Review



cygb  (Proteintech)


Bioz Verified Symbol Proteintech is a verified supplier  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
    • 93
      Buy from Supplier

    Structured Review

    Proteintech cygb
    Fig. 5 <t>CYGB</t> combined TFR to regulate ferroptosis. (A) Western blotting analysis of FLAG-CYGB-overexpression in HCT116 and SW620. (B) The immunoprecipitation and immunoblotting were per- formed using FLAG-CYGB and <t>TFR</t> <t>antibodies</t> in HCT116. (C) Co-localization of TFR and FLAG-CYGB in HCT116 cells based on immunofluorescence staining
    Cygb, supplied by Proteintech, used in various techniques. Bioz Stars score: 93/100, based on 11 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/cygb/pm39503803-59-54-58?v=Proteintech
    Average 93 stars, based on 11 article reviews
    cygb - by Bioz Stars, 2026-07
    93/100 stars

    Images

    1) Product Images from "Cytoglobin augments ferroptosis through autophagic degradation of ferritin in colorectal cancer cells."

    Article Title: Cytoglobin augments ferroptosis through autophagic degradation of ferritin in colorectal cancer cells.

    Journal: Molecular and cellular biochemistry

    doi: 10.1007/s11010-024-05148-0

    Fig. 5 CYGB combined TFR to regulate ferroptosis. (A) Western blotting analysis of FLAG-CYGB-overexpression in HCT116 and SW620. (B) The immunoprecipitation and immunoblotting were per- formed using FLAG-CYGB and TFR antibodies in HCT116. (C) Co-localization of TFR and FLAG-CYGB in HCT116 cells based on immunofluorescence staining
    Figure Legend Snippet: Fig. 5 CYGB combined TFR to regulate ferroptosis. (A) Western blotting analysis of FLAG-CYGB-overexpression in HCT116 and SW620. (B) The immunoprecipitation and immunoblotting were per- formed using FLAG-CYGB and TFR antibodies in HCT116. (C) Co-localization of TFR and FLAG-CYGB in HCT116 cells based on immunofluorescence staining

    Techniques Used: Western Blot, Over Expression, Immunoprecipitation, Immunofluorescence, Staining



    Similar Products

    cygb cdna sequence  (Twist Bioscience)
    86
    Twist Bioscience cygb cdna sequence
    Cygb Cdna Sequence, supplied by Twist Bioscience, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/cygb/10__3390_slash_cosmetics12050230-66-1-12?v=Twist+Bioscience
    Average 86 stars, based on 1 article reviews
    cygb cdna sequence - by Bioz Stars, 2026-07
    86/100 stars
    		  Buy from Supplier
    antibodies against cygb  (Santa Cruz Biotechnology)
    93
    Santa Cruz Biotechnology antibodies against cygb
    Antibodies Against Cygb, supplied by Santa Cruz Biotechnology, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/cygb/pmc12531289-57-16-20?v=Santa+Cruz+Biotechnology
    Average 93 stars, based on 1 article reviews
    antibodies against cygb - by Bioz Stars, 2026-07
    93/100 stars
    		  Buy from Supplier
    cygb elisa kit mbs2890631  (MyBiosource Biotechnology)
    90
    MyBiosource Biotechnology cygb elisa kit mbs2890631
    Cygb Elisa Kit Mbs2890631, supplied by MyBiosource Biotechnology, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/cygb/10__18585_slash_inabj__v17i2__3519-77-31-35?v=MyBiosource+Biotechnology
    Average 90 stars, based on 1 article reviews
    cygb elisa kit mbs2890631 - by Bioz Stars, 2026-07
    90/100 stars
    		  Buy from Supplier
    rabbit polyclonal anti-cygb  (Thermo Fisher)
    90
    Thermo Fisher rabbit polyclonal anti-cygb
    Rabbit Polyclonal Anti Cygb, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/cygb/pm39743029-99-11-12?v=Thermo+Fisher
    Average 90 stars, based on 1 article reviews
    rabbit polyclonal anti-cygb - by Bioz Stars, 2026-07
    90/100 stars
    		  Buy from Supplier
    cygb sirna  (Santa Cruz Biotechnology)
    92
    Santa Cruz Biotechnology cygb sirna
    Cygb Sirna, supplied by Santa Cruz Biotechnology, used in various techniques. Bioz Stars score: 92/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/cygb/pm39743029-87-5-8?v=Santa+Cruz+Biotechnology
    Average 92 stars, based on 1 article reviews
    cygb sirna - by Bioz Stars, 2026-07
    92/100 stars
    		  Buy from Supplier
    lentivirus carrying the cygb cds (protein coding region) or short hairpin rna (shrna) sequences (ctcaacactgtcgtggagaacctgcatga)  (Genechem)
    90
    Genechem lentivirus carrying the cygb cds (protein coding region) or short hairpin rna (shrna) sequences (ctcaacactgtcgtggagaacctgcatga)
    Lentivirus Carrying The Cygb Cds (Protein Coding Region) Or Short Hairpin Rna (Shrna) Sequences (Ctcaacactgtcgtggagaacctgcatga), supplied by Genechem, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/cygb/pmc11465429-36-9-41?v=Genechem
    Average 90 stars, based on 1 article reviews
    lentivirus carrying the cygb cds (protein coding region) or short hairpin rna (shrna) sequences (ctcaacactgtcgtggagaacctgcatga) - by Bioz Stars, 2026-07
    90/100 stars
    		  Buy from Supplier
    cygb  (Proteintech)
    93
    Proteintech cygb
    Fig. 5 <t>CYGB</t> combined TFR to regulate ferroptosis. (A) Western blotting analysis of FLAG-CYGB-overexpression in HCT116 and SW620. (B) The immunoprecipitation and immunoblotting were per- formed using FLAG-CYGB and <t>TFR</t> <t>antibodies</t> in HCT116. (C) Co-localization of TFR and FLAG-CYGB in HCT116 cells based on immunofluorescence staining
    Cygb, supplied by Proteintech, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/cygb/pm39503803-59-54-58?v=Proteintech
    Average 93 stars, based on 1 article reviews
    cygb - by Bioz Stars, 2026-07
    93/100 stars
    		  Buy from Supplier
    blotting with cygb  (Proteintech)
    96
    Proteintech blotting with cygb
    Fig. 5 <t>CYGB</t> combined TFR to regulate ferroptosis. (A) <t>Western</t> <t>blotting</t> analysis of FLAG-CYGB-overexpression in HCT116 and SW620. (B) The immunoprecipitation and immunoblotting were per- formed using FLAG-CYGB and TFR antibodies in HCT116. (C) Co-localization of TFR and FLAG-CYGB in HCT116 cells based on immunofluorescence staining
    Blotting With Cygb, supplied by Proteintech, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/cygb/pm39503803-82-6-12?v=Proteintech
    Average 96 stars, based on 1 article reviews
    blotting with cygb - by Bioz Stars, 2026-07
    96/100 stars
    		  Buy from Supplier

    Image Search Results


    Fig. 5 CYGB combined TFR to regulate ferroptosis. (A) Western blotting analysis of FLAG-CYGB-overexpression in HCT116 and SW620. (B) The immunoprecipitation and immunoblotting were per- formed using FLAG-CYGB and TFR antibodies in HCT116. (C) Co-localization of TFR and FLAG-CYGB in HCT116 cells based on immunofluorescence staining

    Journal: Molecular and cellular biochemistry

    Article Title: Cytoglobin augments ferroptosis through autophagic degradation of ferritin in colorectal cancer cells.

    doi: 10.1007/s11010-024-05148-0

    Figure Lengend Snippet: Fig. 5 CYGB combined TFR to regulate ferroptosis. (A) Western blotting analysis of FLAG-CYGB-overexpression in HCT116 and SW620. (B) The immunoprecipitation and immunoblotting were per- formed using FLAG-CYGB and TFR antibodies in HCT116. (C) Co-localization of TFR and FLAG-CYGB in HCT116 cells based on immunofluorescence staining

    Article Snippet: The separated proteins were separated in a 10% gel through sodium dodecyl sulfate–polyacrylamide gel electrophoresis and then transferred onto polyvinylidene difluoride membranes, blocked in 0.3% Tris-buffered saline with Tween 20 solution containing 5% nonfat dry milk, and further incubated with the primary antibodies LC3B (1:1000 dilution, #3868; Cell Signaling), β-Actin (1:20000 dilution, AC026; ABclonal), CYGB (1:1000 dilution, 60228-1-Ig; Proteintech), DDDDKTag (1:1000 dilution, HT201; TransGen), NCOA4 (1:1000 dilution, A5695; ABclonal), TFR (1:1000 dilution, #13113; Cell Signaling), FTH (1:1000 dilution, A19544; ABclonal), FTL (1:2000 dilution, A11241; ABclonal), PCBP1 (1:1000 dilution, A22141; ABclonal) and ACSL4 (1:1000 dilution, A20414; ABclonal).

    Techniques: Western Blot, Over Expression, Immunoprecipitation, Immunofluorescence, Staining

    Fig. 5 CYGB combined TFR to regulate ferroptosis. (A) Western blotting analysis of FLAG-CYGB-overexpression in HCT116 and SW620. (B) The immunoprecipitation and immunoblotting were per- formed using FLAG-CYGB and TFR antibodies in HCT116. (C) Co-localization of TFR and FLAG-CYGB in HCT116 cells based on immunofluorescence staining

    Journal: Molecular and cellular biochemistry

    Article Title: Cytoglobin augments ferroptosis through autophagic degradation of ferritin in colorectal cancer cells.

    doi: 10.1007/s11010-024-05148-0

    Figure Lengend Snippet: Fig. 5 CYGB combined TFR to regulate ferroptosis. (A) Western blotting analysis of FLAG-CYGB-overexpression in HCT116 and SW620. (B) The immunoprecipitation and immunoblotting were per- formed using FLAG-CYGB and TFR antibodies in HCT116. (C) Co-localization of TFR and FLAG-CYGB in HCT116 cells based on immunofluorescence staining

    Article Snippet: The supernatant was collected for western blotting with CYGB (1:1000 dilution, 60228; Proteintech) and TFR (1:1000 dilution, #13113; Cell Signaling).

    Techniques: Western Blot, Over Expression, Immunoprecipitation, Immunofluorescence, Staining