Review




Structured Review

Proteintech cyp1b1
The screening and evaluation of DC‐derived lncRNA. (A, B) The plasma levels of oxPAPC and IL‐1β in CHD. (C) The up‐regulated lncRNAs under various oxPAPC stimuli. (D) The down‐regulated lncRNAs under various oxPAPC stimuli. (E) The expression level of the ENST00000628135 <t>(CYP1B1‐AS1).</t> (F) The genomic localisation of mouse for Gm33055 and CYP1B1‐AS1 by Integrative Genomics Viewer (IGV). (G) The genomic localisation of human for Gm33055 and CYP1B1‐AS1 by IGV. (H) The intersection of Gm33055 and RNA‐binding proteins in the promoter region of CYP1B1‐AS1 by RBP map analysis. (I) The non‐coding potential of Gm33055 by Coding‐Non‐Coding Index (CNCI) prediction. (J) The non‐coding potential of Gm33055 by Coding Potential Calculator 2 (CPC2) prediction (** P < 0.01, *** P < 0.001, **** P < 0.0001).
Cyp1b1, supplied by Proteintech, used in various techniques. Bioz Stars score: 95/100, based on 51 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/cyp1b1/CYP1B1+Antibody/pmc12948649-121-59-60
Average 95 stars, based on 51 article reviews
cyp1b1 - by Bioz Stars, 2026-09
95/100 stars

Images

1) Product Images from "oxPAPC ‐Mediated lncRNA CYP1B1 ‐ AS1 From Dendritic Cells Accelerates Atherosclerosis"

Article Title: oxPAPC ‐Mediated lncRNA CYP1B1 ‐ AS1 From Dendritic Cells Accelerates Atherosclerosis

Journal: Journal of Cellular and Molecular Medicine

doi: 10.1111/jcmm.71066

The screening and evaluation of DC‐derived lncRNA. (A, B) The plasma levels of oxPAPC and IL‐1β in CHD. (C) The up‐regulated lncRNAs under various oxPAPC stimuli. (D) The down‐regulated lncRNAs under various oxPAPC stimuli. (E) The expression level of the ENST00000628135 (CYP1B1‐AS1). (F) The genomic localisation of mouse for Gm33055 and CYP1B1‐AS1 by Integrative Genomics Viewer (IGV). (G) The genomic localisation of human for Gm33055 and CYP1B1‐AS1 by IGV. (H) The intersection of Gm33055 and RNA‐binding proteins in the promoter region of CYP1B1‐AS1 by RBP map analysis. (I) The non‐coding potential of Gm33055 by Coding‐Non‐Coding Index (CNCI) prediction. (J) The non‐coding potential of Gm33055 by Coding Potential Calculator 2 (CPC2) prediction (** P < 0.01, *** P < 0.001, **** P < 0.0001).
Figure Legend Snippet: The screening and evaluation of DC‐derived lncRNA. (A, B) The plasma levels of oxPAPC and IL‐1β in CHD. (C) The up‐regulated lncRNAs under various oxPAPC stimuli. (D) The down‐regulated lncRNAs under various oxPAPC stimuli. (E) The expression level of the ENST00000628135 (CYP1B1‐AS1). (F) The genomic localisation of mouse for Gm33055 and CYP1B1‐AS1 by Integrative Genomics Viewer (IGV). (G) The genomic localisation of human for Gm33055 and CYP1B1‐AS1 by IGV. (H) The intersection of Gm33055 and RNA‐binding proteins in the promoter region of CYP1B1‐AS1 by RBP map analysis. (I) The non‐coding potential of Gm33055 by Coding‐Non‐Coding Index (CNCI) prediction. (J) The non‐coding potential of Gm33055 by Coding Potential Calculator 2 (CPC2) prediction (** P < 0.01, *** P < 0.001, **** P < 0.0001).

Techniques Used: Derivative Assay, Clinical Proteomics, Expressing, RNA Binding Assay

The relationship between CYP1B1‐AS1, CYP1B1 and AS. (A) Calculation of the Pearson correlation coefficient between CYP1B1 and CYP1B1‐AS1. (B) The CYP1B1 expression levels after knockdown and over‐expression of m‐CYP1B1‐AS1 by immunoblotting analysis. (C) The success of knockdown and over‐expression CYP1B1‐AS1 (m‐CYP1B1‐AS1) in mouse by PCR validation. (D) The subsets and distribution of PTPRC+ CYP1B1+ cells by Dimplot (Seurat). (E) The differentially expressed genes among cell subpopulations (Coloured point: Differentially expressed genes, log 2 FoldChange > 0.25 and adjusted p ‐value < 0.01). (F, G) The differential number of interactions and interaction strength in CellChat (* p < 0.05, *** p < 0.001, **** p < 0.0001).
Figure Legend Snippet: The relationship between CYP1B1‐AS1, CYP1B1 and AS. (A) Calculation of the Pearson correlation coefficient between CYP1B1 and CYP1B1‐AS1. (B) The CYP1B1 expression levels after knockdown and over‐expression of m‐CYP1B1‐AS1 by immunoblotting analysis. (C) The success of knockdown and over‐expression CYP1B1‐AS1 (m‐CYP1B1‐AS1) in mouse by PCR validation. (D) The subsets and distribution of PTPRC+ CYP1B1+ cells by Dimplot (Seurat). (E) The differentially expressed genes among cell subpopulations (Coloured point: Differentially expressed genes, log 2 FoldChange > 0.25 and adjusted p ‐value < 0.01). (F, G) The differential number of interactions and interaction strength in CellChat (* p < 0.05, *** p < 0.001, **** p < 0.0001).

Techniques Used: Expressing, Knockdown, Over Expression, Western Blot, Biomarker Discovery

The expression levels of CD14, TLR‐4 signalling pathway and CYP1B1 by rt‐PCR and Western Blot. (A–F) The transcription levels of Gm33055, CD14, Caspase‐11, Caspase‐1, IL‐1β, and IL‐18 by rt‐PCR. (G) The expression levels of CD14, TLR‐4 signalling molecules, cell death‐related molecules, and CYP1B1 by Western Blot (* p < 0.05, ** p < 0.01, *** p < 0.001, **** p < 0.0001).
Figure Legend Snippet: The expression levels of CD14, TLR‐4 signalling pathway and CYP1B1 by rt‐PCR and Western Blot. (A–F) The transcription levels of Gm33055, CD14, Caspase‐11, Caspase‐1, IL‐1β, and IL‐18 by rt‐PCR. (G) The expression levels of CD14, TLR‐4 signalling molecules, cell death‐related molecules, and CYP1B1 by Western Blot (* p < 0.05, ** p < 0.01, *** p < 0.001, **** p < 0.0001).

Techniques Used: Expressing, Reverse Transcription Polymerase Chain Reaction, Western Blot

The mechanism of CYP1B1‐AS1 on AS. (A) The subcellular localisation of h‐CYP1B1‐AS1 and m‐CYP1B1‐AS1 by fluorescence in situ hybridization (FISH). (B) The transcription factors binding sites in the promoters of human and mouse CYP1B1 and CYP1B1‐AS1 by JASPAR. (C) The common transcription factor binding motif for human and mouse CYP1B1 and CYP1B1‐AS1. (D, E) The levels of DC nuclear proteins after oxPAPC stimulation by TMT mass spectrometry. (F) The levels of nuclear and cytoplasmic NFATc2 before and after oxPAPC stimulation by Western blot (** p < 0.01).
Figure Legend Snippet: The mechanism of CYP1B1‐AS1 on AS. (A) The subcellular localisation of h‐CYP1B1‐AS1 and m‐CYP1B1‐AS1 by fluorescence in situ hybridization (FISH). (B) The transcription factors binding sites in the promoters of human and mouse CYP1B1 and CYP1B1‐AS1 by JASPAR. (C) The common transcription factor binding motif for human and mouse CYP1B1 and CYP1B1‐AS1. (D, E) The levels of DC nuclear proteins after oxPAPC stimulation by TMT mass spectrometry. (F) The levels of nuclear and cytoplasmic NFATc2 before and after oxPAPC stimulation by Western blot (** p < 0.01).

Techniques Used: Fluorescence, In Situ Hybridization, Binding Assay, Mass Spectrometry, Western Blot

The relationship among oxPAPC, NFATC2, and CYP1B1‐AS1. (A–D) The enrichment of NFATC2 before and after oxPAPC stimulation by ChIP‐Seq. (A) The genomic distribution of enriched peaks. (B) The length distribution of enriched peaks. (C) The distribution of reads around transcription start sites. (D) NFATC2 enrichment in the promoter region sites and sequence information of CYP1B1‐AS1. (E) The binding of CYP1B1‐AS1 to NFATC2 by RNA pulldown assay. (F, G) The expression levels of Nfatc2 and CYP1B1‐AS1 in mouse DCs following Nfatc2 knockdown or overexpression were determined by RT‐PCR. (H) The CYP1B1 expression levels after knockdown and overexpression of Nfatc2 by immunoblotting analysis (* P < 0.05, ** P < 0.01, *** P < 0.001).
Figure Legend Snippet: The relationship among oxPAPC, NFATC2, and CYP1B1‐AS1. (A–D) The enrichment of NFATC2 before and after oxPAPC stimulation by ChIP‐Seq. (A) The genomic distribution of enriched peaks. (B) The length distribution of enriched peaks. (C) The distribution of reads around transcription start sites. (D) NFATC2 enrichment in the promoter region sites and sequence information of CYP1B1‐AS1. (E) The binding of CYP1B1‐AS1 to NFATC2 by RNA pulldown assay. (F, G) The expression levels of Nfatc2 and CYP1B1‐AS1 in mouse DCs following Nfatc2 knockdown or overexpression were determined by RT‐PCR. (H) The CYP1B1 expression levels after knockdown and overexpression of Nfatc2 by immunoblotting analysis (* P < 0.05, ** P < 0.01, *** P < 0.001).

Techniques Used: ChIP-sequencing, Sequencing, Binding Assay, Expressing, Knockdown, Over Expression, Reverse Transcription Polymerase Chain Reaction, Western Blot

Related Articles

Incubation:

Article Title: Exploring the role of cytochrome P450 family 1 subfamily B member 1 and quercetin in modulating neuropathic pain after spinal cord injury
Article Snippet: .. The slides were allowed to equilibrate at room temperature for 1 h. Subsequently, 0.5% Triton X-100 permeabilization solution (cat. no. 9036-19-5; Sigma-Aldrich; Merck KGaA) was applied to the sections and incubated at 4°C for 5 min. Ready-to-use goat serum blocking buffer (Beyotime Institute of Biotechnology) was then applied, followed by incubation at room temperature for 1 h. The sections were incubated overnight at 4°C with the following primary antibodies: CYP1B1 (1:100 dilution; cat. no. 18505-1-AP; Proteintech Group, Inc.) and PDGF-D (1:100 dilution; cat. no. 14075-1-AP; Proteintech Group, Inc.). .. Afterward, the sections were stained for 1 h with the following secondary antibodies: Goat anti-mouse IgG H&L (1:500; cat. no. ab150113; Abcam) and goat anti-rabbit IgG H&L (1:500; cat. no. ab150080; Abcam).

Article Title: Machine learning-based identification of kbhb-affected tumor cell subsets as prognostic and therapeutic targets in breast cancer
Article Snippet: .. After blocking, membranes were incubated with primary antibodies against SCGB2A2, LDHB, OCT4, SOX2, c-Myc, KLF4, CPT1A, ACOX1, ANGPTL4, CYP1B1, and β-actin (all from Proteintech) overnight at 4 °C, followed by HRP-conjugated secondary antibody. ..

Article Title: Machine learning-based identification of kbhb-affected tumor cell subsets as prognostic and therapeutic targets in breast cancer.
Article Snippet: .. After blocking, membranes were incubated with primary antibodies against SCGB2A2, LDHB, OCT4, SOX2, c-Myc, KLF4, CPT1A, ACOX1, ANGPTL4, CYP1B1, and β-actin (all from Proteintech) overnight at 4°C, followed by HRP-conjugated secondary antibody. ..

Article Title: Exploring the role of cytochrome P450 family 1 subfamily B member 1 and quercetin in modulating neuropathic pain after spinal cord injury
Article Snippet: Protein concentration was determined using the BCA protein assay kit (cat. no. 23227; Thermo Fisher Scientific, Inc.). .. The protein samples were then transferred to polyvinylidene fluoride membranes, which were subsequently blocked for 1 h at room temperature., washed with TBST solution and incubated with the following primary antibodies: CYP1B1 (1:500; cat. no. 18505-1-AP; Proteintech Group, Inc.), Fibronectin (Fn) (1:1,000; cat. no. ab2413; Abcam) and GAPDH (1:50,000; cat. no. 1E6D9; Proteintech Group, Inc.). ..

Article Title: oxPAPC ‐Mediated lncRNA CYP1B1 ‐ AS1 From Dendritic Cells Accelerates Atherosclerosis
Article Snippet: Following gel electrophoresis, proteins were transferred onto polyvinylidene fluoride membranes (Epizyme, China). .. The membranes were blocked with 5% bovine serum albumin (Epizyme, China) in 1X PBS with Tween‐20 at 20°C–25°C for 2 h and then incubated overnight at 4°C with primary antibodies against GAPDH (HUABIO, ET1601‐4), CD14 (HUABIO, ET1610‐85), TLR4 (Proteintech, 19811‐AP), MyD88 (Abbkine, ABP0102), p65 (HUABIO, ET1603‐12), Cleaved‐Caspase‐1 (CST, 89332), ASC (ImmunoWay, YT0365), NLRP3 (HUABIO, ET1610‐93), ApoB (ImmunoWay, YT7819), and CYP1B1 (Proteintech, 18505‐1‐AP). .. Membranes were then incubated with a secondary antibody at room temperature for 1 h. Protein bands were visualised and detected using a chemiluminescent imaging system (Bio‐Rad, Chemidoc).

Blocking Assay:

Article Title: Exploring the role of cytochrome P450 family 1 subfamily B member 1 and quercetin in modulating neuropathic pain after spinal cord injury
Article Snippet: .. The slides were allowed to equilibrate at room temperature for 1 h. Subsequently, 0.5% Triton X-100 permeabilization solution (cat. no. 9036-19-5; Sigma-Aldrich; Merck KGaA) was applied to the sections and incubated at 4°C for 5 min. Ready-to-use goat serum blocking buffer (Beyotime Institute of Biotechnology) was then applied, followed by incubation at room temperature for 1 h. The sections were incubated overnight at 4°C with the following primary antibodies: CYP1B1 (1:100 dilution; cat. no. 18505-1-AP; Proteintech Group, Inc.) and PDGF-D (1:100 dilution; cat. no. 14075-1-AP; Proteintech Group, Inc.). .. Afterward, the sections were stained for 1 h with the following secondary antibodies: Goat anti-mouse IgG H&L (1:500; cat. no. ab150113; Abcam) and goat anti-rabbit IgG H&L (1:500; cat. no. ab150080; Abcam).

Article Title: Machine learning-based identification of kbhb-affected tumor cell subsets as prognostic and therapeutic targets in breast cancer
Article Snippet: .. After blocking, membranes were incubated with primary antibodies against SCGB2A2, LDHB, OCT4, SOX2, c-Myc, KLF4, CPT1A, ACOX1, ANGPTL4, CYP1B1, and β-actin (all from Proteintech) overnight at 4 °C, followed by HRP-conjugated secondary antibody. ..

Article Title: Machine learning-based identification of kbhb-affected tumor cell subsets as prognostic and therapeutic targets in breast cancer.
Article Snippet: .. After blocking, membranes were incubated with primary antibodies against SCGB2A2, LDHB, OCT4, SOX2, c-Myc, KLF4, CPT1A, ACOX1, ANGPTL4, CYP1B1, and β-actin (all from Proteintech) overnight at 4°C, followed by HRP-conjugated secondary antibody. ..

other:

Article Title: FOXC1 Regulates Cytokine Signaling, Inflammatory Pathways, and Retinoid Metabolism to Maintain Limbal Epithelial Cell Homeostasis In Vitro
Article Snippet: CYP1B1 , Rabbit, polyclonal , 61 kDa , 18505-1-AP, Proteintech, Rosemont, Illinois (IL), USA , 1:250.



Similar Products

94
OriGene b member 1
Graphical abstract. AhR, aryl hydrocarbon receptor; Bmpr2, bone morphogenetic protein receptor type 2; Col4a, collagen, type IV, alpha; <t>Cyp1b1,</t> cytochrome P450 family 1 subfamily B member 1; SOX17, SRY-box transcription factor 17. Created in https://BioRender.com .
B Member 1, supplied by OriGene, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/cyp1b1/Cyp1b1+Mouse+qPCR+Primer+Pair/pmc13201606-64-33-41
Average 94 stars, based on 1 article reviews
b member 1 - by Bioz Stars, 2026-09
94/100 stars
  Buy from Supplier

95
Thermo Fisher gene exp cyp1b1 mm00487229 m1
Graphical abstract. AhR, aryl hydrocarbon receptor; Bmpr2, bone morphogenetic protein receptor type 2; Col4a, collagen, type IV, alpha; <t>Cyp1b1,</t> cytochrome P450 family 1 subfamily B member 1; SOX17, SRY-box transcription factor 17. Created in https://BioRender.com .
Gene Exp Cyp1b1 Mm00487229 M1, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 95/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/cyp1b1/Gene+Exp%2E+Cyp1b1%2C+Mm00487229_m1/pmc13018597-208-55-36
Average 95 stars, based on 1 article reviews
gene exp cyp1b1 mm00487229 m1 - by Bioz Stars, 2026-09
95/100 stars
  Buy from Supplier

93
novus biologicals NBP2-24722
Graphical abstract. AhR, aryl hydrocarbon receptor; Bmpr2, bone morphogenetic protein receptor type 2; Col4a, collagen, type IV, alpha; <t>Cyp1b1,</t> cytochrome P450 family 1 subfamily B member 1; SOX17, SRY-box transcription factor 17. Created in https://BioRender.com .
Nbp2 24722, supplied by novus biologicals, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/cyp1b1/CYP1B1+Antibody/pmc12946850-6-0-2
Average 93 stars, based on 1 article reviews
NBP2-24722 - by Bioz Stars, 2026-09
93/100 stars
  Buy from Supplier

93
Novus Biologicals novus biologicals nbp2 24722
Graphical abstract. AhR, aryl hydrocarbon receptor; Bmpr2, bone morphogenetic protein receptor type 2; Col4a, collagen, type IV, alpha; <t>Cyp1b1,</t> cytochrome P450 family 1 subfamily B member 1; SOX17, SRY-box transcription factor 17. Created in https://BioRender.com .
Novus Biologicals Nbp2 24722, supplied by Novus Biologicals, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/cyp1b1/CYP1B1+Antibody/pmc12946850-6-2-2
Average 93 stars, based on 1 article reviews
novus biologicals nbp2 24722 - by Bioz Stars, 2026-09
93/100 stars
  Buy from Supplier

95
Proteintech cyp1b1
The screening and evaluation of DC‐derived lncRNA. (A, B) The plasma levels of oxPAPC and IL‐1β in CHD. (C) The up‐regulated lncRNAs under various oxPAPC stimuli. (D) The down‐regulated lncRNAs under various oxPAPC stimuli. (E) The expression level of the ENST00000628135 <t>(CYP1B1‐AS1).</t> (F) The genomic localisation of mouse for Gm33055 and CYP1B1‐AS1 by Integrative Genomics Viewer (IGV). (G) The genomic localisation of human for Gm33055 and CYP1B1‐AS1 by IGV. (H) The intersection of Gm33055 and RNA‐binding proteins in the promoter region of CYP1B1‐AS1 by RBP map analysis. (I) The non‐coding potential of Gm33055 by Coding‐Non‐Coding Index (CNCI) prediction. (J) The non‐coding potential of Gm33055 by Coding Potential Calculator 2 (CPC2) prediction (** P < 0.01, *** P < 0.001, **** P < 0.0001).
Cyp1b1, supplied by Proteintech, used in various techniques. Bioz Stars score: 95/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/cyp1b1/CYP1B1+Antibody/pmc12948649-121-59-60
Average 95 stars, based on 1 article reviews
cyp1b1 - by Bioz Stars, 2026-09
95/100 stars
  Buy from Supplier

95
Proteintech rabbit
The screening and evaluation of DC‐derived lncRNA. (A, B) The plasma levels of oxPAPC and IL‐1β in CHD. (C) The up‐regulated lncRNAs under various oxPAPC stimuli. (D) The down‐regulated lncRNAs under various oxPAPC stimuli. (E) The expression level of the ENST00000628135 <t>(CYP1B1‐AS1).</t> (F) The genomic localisation of mouse for Gm33055 and CYP1B1‐AS1 by Integrative Genomics Viewer (IGV). (G) The genomic localisation of human for Gm33055 and CYP1B1‐AS1 by IGV. (H) The intersection of Gm33055 and RNA‐binding proteins in the promoter region of CYP1B1‐AS1 by RBP map analysis. (I) The non‐coding potential of Gm33055 by Coding‐Non‐Coding Index (CNCI) prediction. (J) The non‐coding potential of Gm33055 by Coding Potential Calculator 2 (CPC2) prediction (** P < 0.01, *** P < 0.001, **** P < 0.0001).
Rabbit, supplied by Proteintech, used in various techniques. Bioz Stars score: 95/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/cyp1b1/CYP1B1+Antibody/pmc12940945-42-2-9
Average 95 stars, based on 1 article reviews
rabbit - by Bioz Stars, 2026-09
95/100 stars
  Buy from Supplier

95
Proteintech 18505 1 ap
The screening and evaluation of DC‐derived lncRNA. (A, B) The plasma levels of oxPAPC and IL‐1β in CHD. (C) The up‐regulated lncRNAs under various oxPAPC stimuli. (D) The down‐regulated lncRNAs under various oxPAPC stimuli. (E) The expression level of the ENST00000628135 <t>(CYP1B1‐AS1).</t> (F) The genomic localisation of mouse for Gm33055 and CYP1B1‐AS1 by Integrative Genomics Viewer (IGV). (G) The genomic localisation of human for Gm33055 and CYP1B1‐AS1 by IGV. (H) The intersection of Gm33055 and RNA‐binding proteins in the promoter region of CYP1B1‐AS1 by RBP map analysis. (I) The non‐coding potential of Gm33055 by Coding‐Non‐Coding Index (CNCI) prediction. (J) The non‐coding potential of Gm33055 by Coding Potential Calculator 2 (CPC2) prediction (** P < 0.01, *** P < 0.001, **** P < 0.0001).
18505 1 Ap, supplied by Proteintech, used in various techniques. Bioz Stars score: 95/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/cyp1b1/CYP1B1+Antibody/pmc12940945-42-8-9
Average 95 stars, based on 1 article reviews
18505 1 ap - by Bioz Stars, 2026-09
95/100 stars
  Buy from Supplier

Image Search Results


Graphical abstract. AhR, aryl hydrocarbon receptor; Bmpr2, bone morphogenetic protein receptor type 2; Col4a, collagen, type IV, alpha; Cyp1b1, cytochrome P450 family 1 subfamily B member 1; SOX17, SRY-box transcription factor 17. Created in https://BioRender.com .

Journal: Scientific Reports

Article Title: Experimental pulmonary arterial hypertension in mice with a pathogenic SOX17 variant

doi: 10.1038/s41598-026-46893-0

Figure Lengend Snippet: Graphical abstract. AhR, aryl hydrocarbon receptor; Bmpr2, bone morphogenetic protein receptor type 2; Col4a, collagen, type IV, alpha; Cyp1b1, cytochrome P450 family 1 subfamily B member 1; SOX17, SRY-box transcription factor 17. Created in https://BioRender.com .

Article Snippet: The primers used were as follows: F: TGCACCACCAACTGCTTAG and R: GGATGCAGGGATGATGTTC for glyceraldehyde-3-phosphate dehydrogenase ( Gapdh ) as an endogenous control gene; F: GCCACTATTACGGACATCTTCGG and R: ACAACCTGGTCCAACTCAGCCT for cytochrome P450 family 1 subfamily B member 1 ( Cyp1b1 ) (SKU MP203248, ORIGENE, MD, USA); F: AAGCTGCTGGAGCTGATTGG and R: AACTGGACGCTCATCCAAGG for Bmpr2 ; F: CTGGCACAAAAGGGACGAG and R: ACGTGGCCGAGAATTTCACC for collagen , type IV , alpha 1 ( Col4a1 ) ; and F: CCCGGATCTGTACAAGGGTG and R: TGATGCCTTCCTCGCCTTTT for collagen , type IV , alpha 2 ( Col4a2 ) .

Techniques:

The screening and evaluation of DC‐derived lncRNA. (A, B) The plasma levels of oxPAPC and IL‐1β in CHD. (C) The up‐regulated lncRNAs under various oxPAPC stimuli. (D) The down‐regulated lncRNAs under various oxPAPC stimuli. (E) The expression level of the ENST00000628135 (CYP1B1‐AS1). (F) The genomic localisation of mouse for Gm33055 and CYP1B1‐AS1 by Integrative Genomics Viewer (IGV). (G) The genomic localisation of human for Gm33055 and CYP1B1‐AS1 by IGV. (H) The intersection of Gm33055 and RNA‐binding proteins in the promoter region of CYP1B1‐AS1 by RBP map analysis. (I) The non‐coding potential of Gm33055 by Coding‐Non‐Coding Index (CNCI) prediction. (J) The non‐coding potential of Gm33055 by Coding Potential Calculator 2 (CPC2) prediction (** P < 0.01, *** P < 0.001, **** P < 0.0001).

Journal: Journal of Cellular and Molecular Medicine

Article Title: oxPAPC ‐Mediated lncRNA CYP1B1 ‐ AS1 From Dendritic Cells Accelerates Atherosclerosis

doi: 10.1111/jcmm.71066

Figure Lengend Snippet: The screening and evaluation of DC‐derived lncRNA. (A, B) The plasma levels of oxPAPC and IL‐1β in CHD. (C) The up‐regulated lncRNAs under various oxPAPC stimuli. (D) The down‐regulated lncRNAs under various oxPAPC stimuli. (E) The expression level of the ENST00000628135 (CYP1B1‐AS1). (F) The genomic localisation of mouse for Gm33055 and CYP1B1‐AS1 by Integrative Genomics Viewer (IGV). (G) The genomic localisation of human for Gm33055 and CYP1B1‐AS1 by IGV. (H) The intersection of Gm33055 and RNA‐binding proteins in the promoter region of CYP1B1‐AS1 by RBP map analysis. (I) The non‐coding potential of Gm33055 by Coding‐Non‐Coding Index (CNCI) prediction. (J) The non‐coding potential of Gm33055 by Coding Potential Calculator 2 (CPC2) prediction (** P < 0.01, *** P < 0.001, **** P < 0.0001).

Article Snippet: The membranes were blocked with 5% bovine serum albumin (Epizyme, China) in 1X PBS with Tween‐20 at 20°C–25°C for 2 h and then incubated overnight at 4°C with primary antibodies against GAPDH (HUABIO, ET1601‐4), CD14 (HUABIO, ET1610‐85), TLR4 (Proteintech, 19811‐AP), MyD88 (Abbkine, ABP0102), p65 (HUABIO, ET1603‐12), Cleaved‐Caspase‐1 (CST, 89332), ASC (ImmunoWay, YT0365), NLRP3 (HUABIO, ET1610‐93), ApoB (ImmunoWay, YT7819), and CYP1B1 (Proteintech, 18505‐1‐AP).

Techniques: Derivative Assay, Clinical Proteomics, Expressing, RNA Binding Assay

The relationship between CYP1B1‐AS1, CYP1B1 and AS. (A) Calculation of the Pearson correlation coefficient between CYP1B1 and CYP1B1‐AS1. (B) The CYP1B1 expression levels after knockdown and over‐expression of m‐CYP1B1‐AS1 by immunoblotting analysis. (C) The success of knockdown and over‐expression CYP1B1‐AS1 (m‐CYP1B1‐AS1) in mouse by PCR validation. (D) The subsets and distribution of PTPRC+ CYP1B1+ cells by Dimplot (Seurat). (E) The differentially expressed genes among cell subpopulations (Coloured point: Differentially expressed genes, log 2 FoldChange > 0.25 and adjusted p ‐value < 0.01). (F, G) The differential number of interactions and interaction strength in CellChat (* p < 0.05, *** p < 0.001, **** p < 0.0001).

Journal: Journal of Cellular and Molecular Medicine

Article Title: oxPAPC ‐Mediated lncRNA CYP1B1 ‐ AS1 From Dendritic Cells Accelerates Atherosclerosis

doi: 10.1111/jcmm.71066

Figure Lengend Snippet: The relationship between CYP1B1‐AS1, CYP1B1 and AS. (A) Calculation of the Pearson correlation coefficient between CYP1B1 and CYP1B1‐AS1. (B) The CYP1B1 expression levels after knockdown and over‐expression of m‐CYP1B1‐AS1 by immunoblotting analysis. (C) The success of knockdown and over‐expression CYP1B1‐AS1 (m‐CYP1B1‐AS1) in mouse by PCR validation. (D) The subsets and distribution of PTPRC+ CYP1B1+ cells by Dimplot (Seurat). (E) The differentially expressed genes among cell subpopulations (Coloured point: Differentially expressed genes, log 2 FoldChange > 0.25 and adjusted p ‐value < 0.01). (F, G) The differential number of interactions and interaction strength in CellChat (* p < 0.05, *** p < 0.001, **** p < 0.0001).

Article Snippet: The membranes were blocked with 5% bovine serum albumin (Epizyme, China) in 1X PBS with Tween‐20 at 20°C–25°C for 2 h and then incubated overnight at 4°C with primary antibodies against GAPDH (HUABIO, ET1601‐4), CD14 (HUABIO, ET1610‐85), TLR4 (Proteintech, 19811‐AP), MyD88 (Abbkine, ABP0102), p65 (HUABIO, ET1603‐12), Cleaved‐Caspase‐1 (CST, 89332), ASC (ImmunoWay, YT0365), NLRP3 (HUABIO, ET1610‐93), ApoB (ImmunoWay, YT7819), and CYP1B1 (Proteintech, 18505‐1‐AP).

Techniques: Expressing, Knockdown, Over Expression, Western Blot, Biomarker Discovery

The expression levels of CD14, TLR‐4 signalling pathway and CYP1B1 by rt‐PCR and Western Blot. (A–F) The transcription levels of Gm33055, CD14, Caspase‐11, Caspase‐1, IL‐1β, and IL‐18 by rt‐PCR. (G) The expression levels of CD14, TLR‐4 signalling molecules, cell death‐related molecules, and CYP1B1 by Western Blot (* p < 0.05, ** p < 0.01, *** p < 0.001, **** p < 0.0001).

Journal: Journal of Cellular and Molecular Medicine

Article Title: oxPAPC ‐Mediated lncRNA CYP1B1 ‐ AS1 From Dendritic Cells Accelerates Atherosclerosis

doi: 10.1111/jcmm.71066

Figure Lengend Snippet: The expression levels of CD14, TLR‐4 signalling pathway and CYP1B1 by rt‐PCR and Western Blot. (A–F) The transcription levels of Gm33055, CD14, Caspase‐11, Caspase‐1, IL‐1β, and IL‐18 by rt‐PCR. (G) The expression levels of CD14, TLR‐4 signalling molecules, cell death‐related molecules, and CYP1B1 by Western Blot (* p < 0.05, ** p < 0.01, *** p < 0.001, **** p < 0.0001).

Article Snippet: The membranes were blocked with 5% bovine serum albumin (Epizyme, China) in 1X PBS with Tween‐20 at 20°C–25°C for 2 h and then incubated overnight at 4°C with primary antibodies against GAPDH (HUABIO, ET1601‐4), CD14 (HUABIO, ET1610‐85), TLR4 (Proteintech, 19811‐AP), MyD88 (Abbkine, ABP0102), p65 (HUABIO, ET1603‐12), Cleaved‐Caspase‐1 (CST, 89332), ASC (ImmunoWay, YT0365), NLRP3 (HUABIO, ET1610‐93), ApoB (ImmunoWay, YT7819), and CYP1B1 (Proteintech, 18505‐1‐AP).

Techniques: Expressing, Reverse Transcription Polymerase Chain Reaction, Western Blot

The mechanism of CYP1B1‐AS1 on AS. (A) The subcellular localisation of h‐CYP1B1‐AS1 and m‐CYP1B1‐AS1 by fluorescence in situ hybridization (FISH). (B) The transcription factors binding sites in the promoters of human and mouse CYP1B1 and CYP1B1‐AS1 by JASPAR. (C) The common transcription factor binding motif for human and mouse CYP1B1 and CYP1B1‐AS1. (D, E) The levels of DC nuclear proteins after oxPAPC stimulation by TMT mass spectrometry. (F) The levels of nuclear and cytoplasmic NFATc2 before and after oxPAPC stimulation by Western blot (** p < 0.01).

Journal: Journal of Cellular and Molecular Medicine

Article Title: oxPAPC ‐Mediated lncRNA CYP1B1 ‐ AS1 From Dendritic Cells Accelerates Atherosclerosis

doi: 10.1111/jcmm.71066

Figure Lengend Snippet: The mechanism of CYP1B1‐AS1 on AS. (A) The subcellular localisation of h‐CYP1B1‐AS1 and m‐CYP1B1‐AS1 by fluorescence in situ hybridization (FISH). (B) The transcription factors binding sites in the promoters of human and mouse CYP1B1 and CYP1B1‐AS1 by JASPAR. (C) The common transcription factor binding motif for human and mouse CYP1B1 and CYP1B1‐AS1. (D, E) The levels of DC nuclear proteins after oxPAPC stimulation by TMT mass spectrometry. (F) The levels of nuclear and cytoplasmic NFATc2 before and after oxPAPC stimulation by Western blot (** p < 0.01).

Article Snippet: The membranes were blocked with 5% bovine serum albumin (Epizyme, China) in 1X PBS with Tween‐20 at 20°C–25°C for 2 h and then incubated overnight at 4°C with primary antibodies against GAPDH (HUABIO, ET1601‐4), CD14 (HUABIO, ET1610‐85), TLR4 (Proteintech, 19811‐AP), MyD88 (Abbkine, ABP0102), p65 (HUABIO, ET1603‐12), Cleaved‐Caspase‐1 (CST, 89332), ASC (ImmunoWay, YT0365), NLRP3 (HUABIO, ET1610‐93), ApoB (ImmunoWay, YT7819), and CYP1B1 (Proteintech, 18505‐1‐AP).

Techniques: Fluorescence, In Situ Hybridization, Binding Assay, Mass Spectrometry, Western Blot

The relationship among oxPAPC, NFATC2, and CYP1B1‐AS1. (A–D) The enrichment of NFATC2 before and after oxPAPC stimulation by ChIP‐Seq. (A) The genomic distribution of enriched peaks. (B) The length distribution of enriched peaks. (C) The distribution of reads around transcription start sites. (D) NFATC2 enrichment in the promoter region sites and sequence information of CYP1B1‐AS1. (E) The binding of CYP1B1‐AS1 to NFATC2 by RNA pulldown assay. (F, G) The expression levels of Nfatc2 and CYP1B1‐AS1 in mouse DCs following Nfatc2 knockdown or overexpression were determined by RT‐PCR. (H) The CYP1B1 expression levels after knockdown and overexpression of Nfatc2 by immunoblotting analysis (* P < 0.05, ** P < 0.01, *** P < 0.001).

Journal: Journal of Cellular and Molecular Medicine

Article Title: oxPAPC ‐Mediated lncRNA CYP1B1 ‐ AS1 From Dendritic Cells Accelerates Atherosclerosis

doi: 10.1111/jcmm.71066

Figure Lengend Snippet: The relationship among oxPAPC, NFATC2, and CYP1B1‐AS1. (A–D) The enrichment of NFATC2 before and after oxPAPC stimulation by ChIP‐Seq. (A) The genomic distribution of enriched peaks. (B) The length distribution of enriched peaks. (C) The distribution of reads around transcription start sites. (D) NFATC2 enrichment in the promoter region sites and sequence information of CYP1B1‐AS1. (E) The binding of CYP1B1‐AS1 to NFATC2 by RNA pulldown assay. (F, G) The expression levels of Nfatc2 and CYP1B1‐AS1 in mouse DCs following Nfatc2 knockdown or overexpression were determined by RT‐PCR. (H) The CYP1B1 expression levels after knockdown and overexpression of Nfatc2 by immunoblotting analysis (* P < 0.05, ** P < 0.01, *** P < 0.001).

Article Snippet: The membranes were blocked with 5% bovine serum albumin (Epizyme, China) in 1X PBS with Tween‐20 at 20°C–25°C for 2 h and then incubated overnight at 4°C with primary antibodies against GAPDH (HUABIO, ET1601‐4), CD14 (HUABIO, ET1610‐85), TLR4 (Proteintech, 19811‐AP), MyD88 (Abbkine, ABP0102), p65 (HUABIO, ET1603‐12), Cleaved‐Caspase‐1 (CST, 89332), ASC (ImmunoWay, YT0365), NLRP3 (HUABIO, ET1610‐93), ApoB (ImmunoWay, YT7819), and CYP1B1 (Proteintech, 18505‐1‐AP).

Techniques: ChIP-sequencing, Sequencing, Binding Assay, Expressing, Knockdown, Over Expression, Reverse Transcription Polymerase Chain Reaction, Western Blot