Review




Structured Review

Proteintech cygb
Fig. 5 <t>CYGB</t> combined TFR to regulate ferroptosis. (A) Western blotting analysis of FLAG-CYGB-overexpression in HCT116 and SW620. (B) The immunoprecipitation and immunoblotting were per- formed using FLAG-CYGB and <t>TFR</t> <t>antibodies</t> in HCT116. (C) Co-localization of TFR and FLAG-CYGB in HCT116 cells based on immunofluorescence staining
Cygb, supplied by Proteintech, used in various techniques. Bioz Stars score: 93/100, based on 11 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/cygb/Cytoglobin+Antibody/pm39503803-59-54-58
Average 93 stars, based on 11 article reviews
cygb - by Bioz Stars, 2026-09
93/100 stars

Images

1) Product Images from "Cytoglobin augments ferroptosis through autophagic degradation of ferritin in colorectal cancer cells."

Article Title: Cytoglobin augments ferroptosis through autophagic degradation of ferritin in colorectal cancer cells.

Journal: Molecular and cellular biochemistry

doi: 10.1007/s11010-024-05148-0

Fig. 5 CYGB combined TFR to regulate ferroptosis. (A) Western blotting analysis of FLAG-CYGB-overexpression in HCT116 and SW620. (B) The immunoprecipitation and immunoblotting were per- formed using FLAG-CYGB and TFR antibodies in HCT116. (C) Co-localization of TFR and FLAG-CYGB in HCT116 cells based on immunofluorescence staining
Figure Legend Snippet: Fig. 5 CYGB combined TFR to regulate ferroptosis. (A) Western blotting analysis of FLAG-CYGB-overexpression in HCT116 and SW620. (B) The immunoprecipitation and immunoblotting were per- formed using FLAG-CYGB and TFR antibodies in HCT116. (C) Co-localization of TFR and FLAG-CYGB in HCT116 cells based on immunofluorescence staining

Techniques Used: Western Blot, Over Expression, Immunoprecipitation, Immunofluorescence, Staining



Similar Products

86
Twist Bioscience cygb cdna sequence
Cygb Cdna Sequence, supplied by Twist Bioscience, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/cygb/coding+sequences+synthetic/10__3390_slash_cosmetics12050230-66-1-12
Average 86 stars, based on 1 article reviews
cygb cdna sequence - by Bioz Stars, 2026-09
86/100 stars
  Buy from Supplier

93
Santa Cruz Biotechnology antibodies against cygb
Antibodies Against Cygb, supplied by Santa Cruz Biotechnology, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/cygb/cytoglobin+Antibody/pmc12531289-57-16-20
Average 93 stars, based on 1 article reviews
antibodies against cygb - by Bioz Stars, 2026-09
93/100 stars
  Buy from Supplier

90
MyBiosource Biotechnology cygb elisa kit mbs2890631
Cygb Elisa Kit Mbs2890631, supplied by MyBiosource Biotechnology, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/cygb/elisa+kit/10__18585_slash_inabj__v17i2__3519-77-31-35
Average 90 stars, based on 1 article reviews
cygb elisa kit mbs2890631 - by Bioz Stars, 2026-09
90/100 stars
  Buy from Supplier

90
Thermo Fisher rabbit polyclonal anti-cygb
Rabbit Polyclonal Anti Cygb, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/cygb/pm39743029-99-11-12
Average 90 stars, based on 1 article reviews
rabbit polyclonal anti-cygb - by Bioz Stars, 2026-09
90/100 stars
  Buy from Supplier

92
Santa Cruz Biotechnology cygb sirna
Cygb Sirna, supplied by Santa Cruz Biotechnology, used in various techniques. Bioz Stars score: 92/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/cygb/cytoglobin+siRNA/pm39743029-87-5-8
Average 92 stars, based on 1 article reviews
cygb sirna - by Bioz Stars, 2026-09
92/100 stars
  Buy from Supplier

90
Genechem lentivirus carrying the cygb cds (protein coding region) or short hairpin rna (shrna) sequences (ctcaacactgtcgtggagaacctgcatga)
Lentivirus Carrying The Cygb Cds (Protein Coding Region) Or Short Hairpin Rna (Shrna) Sequences (Ctcaacactgtcgtggagaacctgcatga), supplied by Genechem, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/cygb/lentivirus+carrying+cygb+cds++protein+coding+region++fused+flag/pmc11465429-36-9-41
Average 90 stars, based on 1 article reviews
lentivirus carrying the cygb cds (protein coding region) or short hairpin rna (shrna) sequences (ctcaacactgtcgtggagaacctgcatga) - by Bioz Stars, 2026-09
90/100 stars
  Buy from Supplier

93
Proteintech cygb
Fig. 5 <t>CYGB</t> combined TFR to regulate ferroptosis. (A) Western blotting analysis of FLAG-CYGB-overexpression in HCT116 and SW620. (B) The immunoprecipitation and immunoblotting were per- formed using FLAG-CYGB and <t>TFR</t> <t>antibodies</t> in HCT116. (C) Co-localization of TFR and FLAG-CYGB in HCT116 cells based on immunofluorescence staining
Cygb, supplied by Proteintech, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/cygb/Cytoglobin+Antibody/pm39503803-59-54-58
Average 93 stars, based on 1 article reviews
cygb - by Bioz Stars, 2026-09
93/100 stars
  Buy from Supplier

96
Proteintech blotting with cygb
Fig. 5 <t>CYGB</t> combined TFR to regulate ferroptosis. (A) <t>Western</t> <t>blotting</t> analysis of FLAG-CYGB-overexpression in HCT116 and SW620. (B) The immunoprecipitation and immunoblotting were per- formed using FLAG-CYGB and TFR antibodies in HCT116. (C) Co-localization of TFR and FLAG-CYGB in HCT116 cells based on immunofluorescence staining
Blotting With Cygb, supplied by Proteintech, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/cygb/CD71+Antibody/pm39503803-82-6-12
Average 96 stars, based on 1 article reviews
blotting with cygb - by Bioz Stars, 2026-09
96/100 stars
  Buy from Supplier

Image Search Results


Fig. 5 CYGB combined TFR to regulate ferroptosis. (A) Western blotting analysis of FLAG-CYGB-overexpression in HCT116 and SW620. (B) The immunoprecipitation and immunoblotting were per- formed using FLAG-CYGB and TFR antibodies in HCT116. (C) Co-localization of TFR and FLAG-CYGB in HCT116 cells based on immunofluorescence staining

Journal: Molecular and cellular biochemistry

Article Title: Cytoglobin augments ferroptosis through autophagic degradation of ferritin in colorectal cancer cells.

doi: 10.1007/s11010-024-05148-0

Figure Lengend Snippet: Fig. 5 CYGB combined TFR to regulate ferroptosis. (A) Western blotting analysis of FLAG-CYGB-overexpression in HCT116 and SW620. (B) The immunoprecipitation and immunoblotting were per- formed using FLAG-CYGB and TFR antibodies in HCT116. (C) Co-localization of TFR and FLAG-CYGB in HCT116 cells based on immunofluorescence staining

Article Snippet: The separated proteins were separated in a 10% gel through sodium dodecyl sulfate–polyacrylamide gel electrophoresis and then transferred onto polyvinylidene difluoride membranes, blocked in 0.3% Tris-buffered saline with Tween 20 solution containing 5% nonfat dry milk, and further incubated with the primary antibodies LC3B (1:1000 dilution, #3868; Cell Signaling), β-Actin (1:20000 dilution, AC026; ABclonal), CYGB (1:1000 dilution, 60228-1-Ig; Proteintech), DDDDKTag (1:1000 dilution, HT201; TransGen), NCOA4 (1:1000 dilution, A5695; ABclonal), TFR (1:1000 dilution, #13113; Cell Signaling), FTH (1:1000 dilution, A19544; ABclonal), FTL (1:2000 dilution, A11241; ABclonal), PCBP1 (1:1000 dilution, A22141; ABclonal) and ACSL4 (1:1000 dilution, A20414; ABclonal).

Techniques: Western Blot, Over Expression, Immunoprecipitation, Immunofluorescence, Staining

Fig. 5 CYGB combined TFR to regulate ferroptosis. (A) Western blotting analysis of FLAG-CYGB-overexpression in HCT116 and SW620. (B) The immunoprecipitation and immunoblotting were per- formed using FLAG-CYGB and TFR antibodies in HCT116. (C) Co-localization of TFR and FLAG-CYGB in HCT116 cells based on immunofluorescence staining

Journal: Molecular and cellular biochemistry

Article Title: Cytoglobin augments ferroptosis through autophagic degradation of ferritin in colorectal cancer cells.

doi: 10.1007/s11010-024-05148-0

Figure Lengend Snippet: Fig. 5 CYGB combined TFR to regulate ferroptosis. (A) Western blotting analysis of FLAG-CYGB-overexpression in HCT116 and SW620. (B) The immunoprecipitation and immunoblotting were per- formed using FLAG-CYGB and TFR antibodies in HCT116. (C) Co-localization of TFR and FLAG-CYGB in HCT116 cells based on immunofluorescence staining

Article Snippet: The supernatant was collected for western blotting with CYGB (1:1000 dilution, 60228; Proteintech) and TFR (1:1000 dilution, #13113; Cell Signaling).

Techniques: Western Blot, Over Expression, Immunoprecipitation, Immunofluorescence, Staining