Review



antibody dlat  (Proteintech)


Bioz Verified Symbol Proteintech is a verified supplier  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
    • 96
      Buy from Supplier

    Structured Review

    Proteintech antibody dlat
    Antibody Dlat, supplied by Proteintech, used in various techniques. Bioz Stars score: 96/100, based on 178 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/dlat/pm41928317-89-8-13?v=Proteintech
    Average 96 stars, based on 178 article reviews
    antibody dlat - by Bioz Stars, 2026-07
    96/100 stars

    Images



    Similar Products

    anti dlat  (Bioss)
    94
    Bioss anti dlat
    Anti Dlat, supplied by Bioss, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/dlat/pmc13131405-74-0-4?v=Bioss
    Average 94 stars, based on 1 article reviews
    anti dlat - by Bioz Stars, 2026-07
    94/100 stars
    		  Buy from Supplier
    pcmv flag dlat p71850  (Vector Biolabs)
    94
    Vector Biolabs pcmv flag dlat p71850
    Pcmv Flag Dlat P71850, supplied by Vector Biolabs, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/dlat/pm42009144-62-20-17?v=Vector+Biolabs
    Average 94 stars, based on 1 article reviews
    pcmv flag dlat p71850 - by Bioz Stars, 2026-07
    94/100 stars
    		  Buy from Supplier
    rabbit anti dlat  (Servicebio Inc)
    86
    Servicebio Inc rabbit anti dlat
    Rabbit Anti Dlat, supplied by Servicebio Inc, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/dlat/pm42260670-108-40-44?v=Servicebio+Inc
    Average 86 stars, based on 1 article reviews
    rabbit anti dlat - by Bioz Stars, 2026-07
    86/100 stars
    		  Buy from Supplier
    ctccttaatgtcacgcacgat sangon biotech n a primer dlat forward  (Sangon Biotech)
    86
    Sangon Biotech ctccttaatgtcacgcacgat sangon biotech n a primer dlat forward
    Ctccttaatgtcacgcacgat Sangon Biotech N A Primer Dlat Forward, supplied by Sangon Biotech, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/dlat/pm42054210-662-108-109?v=Sangon+Biotech
    Average 86 stars, based on 1 article reviews
    ctccttaatgtcacgcacgat sangon biotech n a primer dlat forward - by Bioz Stars, 2026-07
    86/100 stars
    		  Buy from Supplier
    cggaactccacgagtgacc sangon biotech n a primer dlat reverse  (Sangon Biotech)
    86
    Sangon Biotech cggaactccacgagtgacc sangon biotech n a primer dlat reverse
    Cggaactccacgagtgacc Sangon Biotech N A Primer Dlat Reverse, supplied by Sangon Biotech, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/dlat/pm42054210-662-115-116?v=Sangon+Biotech
    Average 86 stars, based on 1 article reviews
    cggaactccacgagtgacc sangon biotech n a primer dlat reverse - by Bioz Stars, 2026-07
    86/100 stars
    		  Buy from Supplier
    human dlat shrna silencing aav  (Vector Biolabs)
    94
    Vector Biolabs human dlat shrna silencing aav
    Human Dlat Shrna Silencing Aav, supplied by Vector Biolabs, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/dlat/pm42009144-62-9-17?v=Vector+Biolabs
    Average 94 stars, based on 1 article reviews
    human dlat shrna silencing aav - by Bioz Stars, 2026-07
    94/100 stars
    		  Buy from Supplier
    antibody dlat  (Proteintech)
    96
    Proteintech antibody dlat
    Antibody Dlat, supplied by Proteintech, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/dlat/pm41928317-89-8-13?v=Proteintech
    Average 96 stars, based on 1 article reviews
    antibody dlat - by Bioz Stars, 2026-07
    96/100 stars
    		  Buy from Supplier
    anti dlat antibody  (Proteintech)
    96
    Proteintech anti dlat antibody
    Anti Dlat Antibody, supplied by Proteintech, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/dlat/pm41928317-86-9-14?v=Proteintech
    Average 96 stars, based on 1 article reviews
    anti dlat antibody - by Bioz Stars, 2026-07
    96/100 stars
    		  Buy from Supplier
    skim milk  (Proteintech)
    96
    Proteintech skim milk
    Skim Milk, supplied by Proteintech, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/dlat/pmc12906090-131-7-21?v=Proteintech
    Average 96 stars, based on 1 article reviews
    skim milk - by Bioz Stars, 2026-07
    96/100 stars
    		  Buy from Supplier

    Image Search Results