g361  (ATCC)

Journal: Cancers

Article Title: Mechanisms of the Antiproliferative Effects of SIRT6 Inhibition in Melanoma: A Multi-Omics Analysis

doi: 10.3390/cancers18040590

Figure Lengend Snippet: Characterization of SIRT6 expression in G361 knockdown (KD) cells and proteogenomics workflow in melanoma cells. ( A ) CRISPR/Cas9-mediated SIRT6 KD G361 cells were created, and protein expression was determined by Protein Simple automated Western blotting. SIRT6 KD reduces the ( B ) proliferation and ( C ) colony forming potential of G361 melanoma cells. Data is representative of at least 2 biological and 3 technical replicates per group, with statistical significance determined using one-way ANOVA and data shown as mean ± SEM (* p ≤ 0.05, **** p ≤ 0.0001). ( D ) Schematic representation of the experimental workflow for integrative proteogenomic analysis in A375 and G361 melanoma cells, outlining the steps from sample preparation to data integration. For RNA-seq and proteomics, data was generated from three independent biological replicates per group. For all datasets, control cell line was matched for each knockdown strategy.

Article Snippet: CRISPR/Cas9-mediated SIRT6 KD G361 cell lines were purchased from Synthego (guide sequence CUUCCGCUCCAGCUCCUCCG) and clones were isolated using the same method.

Techniques: Expressing, Knockdown, CRISPR, Western Blot, Sample Prep, RNA Sequencing, Generated, Control

Journal: Cancers

Article Title: Mechanisms of the Antiproliferative Effects of SIRT6 Inhibition in Melanoma: A Multi-Omics Analysis

doi: 10.3390/cancers18040590

Figure Lengend Snippet: Transcriptomic profiling and functional enrichment analysis of SIRT6 knockdown (KD) G361 cells. ( A ) RNA-seq analysis of SIRT6 KD G361 cells identified multiple differentially expressed genes (DEGs) with the top 20 up/down regulated denoted in the volcano plot. Dashed line indicates significant genes with Log2 FC ≥ |1.5|. Gene Ontology (GO) enrichment analysis by PANTHER of top 200 significant DEGs revealed alterations across various biological processes ( B ) and molecular functions ( C ).

Article Snippet: CRISPR/Cas9-mediated SIRT6 KD G361 cell lines were purchased from Synthego (guide sequence CUUCCGCUCCAGCUCCUCCG) and clones were isolated using the same method.

Techniques: Functional Assay, Knockdown, RNA Sequencing

Journal: Cancers

Article Title: Mechanisms of the Antiproliferative Effects of SIRT6 Inhibition in Melanoma: A Multi-Omics Analysis

doi: 10.3390/cancers18040590

Figure Lengend Snippet: Transcriptomic profiling and functional enrichment analysis of SIRT6 knockdown (KD) A375 cells. ( A ) The top 20 up/down regulated differentially expressed genes (DEGs) identified by RNA-seq in SIRT6 KD A375 cells denoted via volcano plot. Dashed line indicates significant genes with Log2 FC ≥ |1.5|. Subsequent Gene Ontology (GO) enrichment by PANTHER of top 200 significant DEGs found significant changes in several biological processes ( B ) and molecular functions ( C ) in SIRT6 KD A375 cells.

Article Snippet: CRISPR/Cas9-mediated SIRT6 KD G361 cell lines were purchased from Synthego (guide sequence CUUCCGCUCCAGCUCCUCCG) and clones were isolated using the same method.

Techniques: Functional Assay, Knockdown, RNA Sequencing

Journal: Cancers

Article Title: Mechanisms of the Antiproliferative Effects of SIRT6 Inhibition in Melanoma: A Multi-Omics Analysis

doi: 10.3390/cancers18040590

Figure Lengend Snippet: Functional insights from Ingenuity Pathway Analysis (IPA). ( A ) Graphical summary generated by Ingenuity Pathway Analysis highlighting predicted target regulation activity based on differentially expressed genes (DEGs) in SIRT6 knockdown (KD) G361 cells. ( B ) Top canonical pathways affected in SIRT6 KD G361 cells as predicted by IPA based on the transcriptomic data. IPA analysis of differentially expressed genes shows regulation of cancer-related biological functions in SIRT6 KD G361 ( C ) and A375 cells ( D ).

Article Snippet: CRISPR/Cas9-mediated SIRT6 KD G361 cell lines were purchased from Synthego (guide sequence CUUCCGCUCCAGCUCCUCCG) and clones were isolated using the same method.

Techniques: Functional Assay, Generated, Activity Assay, Knockdown

Journal: Cancers

Article Title: Mechanisms of the Antiproliferative Effects of SIRT6 Inhibition in Melanoma: A Multi-Omics Analysis

doi: 10.3390/cancers18040590

Figure Lengend Snippet: Interactions of SIRT6 with numerous key cell death, invasion, and proliferation genes. Ingenuity Pathway Analysis (IPA) evaluation of differentially expressed genes (DEGs) in SIRT6 KD human melanoma cell lines predicted SIRT6-interacting genes associated with proliferation ( A ) and cell death ( B ) in SIRT6 KD G361 cells. Line type identifies interaction, with solid lines indicating direct interactions and dashed lines indicating indirect interactions. Arrows at the end of the lines indicate that SIRT6 may affect expression of the indicated gene, while a bar at the end of the line indicates inhibition.

Article Snippet: CRISPR/Cas9-mediated SIRT6 KD G361 cell lines were purchased from Synthego (guide sequence CUUCCGCUCCAGCUCCUCCG) and clones were isolated using the same method.

Techniques: Expressing, Inhibition

Journal: Cancers

Article Title: Mechanisms of the Antiproliferative Effects of SIRT6 Inhibition in Melanoma: A Multi-Omics Analysis

doi: 10.3390/cancers18040590

Figure Lengend Snippet: Proteomics analysis of SIRT6 knockdown (KD) A375 melanoma cells. Proteomic analysis of SIRT6 KD A375 cells showing peptide identifications ( A ) and abundance data ( B ) in respective proteins. Gene Ontology (GO) enrichment based on PANTHER analysis reveals regulation of multiple biological ( C ) and molecular ( D ) functions in SIRT6 KD A375 cells.

Article Snippet: CRISPR/Cas9-mediated SIRT6 KD G361 cell lines were purchased from Synthego (guide sequence CUUCCGCUCCAGCUCCUCCG) and clones were isolated using the same method.

Techniques: Knockdown

Journal: Cancers

Article Title: Mechanisms of the Antiproliferative Effects of SIRT6 Inhibition in Melanoma: A Multi-Omics Analysis

doi: 10.3390/cancers18040590

Figure Lengend Snippet: Comparative analysis of multi-omics data. Comparison of SIRT6 knockdown (KD) G361 and A375 cell-based transcriptomics and proteomics data by Ingenuity Pathway Analysis (IPA) predicted regulation of multiple canonical pathways ( A ) and biological functions ( B ) that were predicted to be modulated and are related to cell proliferation, division, migration, invasion, and death at RNA and protein levels. By analyzing protein modulation ≥|1.2|-fold (red = increased levels; green = decreased levels), IPA predicted inhibition of cell proliferation ( C ) and activation of cell death of tumor cell lines ( D ) in our SIRT6 KD A375 cells as compared to the shNS control cells ( n = 3 per group).

Article Snippet: CRISPR/Cas9-mediated SIRT6 KD G361 cell lines were purchased from Synthego (guide sequence CUUCCGCUCCAGCUCCUCCG) and clones were isolated using the same method.

Techniques: Biomarker Discovery, Comparison, Knockdown, Transcriptomics, Migration, Inhibition, Activation Assay, Control

Journal: Cancers

Article Title: Mechanisms of the Antiproliferative Effects of SIRT6 Inhibition in Melanoma: A Multi-Omics Analysis

doi: 10.3390/cancers18040590

Figure Lengend Snippet: Causal networks from multi-omics data. Comparative analysis of multi-omics data from SIRT6 knockdown (KD) G361 and A375 cells by Ingenuity Pathway Analysis (IPA) showed predicted regulation of multiple networks. ( A ) Common causal networks inferred from multi-omics data, integrating upstream regulators and downstream effects. ( B ) SIRT6 KD in A375 cells affects multiple proteins with ≥|1.2|-fold change ( n = 3 per group; shNS and shSIRT6) related to transcription factor family networks, highlighting top common pathways with activation z-scores ≥|2| in both transcriptomics and proteomics data.

Article Snippet: CRISPR/Cas9-mediated SIRT6 KD G361 cell lines were purchased from Synthego (guide sequence CUUCCGCUCCAGCUCCUCCG) and clones were isolated using the same method.

Techniques: Biomarker Discovery, Knockdown, Activation Assay, Transcriptomics