including autophagosomes and autolysosomes. All data are presented as mean ± SD. * P < 0.05, ** P < 0.01, *** P < 0.001.

Journal: Investigative Ophthalmology & Visual Science

Article Title: Inhibition of SGK1 Alleviates Apoptosis and Oxidative Stress in Dry Eye Disease by Activating FoxO3a-Mediated Autophagy

doi: 10.1167/iovs.67.5.37

Figure Lengend Snippet: Inhibition of SGK1 promotes autophagy through FoxO3a activation. ( A ) Co-IP and western blot analysis of SGK1 and FoxO3a in HCECs. ( B ) Western blot analysis of p -FoxO3a and FoxO3a in HCECs. ( C ) Quantification of protein levels from B ( n = 3). ( D ) Immunofluorescence staining of FoxO3a ( green ) and DAPI ( blue ) in HCECs. Scale bar : 5 µm. ( E ) Immunofluorescence staining of FoxO3a ( green ) and DAPI ( blue ) in mouse corneal epithelium. Scale bar : 50 µm. ( F ) Relative mRNA expression level of FoxO3a in HCECs ( n = 3). ( G ) Western blot analysis of FoxO3a protein in HCECs. ( H ) Quantification of FoxO3a protein levels from G ( n = 3). ( I ) Western blot analysis of FoxO3a, p62, and LC3 in HCECs. ( J ) Quantification of protein levels from I ( n = 3). ( K ) Fluorescent images of HCECs transfected with mRFP-GFP-LC3 lentivirus, showing GFP-LC3 ( green ) and RFP-LC3 ( red ) signals. Scale bar : 10 µm. ( L ) Quantitative analysis of autolysosomes ( red puncta ) and autophagosomes ( yellow puncta ) from K ( n = 5). ( M ) TEM images of HCECs. Scale bar : 1 µm. Arrows indicate autophagic vacuoles, including autophagosomes and autolysosomes. All data are presented as mean ± SD. * P < 0.05, ** P < 0.01, *** P < 0.001.

Techniques: Inhibition, Activation Assay, Co-Immunoprecipitation Assay, Western Blot, Analysis, Immunofluorescence, Staining, Expressing, Transfection, Knockdown

Schematic illustration of the mechanism by which inhibition of SGK1 alleviates apoptosis and oxidative stress in DED by activating FoxO3a-mediated autophagy. (Created with BioGDP.com . ).

Journal: Investigative Ophthalmology & Visual Science

Article Title: Inhibition of SGK1 Alleviates Apoptosis and Oxidative Stress in Dry Eye Disease by Activating FoxO3a-Mediated Autophagy

doi: 10.1167/iovs.67.5.37

Figure Lengend Snippet: Schematic illustration of the mechanism by which inhibition of SGK1 alleviates apoptosis and oxidative stress in DED by activating FoxO3a-mediated autophagy. (Created with BioGDP.com . ).

Techniques: Inhibition

LIN28A-mediated reprogramming of an STK network promotes imatinib resistance. A , Z-score of STKs predicted by KSEA to be activated ( red ) in ImR and K562-LIN28 OE cells and suppressed ( blue ) in ImR-LIN28A KD cells. Asterisks (∗) indicate significant prediction (FDR<0.05). B , signaling network centered on PRKCD (PKCd), showing differential protein expression ( inner circle ) and phosphorylation ( outer circle ) in ImR versus ImR-LIN28A KD cells (Omics Visualizer and StringApp in Cytoscape). Color scale represents log2 fold changes from MS data. C , relative proliferation of the indicated cells treated with midostaurin (1 μM, PKC inhibitor), GSK650394 (1 μM, SGK1 inhibitor), or AKTi (1 μM), with or without 500 nM imatinib. Cell viability was assessed by WST-8 assay after 72 h. Data are normalized to vehicle (DMSO) or imatinib-only controls (mean ± SEM; ∗ p < 0.05, one-way ANOVA with Tukey's post hoc test). AKTi, AKT inhibition; DMSO, dimethyl sulfoxide; FDR, false discovery rate; ImR, imatinib resistance; KSEA, kinase substrate enrichment analysis; STK, Ser/Thr kinase; WST-8, water-soluble tetrazolium 8.

Journal: Molecular & Cellular Proteomics : MCP

Article Title: LIN28A-Dependent Kinome and Phosphoproteome Reprogramming Promotes Imatinib Resistance

doi: 10.1016/j.mcpro.2026.101514

Figure Lengend Snippet: LIN28A-mediated reprogramming of an STK network promotes imatinib resistance. A , Z-score of STKs predicted by KSEA to be activated ( red ) in ImR and K562-LIN28 OE cells and suppressed ( blue ) in ImR-LIN28A KD cells. Asterisks (∗) indicate significant prediction (FDR<0.05). B , signaling network centered on PRKCD (PKCd), showing differential protein expression ( inner circle ) and phosphorylation ( outer circle ) in ImR versus ImR-LIN28A KD cells (Omics Visualizer and StringApp in Cytoscape). Color scale represents log2 fold changes from MS data. C , relative proliferation of the indicated cells treated with midostaurin (1 μM, PKC inhibitor), GSK650394 (1 μM, SGK1 inhibitor), or AKTi (1 μM), with or without 500 nM imatinib. Cell viability was assessed by WST-8 assay after 72 h. Data are normalized to vehicle (DMSO) or imatinib-only controls (mean ± SEM; ∗ p < 0.05, one-way ANOVA with Tukey's post hoc test). AKTi, AKT inhibition; DMSO, dimethyl sulfoxide; FDR, false discovery rate; ImR, imatinib resistance; KSEA, kinase substrate enrichment analysis; STK, Ser/Thr kinase; WST-8, water-soluble tetrazolium 8.

Article Snippet: For pharmacological studies, cells were treated with inhibitors to various kinases, including BCR-ABL: imatinib (S2475), dasatinib (S1021), or ponatinib (S1490); AKT: AKTi-1/2 (S7776); mTOR: rapamycin (Cayman, 13346); PKC/FLT3: midostaurin (S8064); SGK: GSK650394 (S7209); PDK1: BX-912 (Cayman, 14708; CaMKII: KN-93 (Cayman, 21472); or AXL: bemcentinib (MedChemExpress, HY-15150).

Techniques: Expressing, Phospho-proteomics, Inhibition

Review

gsk650394 (MedChemExpress)

Structured Review

Images

Related Articles

RNA Extraction:

TUNEL Assay:

Membrane:

Polyacrylamide Gel Electrophoresis:

Mouse Assay:

Injection:

other:

Similar Products

Image Search Results