Review



coralite594 conjugated antibodies  (Proteintech)


Bioz Verified Symbol Proteintech is a verified supplier  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
    • 93
      Buy from Supplier

    Structured Review

    Proteintech coralite594 conjugated antibodies
    Coralite594 Conjugated Antibodies, supplied by Proteintech, used in various techniques. Bioz Stars score: 93/100, based on 32 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/cl594/CoraLite+594-conjugated+HLA-E+Monoclonal+antibody/pmc13020868-190-26-28
    Average 93 stars, based on 32 article reviews
    coralite594 conjugated antibodies - by Bioz Stars, 2026-09
    93/100 stars

    Images

    Related Articles

    Incubation:

    Article Title: The flavonoids from the fruits of Psoralea corylifolia and their potential in inhibiting metastasis of human non-small cell lung cancers.
    Article Snippet: Nineteen flavonoids were isolated from the fruits of Psoralea corylifolia L., including a novel flavanol (3) and three novel isoflavones (12–14).. Their chemical structures were unequivocally determined through comprehensive spectral data analysis.. The anti-proliferative effect of the isolated flavonoids was assessed in vitro using the MTT assay.

    Staining:

    Article Title: The flavonoids from the fruits of Psoralea corylifolia and their potential in inhibiting metastasis of human non-small cell lung cancers.
    Article Snippet: Nineteen flavonoids were isolated from the fruits of Psoralea corylifolia L., including a novel flavanol (3) and three novel isoflavones (12–14).. Their chemical structures were unequivocally determined through comprehensive spectral data analysis.. The anti-proliferative effect of the isolated flavonoids was assessed in vitro using the MTT assay.

    other:

    Article Title: Regulation of N-degron recognin-mediated autophagy by the SARS-CoV-2 PLpro ubiquitin deconjugase.
    Article Snippet: Primary antibodies – Mouse monoclonal: anti-ACTB/β-actin clone AC-15 (Sigma-Aldrich, A5441; 1:5000); anti-GAPDH (Millipore, CB1001; 1:5000); anti-TUBA/tubulin (Millipore, CP06; 1:2000); anti-FLAG (Sigma-Aldrich, F3165; 1:10000); anti-GFP (B-2; Santa Cruz Biotechnology, sc-9996; 1:1000); anti-UBR1 (Clone 6H9 1; Millipore, MABS1180; 1:2000); antiUb (P4D1; Santa Cruz Biotechnology, sc-8017; 1:1000); antiSQSTM1/p62 Ick ligand (BD Biosciences 610,832; WB: 1:1000; IF: 1:200); anti-BECN1 (Proteintech 66,665–1-Ig; 1:1000); anti-WIPI2 (Abcam, ab105459; WB: 1:1000); antiMYC Tag (Proteintech 60,003–2-Ig; IF: 1:200); anti-SQSTM1 /p62-CoraLite®594-conjugated (Proteintech, CL594–66184; IF: 1:150).

    Article Title: ATF7IP2, a meiosis-specific partner of SETDB1, is required for proper chromosome remodeling and crossover formation during spermatogenesis.
    Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER CoraLite 594-conjugated goat anti-mouse (IF, 1:500) Proteintech Cat# SA00013-3; RRID: AB_2797133 CoraLite 488-conjugated goat anti-mouse (IF, 1:500) Proteintech Cat# SA00013-1; RRID: AB_2810983 CoraLite 488-conjugated donkey anti-rabbit (IF, 1:500) Proteintech Cat# SA00013-6; RRID: AB_2890972 Alexa Fluor 594- conjugated donkey anti-goat (IF, 1:500) Invitrogen Cat# A-11058; RRID: AB_142540 Alexa Fluor 405-conjugated donkey anti-mouse (IF, 1:500) Abcam Cat# ab175658; RRID: AB_2687445 Alexa Fluor 405-conjugated goat anti-guinea pig (IF, 1:500) Abcam Cat# ab175678; RRID: AB_2827755 Alexa Fluor 488-conjugated goat anti-guinea pig (IF, 1:500) Abcam Cat# ab150185; RRID: AB_2736871 HRP-conjugated affinipure goat anti-mouse (WB, 1:10000) Proteintech Cat# SA00001-1; RRID: AB_2722565 HRP-conjugated affinipure goat anti-rabbit (WB, 1:10000) Proteintech Cat# SA00001-2; RRID: AB_2722564 HRP-conjugated affinipure goat anti-guinea pig (WB, 1:10000) Proteintech Cat# SA00001-12; RRID: AB_2890975 Bacterial and virus strains DH5a Competent cell Vazyme Cat# C502 Chemicals, peptides, and recombinant proteins Proteinase K CWBIO Cat# CW2584 Bouin’s solution Sigma-Aldrich Cat# HT1032 Triton X-100 Sigma-Aldrich Cat# T9284 Hematoxylin Millipore Cat# H3136 Eosin Millipore Cat# HT1101128 Paraformaldehyde Sigma-Aldrich Cat #P6148 Phenylmethanesulfonyl fluoride (PMSF) Sigma-Aldrich Cat# PMSF-RO Pierce DTT, No-Weight Format (48 3 7.7mg) Thermo Fisher Scientific Cat# 20291 Triton X-100 Sigma-Aldrich Cat# T9284 Photo-Flo 200 Kodak Cat# 146-4510 Bovine Serum Albumin Sigma-Aldrich Cat# A1933 Fetal Bovine Serum Thermo Fisher Scientific Cat# 10428026 Collagenase Type IV Thermo Fisher Scientific Cat# 17104019 Hyaluronidase Sigma-Aldrich Cat# H2126 Trypsin Sigma-Aldrich Cat# T1426 Deoxyribonuclease I Keygen biotech Cat# KGF007 Dulbecco’s Modified Eagle Medium/ Nutrient Mixture F-12 (DMEM/F12) Keygen biotech Cat# KGM12500N Lipofectamine 2000 Invitrogen Cat# 11668019 Complete protease inhibitor Bimake Cat# B14001 Protein A/G-magnification beads Millipore Cat# LSKMAGAG Critical commercial assays RNA simple Total RNA kit Tiangen Cat# DP419 HiScript II Q RT SuperMix for qPCR (+gDNA wiper) Vazyme Cat# R223-01 Phanta Max Super-Fidelity DNA Polymerase Vazyme Cat# P505-d1 (Continued on next page) 20 Cell Reports 42, 112953, August 29, 2023

    Article Title: VPS4A is the selective receptor for lipophagy in mice and humans.
    Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Oligonucleotides siRNA for mouse Vps4a; Sequence (Sense) 5’ to 3’ GUGGAAUGAUGUAGCUGGA; Sequence (Antisense) 5’ to 3’ UCCAGCUACAUCAUUCCAC Sigma-Aldrich SASI_Mm01_00112004 siRNA for mouse Vps4b; Sequence (Sense) 5’ to 3’ CUUAUGCAGCCUGUGAGAA; Sequence (Antisense) 5’ to 3’ UUCUCACAGGCUGCAUAAG Sigma-Aldrich SASI_Mm01_00077385 siRNA for mouseAtg7; Sequence (Sense) 5’ to 3’ CUGUGAACUUCUCUGACGU; Sequence (Antisense) 5’ to 3’ ACGUCAGAGAAGUUCACAG Sigma-Aldrich SASI_Mm01_00044616 siRNA for mouse Hgs; Sequence (Sense) 5’ to 3’ CAUGUUCGCUGCUGAAAGA; Sequence (Antisense) 5’ to 3’ UCUUUCAGCAGCAGCGAACAUG Sigma-Aldrich SASI_Mm01_00155577 siRNA for mouse Vps28; Sequence (Sense) 5’ to 3’ CCUCUGACGAGCUGGAUGA; Sequence (Antisense) 5’ to 3’ UCAUCCAGCUCGUCAGAGG Sigma-Aldrich SASI_Mm02_00329121 siRNA for mouse Vps25; Sequence (Sense) 5’ to 3’ CGGAAACUUCCUGUGGAGU; Sequence (Antisense) 5’ to 3’ ACUCCACAGGAAGUUUCCG Sigma-Aldrich SASI_Mm02_00330851 siRNA for mouse Vps2; Sequence (Sense) 5’ to 3’ CCCUCAAGAUACAGACUCU; Sequence (Antisense) 5’ to 3’ AGAGUCUGUAUCUUGAGGG Sigma-Aldrich SASI_Mm01_00035835 Scramble siRNA; Sequence (Sense) 5’ to 3’ AAUUCUCCGAACGUGUCACGU; Sequence (Antisense) 5’ to 3’ ACGUGACACGUUCGGAGAAUU Sigma-Aldrich Custom sgRNA#1 for mouse Vps4a; Target: ATGAGAGTGAAGCCGCTCGT Dharmacon SG-046156-01 Recombinant DNA Plasmid: pcDNA3.1(+)_His-EGFP GenScript N/A Plasmid: pcDNA3.1(+)_His-EGFP VPS4A WT GenScript N/A Plasmid: pcDNA3.1(+)_His-EGFP VPS4A S95/97A (VPS4A Phosphodeficient mutant) GenScript N/A Plasmid: pcDNA3.1(+)_Vps4a_W126AV129A_EGFP (VPS4A LIR 1 mutant) GenScript N/A Plasmid: pcDNA3.1(+)_Vps4a_F149AL152A_EGFP (VPS4A LIR 2 mutant) GenScript N/A Plasmid: pcDNA3.1(+)_Vps4a-T3E-T5AL6A_mCherry (VPS4A Lipid binding mutant 1) GenScript N/A Plasmid: pcDNA3.1(+)_Vpsa-E37RY38A_mCherry (VPS4A Lipid binding mutant 2) GenScript N/A Plasmid: pcDNA3.1(+)_Vps4a-L40S-H41AE46R_mCherry (VPS4A Lipid binding mutant 3) GenScript N/A (Continued on next page) Molecular Cell 84, 4436–4453.e1–e8, November 21, 2024 e2

    Immunostaining:

    Article Title: Lipopolysaccharide induces placental mitochondrial dysfunction in murine and human systems by reducing MNRR1 levels via a TLR4-independent pathway
    Article Snippet: α-MNRR1 , Proteintech , Cat # 19424-1-AP; RRID: AB_10638907. .. α-MNRR1 (used for immunostaining human cells) , Proteintech , Cat # CL594-66302; RRID: AB_2883552. .. α-Mouse secondary HRP conjugate , Cell Signaling Technology , Cat # 7076; RRID: AB_330924.

    Virus:

    Article Title: Structural basis for translation inhibition by MERS-CoV Nsp1 reveals a conserved mechanism for betacoronaviruses.
    Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies His-Tag Monoclonal antibody ProteinTech Cat# CL594-66005; RRID: AB_2883473 Goat Anti-Mouse IgG HRP Cayman Chemical Company Cat# 10004302; RRID: AB_10078261 Bacterial and virus strains DH5a New England Biosciences C2987H BL21 (DE3) New England Biosciences C2527H Chemicals, peptides, and recombinant proteins Ulp1 Protease (Saccharomyces cerevisiae) Xiong Lab Purified Protein Stocks Accession number 1EUV_A (amino acids 1–221) Creatine Kinase Millipore Sigma/Roche 10127566001 Creatine Phosphate Thermo Fisher 337340100 Complete, Mini Protease Inhibitor Cocktail Roche 11836153001 Potassium Chloride Sigma-Aldrich P9541 Magnesium Acetate Sigma-Aldrich M5661 EDTA Sigma-Aldrich E5134 DTT GoldBio 27565-41-9 Ammonium Acetate Sigma-Aldrich A1542 SUPERase-in Invitrogen AM2696 Sac1HF NEB R3156S HEPES KOH Sigma-Aldrich H0527 Spermidine HCl Sigma-Aldrich S2626 ATP Jena Bioscience NU-1010 GTP ThermoScientific R0461 CHAPSO EMD Millipore 220202 Potassium glutamate Sigma-Aldrich 236497 Magnesium glutamate Sigma-Aldrich M0631 Creatine phosphate Thermo Fisher A15362.06 HeLa cytoplasmic extract Ipracell CC-01-40-50 Fluorescein-5-Maleimide ThermoFisher Scientific 62245 Potassium Acetate JT Baker 2912–01 Magnesium Chloride Sigma-Aldrich 63068 Dithiothreitol (DTT) Fisher Scientific BP17225 Clarity Western ECL substrate Bio-Rad 1705060S 10x TBS Buffer Bio-Rad 1706435 Tween 20 Sigma-Aldrich P7949 Instant Nonfat Dry Milk Nestle/Carnation 12428935 isopropyl b-D-1-thiogalactopyranoside GoldBio I2481C100 NaCl AmericanBio AB01915 Tris-HCl AmericanBio AB14044 TCEP GoldBio TCEP25 Luria Broth Research Products International 31FZ61 Terrific Broth Research Products International 31GE05 Rabbit Reticulocyte Lysate Green Hectares N/A Kanamycin ThermoScientific 450810100 (Continued on next page) Cell Reports 42, 113156, October 31, 2023 9 .. REAGENT or RESOURCE SOURCE IDENTIFIER Ampicillin GoldBio A-301-100 Phenol:Chloroform:IAA Invitrogen 15593–031 Chloroform JT Baker 9180–01 Isoamyl alcohol JT Baker 9038–01 Ethanol Sigma-Aldrich E7023 Critical commercial assays Luciferase Assay System Promega E1500 mMessage mMachine T7 transcription kit Invitrogen AM1344 Gibson assembly cloning New England Biosciences E5510S Q5 High-Fidelity DNA Polymerase New England Biosciences M0491L Deposited data MERS-CoV Nsp1 bound human 40S ribosomal subunit PDB 8T4S Electron density map (focus refined composite map) EMDB EMD-41039 Electron density map (consensus refined map) EMDB EMD-41063 Electron density map (focus refined 40S head map) EMDB EMD-41064 Electron density map (focus refined 40S body map) EMDB EMD-41065 Experimental models: Organisms/strains Middle East Respiratory Syndrome NIH GenBank WBY50300.1 (Amino acids 1–193) Severe Acute Respiratory Syndrome Coronavirus 2 NIH GenBank YP_009725297.1 (Amino acids 1–180) Oligonucleotides SARS-CoV-2 Nsp1 KH Forward (CCAGGAAAACTGGAACACCGCGGCC CAGCTCCGGAGTGACCAGAGAGCTG) IDT N/A SARS-CoV-2 Nsp1 KH Reverse (CACTCCGGAGCTGTGCTTGGGCCGC GGTGTTCCAGTTTTCCTGGAAGTCC) IDT N/A MERS Nsp1 KY Forward (CTAAAGGCGCAGCTGCCC AGAATCTGCTTAAG) IDT N/A MERS Nsp1 KY Reverse (CTGGGCAGCTGCGCCTTTAGGA TCCGCCTCAAAATC) IDT N/A MERS Nsp1 KK Forward (GCGGATCCTGCAGGCGCATATG CCCAGAATCTGCTTAAGAAGTTG) IDT N/A MERS Nsp1 KK Reverse (GCAGATTCTGGGCATATGCGCCTGCA GGATCCGCCTCAAAATCGTCCATCCAC) IDT N/A MERS DCT Forward (CATTCCACTATGAGCGAGACAACT AACTCGAGCACCACCACCACC) IDT N/A MERS DCT Reverse (GGTGGTGGTGGTGCTCGAGTTA GTTGTCTCGCTCATAGTGGAATG) IDT N/A (Continued on next page) 10 Cell Reports 42, 113156, October 31, 2023

    Recombinant:

    Article Title: Structural basis for translation inhibition by MERS-CoV Nsp1 reveals a conserved mechanism for betacoronaviruses.
    Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies His-Tag Monoclonal antibody ProteinTech Cat# CL594-66005; RRID: AB_2883473 Goat Anti-Mouse IgG HRP Cayman Chemical Company Cat# 10004302; RRID: AB_10078261 Bacterial and virus strains DH5a New England Biosciences C2987H BL21 (DE3) New England Biosciences C2527H Chemicals, peptides, and recombinant proteins Ulp1 Protease (Saccharomyces cerevisiae) Xiong Lab Purified Protein Stocks Accession number 1EUV_A (amino acids 1–221) Creatine Kinase Millipore Sigma/Roche 10127566001 Creatine Phosphate Thermo Fisher 337340100 Complete, Mini Protease Inhibitor Cocktail Roche 11836153001 Potassium Chloride Sigma-Aldrich P9541 Magnesium Acetate Sigma-Aldrich M5661 EDTA Sigma-Aldrich E5134 DTT GoldBio 27565-41-9 Ammonium Acetate Sigma-Aldrich A1542 SUPERase-in Invitrogen AM2696 Sac1HF NEB R3156S HEPES KOH Sigma-Aldrich H0527 Spermidine HCl Sigma-Aldrich S2626 ATP Jena Bioscience NU-1010 GTP ThermoScientific R0461 CHAPSO EMD Millipore 220202 Potassium glutamate Sigma-Aldrich 236497 Magnesium glutamate Sigma-Aldrich M0631 Creatine phosphate Thermo Fisher A15362.06 HeLa cytoplasmic extract Ipracell CC-01-40-50 Fluorescein-5-Maleimide ThermoFisher Scientific 62245 Potassium Acetate JT Baker 2912–01 Magnesium Chloride Sigma-Aldrich 63068 Dithiothreitol (DTT) Fisher Scientific BP17225 Clarity Western ECL substrate Bio-Rad 1705060S 10x TBS Buffer Bio-Rad 1706435 Tween 20 Sigma-Aldrich P7949 Instant Nonfat Dry Milk Nestle/Carnation 12428935 isopropyl b-D-1-thiogalactopyranoside GoldBio I2481C100 NaCl AmericanBio AB01915 Tris-HCl AmericanBio AB14044 TCEP GoldBio TCEP25 Luria Broth Research Products International 31FZ61 Terrific Broth Research Products International 31GE05 Rabbit Reticulocyte Lysate Green Hectares N/A Kanamycin ThermoScientific 450810100 (Continued on next page) Cell Reports 42, 113156, October 31, 2023 9 .. REAGENT or RESOURCE SOURCE IDENTIFIER Ampicillin GoldBio A-301-100 Phenol:Chloroform:IAA Invitrogen 15593–031 Chloroform JT Baker 9180–01 Isoamyl alcohol JT Baker 9038–01 Ethanol Sigma-Aldrich E7023 Critical commercial assays Luciferase Assay System Promega E1500 mMessage mMachine T7 transcription kit Invitrogen AM1344 Gibson assembly cloning New England Biosciences E5510S Q5 High-Fidelity DNA Polymerase New England Biosciences M0491L Deposited data MERS-CoV Nsp1 bound human 40S ribosomal subunit PDB 8T4S Electron density map (focus refined composite map) EMDB EMD-41039 Electron density map (consensus refined map) EMDB EMD-41063 Electron density map (focus refined 40S head map) EMDB EMD-41064 Electron density map (focus refined 40S body map) EMDB EMD-41065 Experimental models: Organisms/strains Middle East Respiratory Syndrome NIH GenBank WBY50300.1 (Amino acids 1–193) Severe Acute Respiratory Syndrome Coronavirus 2 NIH GenBank YP_009725297.1 (Amino acids 1–180) Oligonucleotides SARS-CoV-2 Nsp1 KH Forward (CCAGGAAAACTGGAACACCGCGGCC CAGCTCCGGAGTGACCAGAGAGCTG) IDT N/A SARS-CoV-2 Nsp1 KH Reverse (CACTCCGGAGCTGTGCTTGGGCCGC GGTGTTCCAGTTTTCCTGGAAGTCC) IDT N/A MERS Nsp1 KY Forward (CTAAAGGCGCAGCTGCCC AGAATCTGCTTAAG) IDT N/A MERS Nsp1 KY Reverse (CTGGGCAGCTGCGCCTTTAGGA TCCGCCTCAAAATC) IDT N/A MERS Nsp1 KK Forward (GCGGATCCTGCAGGCGCATATG CCCAGAATCTGCTTAAGAAGTTG) IDT N/A MERS Nsp1 KK Reverse (GCAGATTCTGGGCATATGCGCCTGCA GGATCCGCCTCAAAATCGTCCATCCAC) IDT N/A MERS DCT Forward (CATTCCACTATGAGCGAGACAACT AACTCGAGCACCACCACCACC) IDT N/A MERS DCT Reverse (GGTGGTGGTGGTGCTCGAGTTA GTTGTCTCGCTCATAGTGGAATG) IDT N/A (Continued on next page) 10 Cell Reports 42, 113156, October 31, 2023

    Article Title: A functional cardiac patch promotes cardiac repair by modulating the CCR2 - cardiac-resident macrophage niche and their cell crosstalk.
    Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies FITC Rat Anti-CD11b BD Biosciences Cat# 557396; RRID: AB_396679 Alexa Fluor 647 Mouse anti-Mouse CD64 a and b Alloantigens BD Biosciences Cat# 558539; RRID: AB_647120 PerCP-CyTM5.5 Rat Anti-Mouse CD45 BD Biosciences Cat# 550994; RRID: AB_394003 BV421 Rat Anti-Mouse CD192 (CCR2) BD Biosciences Cat# 747963; RRID: AB_2872424 CoraLite 594-conjugated FSP1/S100A4 Polyclonal antibody Proteintech Cat# CL594-16105; RRID: AB_2919828 Alexa Fluor 647 Anti-Cardiac Troponin T BD Biosciences Cat# 565744; RRID: AB_2739341 PE Anti-Mouse CD31 Antibody Elabscience Cat# E-AB-F1180D; RRID: AB_3675229 CoraLite Plus 488-conjugated Connexin 43 Recombinant antibody Proteintech Cat# CL488-80543; RRID: AB_3673036 Alexa Fluor 647 Anti-Wilms Tumor Abcam Cat# ab283325; RRID: AB_3675232 CoraLite 594-conjugated smooth muscle actin specific Monoclonal antibody Proteintech Cat# CL594-67735; RRID: AB_2920177 ABflo 488 Rabbit anti-Mouse CD140b/PDGFR beta mAb ABclonal Cat# A26690; RRID: AB_3675233 NG2/CSPG4 Rabbit mAb ABclonal Cat# A24955; RRID: AB_2863096 Anti-Sarcomeric Alpha Actinin Abcam Cat# ab9465; RRID: AB_307264 Anti-Connexin 43/GJA1 Abcam Cat# ab11370; RRID: AB_297976 IL4 Antibody Affinity Biosciences Cat# AF5142; RRID: AB_2837628 Anti-Ki67 Abcam Cat# ab15580; RRID: AB_443209 Anti-CD163 Abcam Cat# ab182422; RRID: AB_2753196 Anti-iNOS Abcam Cat# ab178945; RRID: AB_2861417 Anti-Mannose Receptor/CD206 Abcam Cat# ab64693; RRID: AB_1523910 b-tubulin Fudebio-tech Cat# FD0064; RRID: AB_3076327 WT1 (F-6) Santa Cruz Cat# sc-7385; RRID: AB_628448 Anti-Wilms Tumor Abcam Cat# ab180840; RRID: AB_2784516 Anti-VWFpp/VWF Antibody Boster Bio. .. Cat# PB9273; RRID: AB_3082045 Anti-Von Willebrand Factor Abcam Cat# ab6994; RRID: AB_305689 Anti-CD31 Abcam Cat# ab222783; RRID: AB_2905525 Anti-CD68 Abcam Cat# ab201340; RRID: AB_2920880 CCR2 Antibody Affinity Biosciences Cat# DF7507; RRID: AB_2841007 Anti-Fibronectin Abcam Cat# ab268020; RRID: AB_2941028 Anti-a-SMA/ACTA2 Antibody Boster Bio.

    Purification:

    Article Title: Structural basis for translation inhibition by MERS-CoV Nsp1 reveals a conserved mechanism for betacoronaviruses.
    Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies His-Tag Monoclonal antibody ProteinTech Cat# CL594-66005; RRID: AB_2883473 Goat Anti-Mouse IgG HRP Cayman Chemical Company Cat# 10004302; RRID: AB_10078261 Bacterial and virus strains DH5a New England Biosciences C2987H BL21 (DE3) New England Biosciences C2527H Chemicals, peptides, and recombinant proteins Ulp1 Protease (Saccharomyces cerevisiae) Xiong Lab Purified Protein Stocks Accession number 1EUV_A (amino acids 1–221) Creatine Kinase Millipore Sigma/Roche 10127566001 Creatine Phosphate Thermo Fisher 337340100 Complete, Mini Protease Inhibitor Cocktail Roche 11836153001 Potassium Chloride Sigma-Aldrich P9541 Magnesium Acetate Sigma-Aldrich M5661 EDTA Sigma-Aldrich E5134 DTT GoldBio 27565-41-9 Ammonium Acetate Sigma-Aldrich A1542 SUPERase-in Invitrogen AM2696 Sac1HF NEB R3156S HEPES KOH Sigma-Aldrich H0527 Spermidine HCl Sigma-Aldrich S2626 ATP Jena Bioscience NU-1010 GTP ThermoScientific R0461 CHAPSO EMD Millipore 220202 Potassium glutamate Sigma-Aldrich 236497 Magnesium glutamate Sigma-Aldrich M0631 Creatine phosphate Thermo Fisher A15362.06 HeLa cytoplasmic extract Ipracell CC-01-40-50 Fluorescein-5-Maleimide ThermoFisher Scientific 62245 Potassium Acetate JT Baker 2912–01 Magnesium Chloride Sigma-Aldrich 63068 Dithiothreitol (DTT) Fisher Scientific BP17225 Clarity Western ECL substrate Bio-Rad 1705060S 10x TBS Buffer Bio-Rad 1706435 Tween 20 Sigma-Aldrich P7949 Instant Nonfat Dry Milk Nestle/Carnation 12428935 isopropyl b-D-1-thiogalactopyranoside GoldBio I2481C100 NaCl AmericanBio AB01915 Tris-HCl AmericanBio AB14044 TCEP GoldBio TCEP25 Luria Broth Research Products International 31FZ61 Terrific Broth Research Products International 31GE05 Rabbit Reticulocyte Lysate Green Hectares N/A Kanamycin ThermoScientific 450810100 (Continued on next page) Cell Reports 42, 113156, October 31, 2023 9 .. REAGENT or RESOURCE SOURCE IDENTIFIER Ampicillin GoldBio A-301-100 Phenol:Chloroform:IAA Invitrogen 15593–031 Chloroform JT Baker 9180–01 Isoamyl alcohol JT Baker 9038–01 Ethanol Sigma-Aldrich E7023 Critical commercial assays Luciferase Assay System Promega E1500 mMessage mMachine T7 transcription kit Invitrogen AM1344 Gibson assembly cloning New England Biosciences E5510S Q5 High-Fidelity DNA Polymerase New England Biosciences M0491L Deposited data MERS-CoV Nsp1 bound human 40S ribosomal subunit PDB 8T4S Electron density map (focus refined composite map) EMDB EMD-41039 Electron density map (consensus refined map) EMDB EMD-41063 Electron density map (focus refined 40S head map) EMDB EMD-41064 Electron density map (focus refined 40S body map) EMDB EMD-41065 Experimental models: Organisms/strains Middle East Respiratory Syndrome NIH GenBank WBY50300.1 (Amino acids 1–193) Severe Acute Respiratory Syndrome Coronavirus 2 NIH GenBank YP_009725297.1 (Amino acids 1–180) Oligonucleotides SARS-CoV-2 Nsp1 KH Forward (CCAGGAAAACTGGAACACCGCGGCC CAGCTCCGGAGTGACCAGAGAGCTG) IDT N/A SARS-CoV-2 Nsp1 KH Reverse (CACTCCGGAGCTGTGCTTGGGCCGC GGTGTTCCAGTTTTCCTGGAAGTCC) IDT N/A MERS Nsp1 KY Forward (CTAAAGGCGCAGCTGCCC AGAATCTGCTTAAG) IDT N/A MERS Nsp1 KY Reverse (CTGGGCAGCTGCGCCTTTAGGA TCCGCCTCAAAATC) IDT N/A MERS Nsp1 KK Forward (GCGGATCCTGCAGGCGCATATG CCCAGAATCTGCTTAAGAAGTTG) IDT N/A MERS Nsp1 KK Reverse (GCAGATTCTGGGCATATGCGCCTGCA GGATCCGCCTCAAAATCGTCCATCCAC) IDT N/A MERS DCT Forward (CATTCCACTATGAGCGAGACAACT AACTCGAGCACCACCACCACC) IDT N/A MERS DCT Reverse (GGTGGTGGTGGTGCTCGAGTTA GTTGTCTCGCTCATAGTGGAATG) IDT N/A (Continued on next page) 10 Cell Reports 42, 113156, October 31, 2023

    Protease Inhibitor:

    Article Title: Structural basis for translation inhibition by MERS-CoV Nsp1 reveals a conserved mechanism for betacoronaviruses.
    Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies His-Tag Monoclonal antibody ProteinTech Cat# CL594-66005; RRID: AB_2883473 Goat Anti-Mouse IgG HRP Cayman Chemical Company Cat# 10004302; RRID: AB_10078261 Bacterial and virus strains DH5a New England Biosciences C2987H BL21 (DE3) New England Biosciences C2527H Chemicals, peptides, and recombinant proteins Ulp1 Protease (Saccharomyces cerevisiae) Xiong Lab Purified Protein Stocks Accession number 1EUV_A (amino acids 1–221) Creatine Kinase Millipore Sigma/Roche 10127566001 Creatine Phosphate Thermo Fisher 337340100 Complete, Mini Protease Inhibitor Cocktail Roche 11836153001 Potassium Chloride Sigma-Aldrich P9541 Magnesium Acetate Sigma-Aldrich M5661 EDTA Sigma-Aldrich E5134 DTT GoldBio 27565-41-9 Ammonium Acetate Sigma-Aldrich A1542 SUPERase-in Invitrogen AM2696 Sac1HF NEB R3156S HEPES KOH Sigma-Aldrich H0527 Spermidine HCl Sigma-Aldrich S2626 ATP Jena Bioscience NU-1010 GTP ThermoScientific R0461 CHAPSO EMD Millipore 220202 Potassium glutamate Sigma-Aldrich 236497 Magnesium glutamate Sigma-Aldrich M0631 Creatine phosphate Thermo Fisher A15362.06 HeLa cytoplasmic extract Ipracell CC-01-40-50 Fluorescein-5-Maleimide ThermoFisher Scientific 62245 Potassium Acetate JT Baker 2912–01 Magnesium Chloride Sigma-Aldrich 63068 Dithiothreitol (DTT) Fisher Scientific BP17225 Clarity Western ECL substrate Bio-Rad 1705060S 10x TBS Buffer Bio-Rad 1706435 Tween 20 Sigma-Aldrich P7949 Instant Nonfat Dry Milk Nestle/Carnation 12428935 isopropyl b-D-1-thiogalactopyranoside GoldBio I2481C100 NaCl AmericanBio AB01915 Tris-HCl AmericanBio AB14044 TCEP GoldBio TCEP25 Luria Broth Research Products International 31FZ61 Terrific Broth Research Products International 31GE05 Rabbit Reticulocyte Lysate Green Hectares N/A Kanamycin ThermoScientific 450810100 (Continued on next page) Cell Reports 42, 113156, October 31, 2023 9 .. REAGENT or RESOURCE SOURCE IDENTIFIER Ampicillin GoldBio A-301-100 Phenol:Chloroform:IAA Invitrogen 15593–031 Chloroform JT Baker 9180–01 Isoamyl alcohol JT Baker 9038–01 Ethanol Sigma-Aldrich E7023 Critical commercial assays Luciferase Assay System Promega E1500 mMessage mMachine T7 transcription kit Invitrogen AM1344 Gibson assembly cloning New England Biosciences E5510S Q5 High-Fidelity DNA Polymerase New England Biosciences M0491L Deposited data MERS-CoV Nsp1 bound human 40S ribosomal subunit PDB 8T4S Electron density map (focus refined composite map) EMDB EMD-41039 Electron density map (consensus refined map) EMDB EMD-41063 Electron density map (focus refined 40S head map) EMDB EMD-41064 Electron density map (focus refined 40S body map) EMDB EMD-41065 Experimental models: Organisms/strains Middle East Respiratory Syndrome NIH GenBank WBY50300.1 (Amino acids 1–193) Severe Acute Respiratory Syndrome Coronavirus 2 NIH GenBank YP_009725297.1 (Amino acids 1–180) Oligonucleotides SARS-CoV-2 Nsp1 KH Forward (CCAGGAAAACTGGAACACCGCGGCC CAGCTCCGGAGTGACCAGAGAGCTG) IDT N/A SARS-CoV-2 Nsp1 KH Reverse (CACTCCGGAGCTGTGCTTGGGCCGC GGTGTTCCAGTTTTCCTGGAAGTCC) IDT N/A MERS Nsp1 KY Forward (CTAAAGGCGCAGCTGCCC AGAATCTGCTTAAG) IDT N/A MERS Nsp1 KY Reverse (CTGGGCAGCTGCGCCTTTAGGA TCCGCCTCAAAATC) IDT N/A MERS Nsp1 KK Forward (GCGGATCCTGCAGGCGCATATG CCCAGAATCTGCTTAAGAAGTTG) IDT N/A MERS Nsp1 KK Reverse (GCAGATTCTGGGCATATGCGCCTGCA GGATCCGCCTCAAAATCGTCCATCCAC) IDT N/A MERS DCT Forward (CATTCCACTATGAGCGAGACAACT AACTCGAGCACCACCACCACC) IDT N/A MERS DCT Reverse (GGTGGTGGTGGTGCTCGAGTTA GTTGTCTCGCTCATAGTGGAATG) IDT N/A (Continued on next page) 10 Cell Reports 42, 113156, October 31, 2023

    Western Blot:

    Article Title: Structural basis for translation inhibition by MERS-CoV Nsp1 reveals a conserved mechanism for betacoronaviruses.
    Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies His-Tag Monoclonal antibody ProteinTech Cat# CL594-66005; RRID: AB_2883473 Goat Anti-Mouse IgG HRP Cayman Chemical Company Cat# 10004302; RRID: AB_10078261 Bacterial and virus strains DH5a New England Biosciences C2987H BL21 (DE3) New England Biosciences C2527H Chemicals, peptides, and recombinant proteins Ulp1 Protease (Saccharomyces cerevisiae) Xiong Lab Purified Protein Stocks Accession number 1EUV_A (amino acids 1–221) Creatine Kinase Millipore Sigma/Roche 10127566001 Creatine Phosphate Thermo Fisher 337340100 Complete, Mini Protease Inhibitor Cocktail Roche 11836153001 Potassium Chloride Sigma-Aldrich P9541 Magnesium Acetate Sigma-Aldrich M5661 EDTA Sigma-Aldrich E5134 DTT GoldBio 27565-41-9 Ammonium Acetate Sigma-Aldrich A1542 SUPERase-in Invitrogen AM2696 Sac1HF NEB R3156S HEPES KOH Sigma-Aldrich H0527 Spermidine HCl Sigma-Aldrich S2626 ATP Jena Bioscience NU-1010 GTP ThermoScientific R0461 CHAPSO EMD Millipore 220202 Potassium glutamate Sigma-Aldrich 236497 Magnesium glutamate Sigma-Aldrich M0631 Creatine phosphate Thermo Fisher A15362.06 HeLa cytoplasmic extract Ipracell CC-01-40-50 Fluorescein-5-Maleimide ThermoFisher Scientific 62245 Potassium Acetate JT Baker 2912–01 Magnesium Chloride Sigma-Aldrich 63068 Dithiothreitol (DTT) Fisher Scientific BP17225 Clarity Western ECL substrate Bio-Rad 1705060S 10x TBS Buffer Bio-Rad 1706435 Tween 20 Sigma-Aldrich P7949 Instant Nonfat Dry Milk Nestle/Carnation 12428935 isopropyl b-D-1-thiogalactopyranoside GoldBio I2481C100 NaCl AmericanBio AB01915 Tris-HCl AmericanBio AB14044 TCEP GoldBio TCEP25 Luria Broth Research Products International 31FZ61 Terrific Broth Research Products International 31GE05 Rabbit Reticulocyte Lysate Green Hectares N/A Kanamycin ThermoScientific 450810100 (Continued on next page) Cell Reports 42, 113156, October 31, 2023 9 .. REAGENT or RESOURCE SOURCE IDENTIFIER Ampicillin GoldBio A-301-100 Phenol:Chloroform:IAA Invitrogen 15593–031 Chloroform JT Baker 9180–01 Isoamyl alcohol JT Baker 9038–01 Ethanol Sigma-Aldrich E7023 Critical commercial assays Luciferase Assay System Promega E1500 mMessage mMachine T7 transcription kit Invitrogen AM1344 Gibson assembly cloning New England Biosciences E5510S Q5 High-Fidelity DNA Polymerase New England Biosciences M0491L Deposited data MERS-CoV Nsp1 bound human 40S ribosomal subunit PDB 8T4S Electron density map (focus refined composite map) EMDB EMD-41039 Electron density map (consensus refined map) EMDB EMD-41063 Electron density map (focus refined 40S head map) EMDB EMD-41064 Electron density map (focus refined 40S body map) EMDB EMD-41065 Experimental models: Organisms/strains Middle East Respiratory Syndrome NIH GenBank WBY50300.1 (Amino acids 1–193) Severe Acute Respiratory Syndrome Coronavirus 2 NIH GenBank YP_009725297.1 (Amino acids 1–180) Oligonucleotides SARS-CoV-2 Nsp1 KH Forward (CCAGGAAAACTGGAACACCGCGGCC CAGCTCCGGAGTGACCAGAGAGCTG) IDT N/A SARS-CoV-2 Nsp1 KH Reverse (CACTCCGGAGCTGTGCTTGGGCCGC GGTGTTCCAGTTTTCCTGGAAGTCC) IDT N/A MERS Nsp1 KY Forward (CTAAAGGCGCAGCTGCCC AGAATCTGCTTAAG) IDT N/A MERS Nsp1 KY Reverse (CTGGGCAGCTGCGCCTTTAGGA TCCGCCTCAAAATC) IDT N/A MERS Nsp1 KK Forward (GCGGATCCTGCAGGCGCATATG CCCAGAATCTGCTTAAGAAGTTG) IDT N/A MERS Nsp1 KK Reverse (GCAGATTCTGGGCATATGCGCCTGCA GGATCCGCCTCAAAATCGTCCATCCAC) IDT N/A MERS DCT Forward (CATTCCACTATGAGCGAGACAACT AACTCGAGCACCACCACCACC) IDT N/A MERS DCT Reverse (GGTGGTGGTGGTGCTCGAGTTA GTTGTCTCGCTCATAGTGGAATG) IDT N/A (Continued on next page) 10 Cell Reports 42, 113156, October 31, 2023

    Milk:

    Article Title: Structural basis for translation inhibition by MERS-CoV Nsp1 reveals a conserved mechanism for betacoronaviruses.
    Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies His-Tag Monoclonal antibody ProteinTech Cat# CL594-66005; RRID: AB_2883473 Goat Anti-Mouse IgG HRP Cayman Chemical Company Cat# 10004302; RRID: AB_10078261 Bacterial and virus strains DH5a New England Biosciences C2987H BL21 (DE3) New England Biosciences C2527H Chemicals, peptides, and recombinant proteins Ulp1 Protease (Saccharomyces cerevisiae) Xiong Lab Purified Protein Stocks Accession number 1EUV_A (amino acids 1–221) Creatine Kinase Millipore Sigma/Roche 10127566001 Creatine Phosphate Thermo Fisher 337340100 Complete, Mini Protease Inhibitor Cocktail Roche 11836153001 Potassium Chloride Sigma-Aldrich P9541 Magnesium Acetate Sigma-Aldrich M5661 EDTA Sigma-Aldrich E5134 DTT GoldBio 27565-41-9 Ammonium Acetate Sigma-Aldrich A1542 SUPERase-in Invitrogen AM2696 Sac1HF NEB R3156S HEPES KOH Sigma-Aldrich H0527 Spermidine HCl Sigma-Aldrich S2626 ATP Jena Bioscience NU-1010 GTP ThermoScientific R0461 CHAPSO EMD Millipore 220202 Potassium glutamate Sigma-Aldrich 236497 Magnesium glutamate Sigma-Aldrich M0631 Creatine phosphate Thermo Fisher A15362.06 HeLa cytoplasmic extract Ipracell CC-01-40-50 Fluorescein-5-Maleimide ThermoFisher Scientific 62245 Potassium Acetate JT Baker 2912–01 Magnesium Chloride Sigma-Aldrich 63068 Dithiothreitol (DTT) Fisher Scientific BP17225 Clarity Western ECL substrate Bio-Rad 1705060S 10x TBS Buffer Bio-Rad 1706435 Tween 20 Sigma-Aldrich P7949 Instant Nonfat Dry Milk Nestle/Carnation 12428935 isopropyl b-D-1-thiogalactopyranoside GoldBio I2481C100 NaCl AmericanBio AB01915 Tris-HCl AmericanBio AB14044 TCEP GoldBio TCEP25 Luria Broth Research Products International 31FZ61 Terrific Broth Research Products International 31GE05 Rabbit Reticulocyte Lysate Green Hectares N/A Kanamycin ThermoScientific 450810100 (Continued on next page) Cell Reports 42, 113156, October 31, 2023 9 .. REAGENT or RESOURCE SOURCE IDENTIFIER Ampicillin GoldBio A-301-100 Phenol:Chloroform:IAA Invitrogen 15593–031 Chloroform JT Baker 9180–01 Isoamyl alcohol JT Baker 9038–01 Ethanol Sigma-Aldrich E7023 Critical commercial assays Luciferase Assay System Promega E1500 mMessage mMachine T7 transcription kit Invitrogen AM1344 Gibson assembly cloning New England Biosciences E5510S Q5 High-Fidelity DNA Polymerase New England Biosciences M0491L Deposited data MERS-CoV Nsp1 bound human 40S ribosomal subunit PDB 8T4S Electron density map (focus refined composite map) EMDB EMD-41039 Electron density map (consensus refined map) EMDB EMD-41063 Electron density map (focus refined 40S head map) EMDB EMD-41064 Electron density map (focus refined 40S body map) EMDB EMD-41065 Experimental models: Organisms/strains Middle East Respiratory Syndrome NIH GenBank WBY50300.1 (Amino acids 1–193) Severe Acute Respiratory Syndrome Coronavirus 2 NIH GenBank YP_009725297.1 (Amino acids 1–180) Oligonucleotides SARS-CoV-2 Nsp1 KH Forward (CCAGGAAAACTGGAACACCGCGGCC CAGCTCCGGAGTGACCAGAGAGCTG) IDT N/A SARS-CoV-2 Nsp1 KH Reverse (CACTCCGGAGCTGTGCTTGGGCCGC GGTGTTCCAGTTTTCCTGGAAGTCC) IDT N/A MERS Nsp1 KY Forward (CTAAAGGCGCAGCTGCCC AGAATCTGCTTAAG) IDT N/A MERS Nsp1 KY Reverse (CTGGGCAGCTGCGCCTTTAGGA TCCGCCTCAAAATC) IDT N/A MERS Nsp1 KK Forward (GCGGATCCTGCAGGCGCATATG CCCAGAATCTGCTTAAGAAGTTG) IDT N/A MERS Nsp1 KK Reverse (GCAGATTCTGGGCATATGCGCCTGCA GGATCCGCCTCAAAATCGTCCATCCAC) IDT N/A MERS DCT Forward (CATTCCACTATGAGCGAGACAACT AACTCGAGCACCACCACCACC) IDT N/A MERS DCT Reverse (GGTGGTGGTGGTGCTCGAGTTA GTTGTCTCGCTCATAGTGGAATG) IDT N/A (Continued on next page) 10 Cell Reports 42, 113156, October 31, 2023



    Similar Products

    coralite594 conjugated antibodies  (Proteintech)
    93
    Proteintech coralite594 conjugated antibodies
    Coralite594 Conjugated Antibodies, supplied by Proteintech, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/cl594/CoraLite+594-conjugated+HLA-E+Monoclonal+antibody/pmc13020868-190-26-28
    Average 93 stars, based on 1 article reviews
    coralite594 conjugated antibodies - by Bioz Stars, 2026-09
    93/100 stars
    		  Buy from Supplier
    sumo2 3  (Proteintech)
    95
    Proteintech sumo2 3
    a Immunofluorescence images and quantification (n = 20) of SUMO1 (green) <t>and</t> <t>SUMO2/3</t> (red) conjugation in RAW264.7 cells with or without STM 14028S infection (4 hpi). Scale bar, 10 µm. b Core SUMO cycle enzymes and their corresponding primary genes (blue). c, d Transcriptomic and proteomic analyses of SUMO cycle enzyme expression in RAW264.7 cells infected with STM 14028S vs uninfected controls (4 hpi; n = 3). e UBC9 mRNA expression in RAW264.7 cells during STM 14028S infection (0-6 hpi; n = 3). f Immunoblot analysis and quantification of UBC9 protein levels in STM 14028S-infected RAW264.7 cells (0-6 hpi; n = 3). *P < 0.05; ***P < 0.001; ns, not significant.
    Sumo2 3, supplied by Proteintech, used in various techniques. Bioz Stars score: 95/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/cl594/CL594-conjugated+SUMO2%2F3+Antibody/bio_rxiv__64898__2026__03__06__710069-241-14-15
    Average 95 stars, based on 1 article reviews
    sumo2 3 - by Bioz Stars, 2026-09
    95/100 stars
    		  Buy from Supplier
    coralite594  (Proteintech)
    93
    Proteintech coralite594
    a Immunofluorescence images and quantification (n = 20) of SUMO1 (green) <t>and</t> <t>SUMO2/3</t> (red) conjugation in RAW264.7 cells with or without STM 14028S infection (4 hpi). Scale bar, 10 µm. b Core SUMO cycle enzymes and their corresponding primary genes (blue). c, d Transcriptomic and proteomic analyses of SUMO cycle enzyme expression in RAW264.7 cells infected with STM 14028S vs uninfected controls (4 hpi; n = 3). e UBC9 mRNA expression in RAW264.7 cells during STM 14028S infection (0-6 hpi; n = 3). f Immunoblot analysis and quantification of UBC9 protein levels in STM 14028S-infected RAW264.7 cells (0-6 hpi; n = 3). *P < 0.05; ***P < 0.001; ns, not significant.
    Coralite594, supplied by Proteintech, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/cl594/CL594-conjugated+acetylated+Tubulin(Lys40)+Antibody/pm41790259-100-15-21
    Average 93 stars, based on 1 article reviews
    coralite594 - by Bioz Stars, 2026-09
    93/100 stars
    		  Buy from Supplier
    tubulin  (Proteintech)
    93
    Proteintech tubulin
    Elapor1 deficiency led to globozoospermia and asthenozoospermia in mice. ( A ) Representative Western blots for ELAPOR1 showed its deficiency in Elapor1 cKO testis. β-actin served as loading control. ( B ) IHC staining of ELAPOR1 in testicular sections showed significantly reduce of ELAPOR1 expression in Elapor1 cKO testis. Scale bar = 50 μm. ( C ) IF staining of ELAPOR1 in spermatids showed its localization in Golgi apparatus and acrosome was disappeared in Elapor1 cKO spermatids. Pink, ELAPOR1; red, GM130 (Golgi marker); green, PNA-stained acrosome. Scale bar = 5 μm. ( D ) Statistical results of testis index ( n = 6, P = 0.1428) between Elapor1 flox/flox and Elapor1 cKO mice. ( E , F ) Sperm parameters including concentration, motility and progressive motility, evaluated by CASA, showed decline of motility ( n = 8, P < 0.0001) and progressive motility ( n = 8, P < 0.0001) in Elapor1 cKO mice, whereas there was no difference in sperm concentration between two groups ( n = 8, P = 0.5079). ( G , H ) Sperm morphology was stained by Wright-Giemsa staining and the sperm deformity was calculated ( n = 5, P < 0.0001). Sperm from Elapor1 cKO mice were 100% deformed, exhibiting rounded-head. Scale bar = 20 μm. ( I ) IF analysis of sperm acrosome stained with ACRV1 (an acrosome marker, in green) and tail flagellum stained <t>with</t> <t>acetylated</t> <t>tubulin</t> (acTUB, in red) between Elapor1 flox/flox and Elapor1 -cKO sperm. Scale bar = 10 μm., ( J , K ) The ultrastructure of mature sperm in caudal epididymis detected by TEM, showed both sperm head ( J , asterisk indicates acrosome) and mitochondrial sheath (K) of Elapor1 flox/flox and Elapor1 -cKO sperm. Scale bar = 1 μm. (L, M) Flow cytometry analysis of mitochondrial membrane potential in mature sperm by JC-1 staining ( n = 5). Unpaired Student’s t-test (two-sided). Error bar, mean ± SD. ns, no statistically significant difference; **** P < 0.0001; ** P < 0.01; * P < 0.05
    Tubulin, supplied by Proteintech, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/cl594/CL594-conjugated+acetylated+Tubulin(Lys40)+Antibody/pmc13003054-56-17-21
    Average 93 stars, based on 1 article reviews
    tubulin - by Bioz Stars, 2026-09
    93/100 stars
    		  Buy from Supplier
    af488 α tubulin  (Proteintech)
    93
    Proteintech af488 α tubulin
    Elapor1 deficiency led to globozoospermia and asthenozoospermia in mice. ( A ) Representative Western blots for ELAPOR1 showed its deficiency in Elapor1 cKO testis. β-actin served as loading control. ( B ) IHC staining of ELAPOR1 in testicular sections showed significantly reduce of ELAPOR1 expression in Elapor1 cKO testis. Scale bar = 50 μm. ( C ) IF staining of ELAPOR1 in spermatids showed its localization in Golgi apparatus and acrosome was disappeared in Elapor1 cKO spermatids. Pink, ELAPOR1; red, GM130 (Golgi marker); green, PNA-stained acrosome. Scale bar = 5 μm. ( D ) Statistical results of testis index ( n = 6, P = 0.1428) between Elapor1 flox/flox and Elapor1 cKO mice. ( E , F ) Sperm parameters including concentration, motility and progressive motility, evaluated by CASA, showed decline of motility ( n = 8, P < 0.0001) and progressive motility ( n = 8, P < 0.0001) in Elapor1 cKO mice, whereas there was no difference in sperm concentration between two groups ( n = 8, P = 0.5079). ( G , H ) Sperm morphology was stained by Wright-Giemsa staining and the sperm deformity was calculated ( n = 5, P < 0.0001). Sperm from Elapor1 cKO mice were 100% deformed, exhibiting rounded-head. Scale bar = 20 μm. ( I ) IF analysis of sperm acrosome stained with ACRV1 (an acrosome marker, in green) and tail flagellum stained <t>with</t> <t>acetylated</t> <t>tubulin</t> (acTUB, in red) between Elapor1 flox/flox and Elapor1 -cKO sperm. Scale bar = 10 μm., ( J , K ) The ultrastructure of mature sperm in caudal epididymis detected by TEM, showed both sperm head ( J , asterisk indicates acrosome) and mitochondrial sheath (K) of Elapor1 flox/flox and Elapor1 -cKO sperm. Scale bar = 1 μm. (L, M) Flow cytometry analysis of mitochondrial membrane potential in mature sperm by JC-1 staining ( n = 5). Unpaired Student’s t-test (two-sided). Error bar, mean ± SD. ns, no statistically significant difference; **** P < 0.0001; ** P < 0.01; * P < 0.05
    Af488 α Tubulin, supplied by Proteintech, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/cl594/CL594-conjugated+acetylated+Tubulin(Lys40)+Antibody/pm41790259-100-22-21
    Average 93 stars, based on 1 article reviews
    af488 α tubulin - by Bioz Stars, 2026-09
    93/100 stars
    		  Buy from Supplier
    anti mouse coralite594 conjugated  (Proteintech)
    93
    Proteintech anti mouse coralite594 conjugated
    Elapor1 deficiency led to globozoospermia and asthenozoospermia in mice. ( A ) Representative Western blots for ELAPOR1 showed its deficiency in Elapor1 cKO testis. β-actin served as loading control. ( B ) IHC staining of ELAPOR1 in testicular sections showed significantly reduce of ELAPOR1 expression in Elapor1 cKO testis. Scale bar = 50 μm. ( C ) IF staining of ELAPOR1 in spermatids showed its localization in Golgi apparatus and acrosome was disappeared in Elapor1 cKO spermatids. Pink, ELAPOR1; red, GM130 (Golgi marker); green, PNA-stained acrosome. Scale bar = 5 μm. ( D ) Statistical results of testis index ( n = 6, P = 0.1428) between Elapor1 flox/flox and Elapor1 cKO mice. ( E , F ) Sperm parameters including concentration, motility and progressive motility, evaluated by CASA, showed decline of motility ( n = 8, P < 0.0001) and progressive motility ( n = 8, P < 0.0001) in Elapor1 cKO mice, whereas there was no difference in sperm concentration between two groups ( n = 8, P = 0.5079). ( G , H ) Sperm morphology was stained by Wright-Giemsa staining and the sperm deformity was calculated ( n = 5, P < 0.0001). Sperm from Elapor1 cKO mice were 100% deformed, exhibiting rounded-head. Scale bar = 20 μm. ( I ) IF analysis of sperm acrosome stained with ACRV1 (an acrosome marker, in green) and tail flagellum stained <t>with</t> <t>acetylated</t> <t>tubulin</t> (acTUB, in red) between Elapor1 flox/flox and Elapor1 -cKO sperm. Scale bar = 10 μm., ( J , K ) The ultrastructure of mature sperm in caudal epididymis detected by TEM, showed both sperm head ( J , asterisk indicates acrosome) and mitochondrial sheath (K) of Elapor1 flox/flox and Elapor1 -cKO sperm. Scale bar = 1 μm. (L, M) Flow cytometry analysis of mitochondrial membrane potential in mature sperm by JC-1 staining ( n = 5). Unpaired Student’s t-test (two-sided). Error bar, mean ± SD. ns, no statistically significant difference; **** P < 0.0001; ** P < 0.01; * P < 0.05
    Anti Mouse Coralite594 Conjugated, supplied by Proteintech, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/cl594/CoraLite+594-conjugated+HLA-E+Monoclonal+antibody/pmc12963025-101-64-68
    Average 93 stars, based on 1 article reviews
    anti mouse coralite594 conjugated - by Bioz Stars, 2026-09
    93/100 stars
    		  Buy from Supplier
    coralite594 conjugated  (Proteintech)
    95
    Proteintech coralite594 conjugated
    Elapor1 deficiency led to globozoospermia and asthenozoospermia in mice. ( A ) Representative Western blots for ELAPOR1 showed its deficiency in Elapor1 cKO testis. β-actin served as loading control. ( B ) IHC staining of ELAPOR1 in testicular sections showed significantly reduce of ELAPOR1 expression in Elapor1 cKO testis. Scale bar = 50 μm. ( C ) IF staining of ELAPOR1 in spermatids showed its localization in Golgi apparatus and acrosome was disappeared in Elapor1 cKO spermatids. Pink, ELAPOR1; red, GM130 (Golgi marker); green, PNA-stained acrosome. Scale bar = 5 μm. ( D ) Statistical results of testis index ( n = 6, P = 0.1428) between Elapor1 flox/flox and Elapor1 cKO mice. ( E , F ) Sperm parameters including concentration, motility and progressive motility, evaluated by CASA, showed decline of motility ( n = 8, P < 0.0001) and progressive motility ( n = 8, P < 0.0001) in Elapor1 cKO mice, whereas there was no difference in sperm concentration between two groups ( n = 8, P = 0.5079). ( G , H ) Sperm morphology was stained by Wright-Giemsa staining and the sperm deformity was calculated ( n = 5, P < 0.0001). Sperm from Elapor1 cKO mice were 100% deformed, exhibiting rounded-head. Scale bar = 20 μm. ( I ) IF analysis of sperm acrosome stained with ACRV1 (an acrosome marker, in green) and tail flagellum stained <t>with</t> <t>acetylated</t> <t>tubulin</t> (acTUB, in red) between Elapor1 flox/flox and Elapor1 -cKO sperm. Scale bar = 10 μm., ( J , K ) The ultrastructure of mature sperm in caudal epididymis detected by TEM, showed both sperm head ( J , asterisk indicates acrosome) and mitochondrial sheath (K) of Elapor1 flox/flox and Elapor1 -cKO sperm. Scale bar = 1 μm. (L, M) Flow cytometry analysis of mitochondrial membrane potential in mature sperm by JC-1 staining ( n = 5). Unpaired Student’s t-test (two-sided). Error bar, mean ± SD. ns, no statistically significant difference; **** P < 0.0001; ** P < 0.01; * P < 0.05
    Coralite594 Conjugated, supplied by Proteintech, used in various techniques. Bioz Stars score: 95/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/cl594/CoraLite+594-conjugated+CD7+Monoclonal+antibody/pmc12765265-68-7-8
    Average 95 stars, based on 1 article reviews
    coralite594 conjugated - by Bioz Stars, 2026-09
    95/100 stars
    		  Buy from Supplier
    anti flag antibody  (Proteintech)
    93
    Proteintech anti flag antibody
    Elapor1 deficiency led to globozoospermia and asthenozoospermia in mice. ( A ) Representative Western blots for ELAPOR1 showed its deficiency in Elapor1 cKO testis. β-actin served as loading control. ( B ) IHC staining of ELAPOR1 in testicular sections showed significantly reduce of ELAPOR1 expression in Elapor1 cKO testis. Scale bar = 50 μm. ( C ) IF staining of ELAPOR1 in spermatids showed its localization in Golgi apparatus and acrosome was disappeared in Elapor1 cKO spermatids. Pink, ELAPOR1; red, GM130 (Golgi marker); green, PNA-stained acrosome. Scale bar = 5 μm. ( D ) Statistical results of testis index ( n = 6, P = 0.1428) between Elapor1 flox/flox and Elapor1 cKO mice. ( E , F ) Sperm parameters including concentration, motility and progressive motility, evaluated by CASA, showed decline of motility ( n = 8, P < 0.0001) and progressive motility ( n = 8, P < 0.0001) in Elapor1 cKO mice, whereas there was no difference in sperm concentration between two groups ( n = 8, P = 0.5079). ( G , H ) Sperm morphology was stained by Wright-Giemsa staining and the sperm deformity was calculated ( n = 5, P < 0.0001). Sperm from Elapor1 cKO mice were 100% deformed, exhibiting rounded-head. Scale bar = 20 μm. ( I ) IF analysis of sperm acrosome stained with ACRV1 (an acrosome marker, in green) and tail flagellum stained <t>with</t> <t>acetylated</t> <t>tubulin</t> (acTUB, in red) between Elapor1 flox/flox and Elapor1 -cKO sperm. Scale bar = 10 μm., ( J , K ) The ultrastructure of mature sperm in caudal epididymis detected by TEM, showed both sperm head ( J , asterisk indicates acrosome) and mitochondrial sheath (K) of Elapor1 flox/flox and Elapor1 -cKO sperm. Scale bar = 1 μm. (L, M) Flow cytometry analysis of mitochondrial membrane potential in mature sperm by JC-1 staining ( n = 5). Unpaired Student’s t-test (two-sided). Error bar, mean ± SD. ns, no statistically significant difference; **** P < 0.0001; ** P < 0.01; * P < 0.05
    Anti Flag Antibody, supplied by Proteintech, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/cl594/CL594-conjugated+DYKDDDDK+Antibody/pmc12959842-240-51-70
    Average 93 stars, based on 1 article reviews
    anti flag antibody - by Bioz Stars, 2026-09
    93/100 stars
    		  Buy from Supplier

    Image Search Results


    a Immunofluorescence images and quantification (n = 20) of SUMO1 (green) and SUMO2/3 (red) conjugation in RAW264.7 cells with or without STM 14028S infection (4 hpi). Scale bar, 10 µm. b Core SUMO cycle enzymes and their corresponding primary genes (blue). c, d Transcriptomic and proteomic analyses of SUMO cycle enzyme expression in RAW264.7 cells infected with STM 14028S vs uninfected controls (4 hpi; n = 3). e UBC9 mRNA expression in RAW264.7 cells during STM 14028S infection (0-6 hpi; n = 3). f Immunoblot analysis and quantification of UBC9 protein levels in STM 14028S-infected RAW264.7 cells (0-6 hpi; n = 3). *P < 0.05; ***P < 0.001; ns, not significant.

    Journal: bioRxiv

    Article Title: A bacterial effector blocks SUMOylation by steric occlusion of UBC9 via arginine-GlcNAcylation

    doi: 10.64898/2026.03.06.710069

    Figure Lengend Snippet: a Immunofluorescence images and quantification (n = 20) of SUMO1 (green) and SUMO2/3 (red) conjugation in RAW264.7 cells with or without STM 14028S infection (4 hpi). Scale bar, 10 µm. b Core SUMO cycle enzymes and their corresponding primary genes (blue). c, d Transcriptomic and proteomic analyses of SUMO cycle enzyme expression in RAW264.7 cells infected with STM 14028S vs uninfected controls (4 hpi; n = 3). e UBC9 mRNA expression in RAW264.7 cells during STM 14028S infection (0-6 hpi; n = 3). f Immunoblot analysis and quantification of UBC9 protein levels in STM 14028S-infected RAW264.7 cells (0-6 hpi; n = 3). *P < 0.05; ***P < 0.001; ns, not significant.

    Article Snippet: Unique primary antibodies used in this study included UBC9 (CST, #4786), SUMO1 (Proteintech, 67557-1-lg), SUMO2/3 (Proteintech, 67154-1-lg), arginine-GlcNAcylation antibody (Abcam, EPR18251), Myd88 (Proteintech, 67969-1-lg), HSPA8 (Proteintech, 10654-1-AP), PDCD4 (Proteintech, 84162-3-RR).

    Techniques: Immunofluorescence, Conjugation Assay, Infection, Expressing, Western Blot

    a Immunofluorescence images and quantification (n = 20) of SUMO1 (green) and SUMO2/3 (red) conjugation in RAW264.7 cells infected with STM 14028S over a 0-6 hrs time course. Scale bar, 10 µm. b Immunofluorescence images and quantification (n = 20) of SUMO1 (green) and SUMO2/3 (red) conjugation in RAW264.7 cells infected with STM WT or Δ ssaV or left uninfected (4 hpi). Scale bar, 10 µm. c Schematic of the high-content screening (HCS) workflow used to identify T3SS-2 effector(s) required for subversion of host SUMOylation. d SUMO2/3 suppression rates in RAW264.7 cells infected with STM WT or T3SS-2 effector knockout strains (4 hpi). For each sample, fluorescence intensity (FI) was measured across three fields (20 cells per field) to calculate the mean FI (MFI). Suppression rate = (MFI_uninfected - FI_test) / (MFI_uninfected - MFI_WT). e Representative immunofluorescence images of SUMO2/3 conjugation in RAW264.7 cells infected with STM WT, Δ ssaV , Δ sseK1 , or left uninfected (4 hpi). f Immunoblot analysis of SUMO2/3 conjugates in RAW264.7 cells infected with STM WT or Δ sseK1 or left uninfected (4 hpi). *P < 0.05; ***P < 0.001; ns, not significant.

    Journal: bioRxiv

    Article Title: A bacterial effector blocks SUMOylation by steric occlusion of UBC9 via arginine-GlcNAcylation

    doi: 10.64898/2026.03.06.710069

    Figure Lengend Snippet: a Immunofluorescence images and quantification (n = 20) of SUMO1 (green) and SUMO2/3 (red) conjugation in RAW264.7 cells infected with STM 14028S over a 0-6 hrs time course. Scale bar, 10 µm. b Immunofluorescence images and quantification (n = 20) of SUMO1 (green) and SUMO2/3 (red) conjugation in RAW264.7 cells infected with STM WT or Δ ssaV or left uninfected (4 hpi). Scale bar, 10 µm. c Schematic of the high-content screening (HCS) workflow used to identify T3SS-2 effector(s) required for subversion of host SUMOylation. d SUMO2/3 suppression rates in RAW264.7 cells infected with STM WT or T3SS-2 effector knockout strains (4 hpi). For each sample, fluorescence intensity (FI) was measured across three fields (20 cells per field) to calculate the mean FI (MFI). Suppression rate = (MFI_uninfected - FI_test) / (MFI_uninfected - MFI_WT). e Representative immunofluorescence images of SUMO2/3 conjugation in RAW264.7 cells infected with STM WT, Δ ssaV , Δ sseK1 , or left uninfected (4 hpi). f Immunoblot analysis of SUMO2/3 conjugates in RAW264.7 cells infected with STM WT or Δ sseK1 or left uninfected (4 hpi). *P < 0.05; ***P < 0.001; ns, not significant.

    Article Snippet: Unique primary antibodies used in this study included UBC9 (CST, #4786), SUMO1 (Proteintech, 67557-1-lg), SUMO2/3 (Proteintech, 67154-1-lg), arginine-GlcNAcylation antibody (Abcam, EPR18251), Myd88 (Proteintech, 67969-1-lg), HSPA8 (Proteintech, 10654-1-AP), PDCD4 (Proteintech, 84162-3-RR).

    Techniques: Immunofluorescence, Conjugation Assay, Infection, High Content Screening, Knock-Out, Fluorescence, Western Blot

    a Immunoblot analysis of UBC9 Arg-GlcNAcylation mediated by SseK1, SseK2, or SseK3. b AlphaFold-predicted structures of SseK1 (aa 29-336, red), SseK2 (aa 29-348, yellow), and SseK3 (aa 29-335, green), shown with structural alignment using PyMOL. c AlphaFold-modeled structure of the SseK1-UBC9 complex. The enlarged view of the lid-domain region is boxed in black. Residues in the SseK1 lid domain forming hydrogen bonds with UBC9 are shown in stick representation. d Sequence alignment of SseK1, SseK2, and SseK3 generated using ESPript 3.0. e Immunoblot analysis of UBC9 Arg-GlcNAcylation mediated by SseK1, SseK1 A332_Q336del, SseK3, and SseK3 R332delinsARHVQ. f Immunoblot analysis of SUMO2/3 conjugation in RAW264.7 cells infected with STM Δ sseK1 , STM Δ sseK1 complemented with SseK1, or STM Δ sseK1 complemented with either SseK1 D223_D225delinsAAA or SseK1 A332_Q336del (4 hpi). g Phylogenetic analysis of Salmonella Typhimurium SseK1 homologs. Protein sequences homologous to SseK1 (UniProt accession: A0A0H3NK84) were identified using BLASTP analysis against the UniProtKB reference proteomes and Swiss-Prot databases. Sequences with an E-value < 0.05 were selected for phylogenetic analysis. The phylogenetic tree was constructed and visualized using the Interactive Tree of Life (iTOL) online tool.

    Journal: bioRxiv

    Article Title: A bacterial effector blocks SUMOylation by steric occlusion of UBC9 via arginine-GlcNAcylation

    doi: 10.64898/2026.03.06.710069

    Figure Lengend Snippet: a Immunoblot analysis of UBC9 Arg-GlcNAcylation mediated by SseK1, SseK2, or SseK3. b AlphaFold-predicted structures of SseK1 (aa 29-336, red), SseK2 (aa 29-348, yellow), and SseK3 (aa 29-335, green), shown with structural alignment using PyMOL. c AlphaFold-modeled structure of the SseK1-UBC9 complex. The enlarged view of the lid-domain region is boxed in black. Residues in the SseK1 lid domain forming hydrogen bonds with UBC9 are shown in stick representation. d Sequence alignment of SseK1, SseK2, and SseK3 generated using ESPript 3.0. e Immunoblot analysis of UBC9 Arg-GlcNAcylation mediated by SseK1, SseK1 A332_Q336del, SseK3, and SseK3 R332delinsARHVQ. f Immunoblot analysis of SUMO2/3 conjugation in RAW264.7 cells infected with STM Δ sseK1 , STM Δ sseK1 complemented with SseK1, or STM Δ sseK1 complemented with either SseK1 D223_D225delinsAAA or SseK1 A332_Q336del (4 hpi). g Phylogenetic analysis of Salmonella Typhimurium SseK1 homologs. Protein sequences homologous to SseK1 (UniProt accession: A0A0H3NK84) were identified using BLASTP analysis against the UniProtKB reference proteomes and Swiss-Prot databases. Sequences with an E-value < 0.05 were selected for phylogenetic analysis. The phylogenetic tree was constructed and visualized using the Interactive Tree of Life (iTOL) online tool.

    Article Snippet: Unique primary antibodies used in this study included UBC9 (CST, #4786), SUMO1 (Proteintech, 67557-1-lg), SUMO2/3 (Proteintech, 67154-1-lg), arginine-GlcNAcylation antibody (Abcam, EPR18251), Myd88 (Proteintech, 67969-1-lg), HSPA8 (Proteintech, 10654-1-AP), PDCD4 (Proteintech, 84162-3-RR).

    Techniques: Western Blot, Sequencing, Generated, Conjugation Assay, Infection, Construct

    a Protein SUMOylation sites showing a >3-fold increase in SUMOylation intensity in STM Δ sseK1 -infected cells relative to WT. SUMOylation intensity was normalized to the corresponding protein abundance measured in proteomic datasets from STM Δ sseK1 - or WT-infected RAW264.7 cells. b GO and KEGG pathway enrichment analysis of proteins with SUMOylation intensity ratio (Δ sseK1 /WT) > 3. c, d IP analysis of Myd88 and Hspa8 SUMO2/3 modification in RAW264.7 cells infected with STM WT or Δ sseK1 or left uninfected (4 hpi). e Immunoblot analysis of SUMO2/3 modification in RAW-SseK1-OE and RAW-GFP-Ctrl cells. f Nine-quadrant plot showing protein abundance changes in two proteomic comparisons (RAW-SseK1-OE vs RAW-GFP-Ctrl and STM WT-infected vs Δ sseK1 -infected cells). Highlighted proteins are downregulated in both datasets. Fold-change values within dashed lines indicate <|1.3|. g Immunoblot analysis of PDCD4 expression in RAW-SseK1-OE and RAW-GFP-Ctrl cells. h Immunoblot analysis of PDCD4 and SUMO2/3 levels in RAW264.7 cells treated with increasing concentrations of the SUMOylation inhibitor 2-D08. ***P < 0.001.

    Journal: bioRxiv

    Article Title: A bacterial effector blocks SUMOylation by steric occlusion of UBC9 via arginine-GlcNAcylation

    doi: 10.64898/2026.03.06.710069

    Figure Lengend Snippet: a Protein SUMOylation sites showing a >3-fold increase in SUMOylation intensity in STM Δ sseK1 -infected cells relative to WT. SUMOylation intensity was normalized to the corresponding protein abundance measured in proteomic datasets from STM Δ sseK1 - or WT-infected RAW264.7 cells. b GO and KEGG pathway enrichment analysis of proteins with SUMOylation intensity ratio (Δ sseK1 /WT) > 3. c, d IP analysis of Myd88 and Hspa8 SUMO2/3 modification in RAW264.7 cells infected with STM WT or Δ sseK1 or left uninfected (4 hpi). e Immunoblot analysis of SUMO2/3 modification in RAW-SseK1-OE and RAW-GFP-Ctrl cells. f Nine-quadrant plot showing protein abundance changes in two proteomic comparisons (RAW-SseK1-OE vs RAW-GFP-Ctrl and STM WT-infected vs Δ sseK1 -infected cells). Highlighted proteins are downregulated in both datasets. Fold-change values within dashed lines indicate <|1.3|. g Immunoblot analysis of PDCD4 expression in RAW-SseK1-OE and RAW-GFP-Ctrl cells. h Immunoblot analysis of PDCD4 and SUMO2/3 levels in RAW264.7 cells treated with increasing concentrations of the SUMOylation inhibitor 2-D08. ***P < 0.001.

    Article Snippet: Unique primary antibodies used in this study included UBC9 (CST, #4786), SUMO1 (Proteintech, 67557-1-lg), SUMO2/3 (Proteintech, 67154-1-lg), arginine-GlcNAcylation antibody (Abcam, EPR18251), Myd88 (Proteintech, 67969-1-lg), HSPA8 (Proteintech, 10654-1-AP), PDCD4 (Proteintech, 84162-3-RR).

    Techniques: Infection, Quantitative Proteomics, Modification, Western Blot, Expressing

    a Intracellular survival of STM WT and Δ sseK1 strains in RAW264.7 cells (1-6 hpi). n = 3. b Schematic of the experimental workflow for 2-D08 treatment and Salmonella infection of RAW264.7 cells. c Intracellular survival of STM WT and Δ sseK1 strains in RAW264.7 cells with or without 2-D08 pretreatment (4 hpi). d Schematic of the experimental workflow for 2-D08 administration and STM challenge in C57BL/6 mice. e Immunoblot analysis of SUMO2/3 modification in liver, spleen, and intestine tissues from C57BL/6 mice challenged with STM WT or Δ sseK1 , with or without 2-D08 pretreatment. f Bacterial load (CFU per gram of liver or spleen) in C57BL/6 mice infected with STM WT or Δ sseK1 . n = 4. g Survival curves of C57BL/6 mice challenged with STM WT or Δ sseK1 , with or without 2-D08 pretreatment. n = 6. *P < 0.05; **P < 0.01; ***P < 0.001; ns, not significant.

    Journal: bioRxiv

    Article Title: A bacterial effector blocks SUMOylation by steric occlusion of UBC9 via arginine-GlcNAcylation

    doi: 10.64898/2026.03.06.710069

    Figure Lengend Snippet: a Intracellular survival of STM WT and Δ sseK1 strains in RAW264.7 cells (1-6 hpi). n = 3. b Schematic of the experimental workflow for 2-D08 treatment and Salmonella infection of RAW264.7 cells. c Intracellular survival of STM WT and Δ sseK1 strains in RAW264.7 cells with or without 2-D08 pretreatment (4 hpi). d Schematic of the experimental workflow for 2-D08 administration and STM challenge in C57BL/6 mice. e Immunoblot analysis of SUMO2/3 modification in liver, spleen, and intestine tissues from C57BL/6 mice challenged with STM WT or Δ sseK1 , with or without 2-D08 pretreatment. f Bacterial load (CFU per gram of liver or spleen) in C57BL/6 mice infected with STM WT or Δ sseK1 . n = 4. g Survival curves of C57BL/6 mice challenged with STM WT or Δ sseK1 , with or without 2-D08 pretreatment. n = 6. *P < 0.05; **P < 0.01; ***P < 0.001; ns, not significant.

    Article Snippet: Unique primary antibodies used in this study included UBC9 (CST, #4786), SUMO1 (Proteintech, 67557-1-lg), SUMO2/3 (Proteintech, 67154-1-lg), arginine-GlcNAcylation antibody (Abcam, EPR18251), Myd88 (Proteintech, 67969-1-lg), HSPA8 (Proteintech, 10654-1-AP), PDCD4 (Proteintech, 84162-3-RR).

    Techniques: Infection, Western Blot, Modification

    Elapor1 deficiency led to globozoospermia and asthenozoospermia in mice. ( A ) Representative Western blots for ELAPOR1 showed its deficiency in Elapor1 cKO testis. β-actin served as loading control. ( B ) IHC staining of ELAPOR1 in testicular sections showed significantly reduce of ELAPOR1 expression in Elapor1 cKO testis. Scale bar = 50 μm. ( C ) IF staining of ELAPOR1 in spermatids showed its localization in Golgi apparatus and acrosome was disappeared in Elapor1 cKO spermatids. Pink, ELAPOR1; red, GM130 (Golgi marker); green, PNA-stained acrosome. Scale bar = 5 μm. ( D ) Statistical results of testis index ( n = 6, P = 0.1428) between Elapor1 flox/flox and Elapor1 cKO mice. ( E , F ) Sperm parameters including concentration, motility and progressive motility, evaluated by CASA, showed decline of motility ( n = 8, P < 0.0001) and progressive motility ( n = 8, P < 0.0001) in Elapor1 cKO mice, whereas there was no difference in sperm concentration between two groups ( n = 8, P = 0.5079). ( G , H ) Sperm morphology was stained by Wright-Giemsa staining and the sperm deformity was calculated ( n = 5, P < 0.0001). Sperm from Elapor1 cKO mice were 100% deformed, exhibiting rounded-head. Scale bar = 20 μm. ( I ) IF analysis of sperm acrosome stained with ACRV1 (an acrosome marker, in green) and tail flagellum stained with acetylated tubulin (acTUB, in red) between Elapor1 flox/flox and Elapor1 -cKO sperm. Scale bar = 10 μm., ( J , K ) The ultrastructure of mature sperm in caudal epididymis detected by TEM, showed both sperm head ( J , asterisk indicates acrosome) and mitochondrial sheath (K) of Elapor1 flox/flox and Elapor1 -cKO sperm. Scale bar = 1 μm. (L, M) Flow cytometry analysis of mitochondrial membrane potential in mature sperm by JC-1 staining ( n = 5). Unpaired Student’s t-test (two-sided). Error bar, mean ± SD. ns, no statistically significant difference; **** P < 0.0001; ** P < 0.01; * P < 0.05

    Journal: Cellular and Molecular Life Sciences: CMLS

    Article Title: ELAPOR1 mediated vesicle traffic is required for acrosome biogenesis and male fertility in mice

    doi: 10.1007/s00018-026-06125-0

    Figure Lengend Snippet: Elapor1 deficiency led to globozoospermia and asthenozoospermia in mice. ( A ) Representative Western blots for ELAPOR1 showed its deficiency in Elapor1 cKO testis. β-actin served as loading control. ( B ) IHC staining of ELAPOR1 in testicular sections showed significantly reduce of ELAPOR1 expression in Elapor1 cKO testis. Scale bar = 50 μm. ( C ) IF staining of ELAPOR1 in spermatids showed its localization in Golgi apparatus and acrosome was disappeared in Elapor1 cKO spermatids. Pink, ELAPOR1; red, GM130 (Golgi marker); green, PNA-stained acrosome. Scale bar = 5 μm. ( D ) Statistical results of testis index ( n = 6, P = 0.1428) between Elapor1 flox/flox and Elapor1 cKO mice. ( E , F ) Sperm parameters including concentration, motility and progressive motility, evaluated by CASA, showed decline of motility ( n = 8, P < 0.0001) and progressive motility ( n = 8, P < 0.0001) in Elapor1 cKO mice, whereas there was no difference in sperm concentration between two groups ( n = 8, P = 0.5079). ( G , H ) Sperm morphology was stained by Wright-Giemsa staining and the sperm deformity was calculated ( n = 5, P < 0.0001). Sperm from Elapor1 cKO mice were 100% deformed, exhibiting rounded-head. Scale bar = 20 μm. ( I ) IF analysis of sperm acrosome stained with ACRV1 (an acrosome marker, in green) and tail flagellum stained with acetylated tubulin (acTUB, in red) between Elapor1 flox/flox and Elapor1 -cKO sperm. Scale bar = 10 μm., ( J , K ) The ultrastructure of mature sperm in caudal epididymis detected by TEM, showed both sperm head ( J , asterisk indicates acrosome) and mitochondrial sheath (K) of Elapor1 flox/flox and Elapor1 -cKO sperm. Scale bar = 1 μm. (L, M) Flow cytometry analysis of mitochondrial membrane potential in mature sperm by JC-1 staining ( n = 5). Unpaired Student’s t-test (two-sided). Error bar, mean ± SD. ns, no statistically significant difference; **** P < 0.0001; ** P < 0.01; * P < 0.05

    Article Snippet: After washing, the slides were incubated with responding secondary antibodies or fluorescein conjugated antibodies/dyes including coraLite594-conjugated acetylated tubulin (1:1000 dilution, #CL594-66200, Proteintech), AF488-α-tubulin (1:200 dilution, #8058, CST) and FITC-PNA (1:500 dilution, #L7381, Sigma), followed by incubated with DAPI Fluoromount (#36308ES, Yeasen, China).

    Techniques: Western Blot, Control, Immunohistochemistry, Expressing, Staining, Marker, Concentration Assay, Flow Cytometry, Membrane

    ELAPOR1 deficiency led to abnormal acrosome biogenesis during spermiogenesis. ( A ) The histological structures of the seminiferous epithelium at different stages analyzed by HE staining showed amorphous head in elongating spermatids from Elapor1 cKO mice. Blue arrows indicated elongating spermatids. Scale bar = 50 μm. ( B ) IF staining of ACRV1 represent the acrosome status showed the absence of acrosome in the seminiferous epithelium at different stages in Elapor1 cKO mice. Green, ACRV1; blue, DAPI. Scale bar = 50 μm. ( C ) Acrosome biogenesis in spermatids at Golgi, cap, acrosome and maturation phases was evaluated by IF staining of GM130 (a Golgi marker, in red color) and PNA (an acrosome marker, in green color). Elapor1 cKO spermatids lacked the acrosome signal which ought to localize between the Golgi apparatus and the nucleus. Scale bar = 5 μm. ( D ) A schematic diagram of acrosome formation in control and Elapor1 cKO spermatids, corresponding to ( C ). ( E ) Elongating spermatids stained with ACRV1 (an acrosome marker, in pink color) and α-Tubulin (visualizing the manchette, in green color) showed the absence of acrosome and abnormal microtubule cytoskeleton in Elapor1 cKO spermatids during spermatid elongation. Scale bar = 5 μm

    Journal: Cellular and Molecular Life Sciences: CMLS

    Article Title: ELAPOR1 mediated vesicle traffic is required for acrosome biogenesis and male fertility in mice

    doi: 10.1007/s00018-026-06125-0

    Figure Lengend Snippet: ELAPOR1 deficiency led to abnormal acrosome biogenesis during spermiogenesis. ( A ) The histological structures of the seminiferous epithelium at different stages analyzed by HE staining showed amorphous head in elongating spermatids from Elapor1 cKO mice. Blue arrows indicated elongating spermatids. Scale bar = 50 μm. ( B ) IF staining of ACRV1 represent the acrosome status showed the absence of acrosome in the seminiferous epithelium at different stages in Elapor1 cKO mice. Green, ACRV1; blue, DAPI. Scale bar = 50 μm. ( C ) Acrosome biogenesis in spermatids at Golgi, cap, acrosome and maturation phases was evaluated by IF staining of GM130 (a Golgi marker, in red color) and PNA (an acrosome marker, in green color). Elapor1 cKO spermatids lacked the acrosome signal which ought to localize between the Golgi apparatus and the nucleus. Scale bar = 5 μm. ( D ) A schematic diagram of acrosome formation in control and Elapor1 cKO spermatids, corresponding to ( C ). ( E ) Elongating spermatids stained with ACRV1 (an acrosome marker, in pink color) and α-Tubulin (visualizing the manchette, in green color) showed the absence of acrosome and abnormal microtubule cytoskeleton in Elapor1 cKO spermatids during spermatid elongation. Scale bar = 5 μm

    Article Snippet: After washing, the slides were incubated with responding secondary antibodies or fluorescein conjugated antibodies/dyes including coraLite594-conjugated acetylated tubulin (1:1000 dilution, #CL594-66200, Proteintech), AF488-α-tubulin (1:200 dilution, #8058, CST) and FITC-PNA (1:500 dilution, #L7381, Sigma), followed by incubated with DAPI Fluoromount (#36308ES, Yeasen, China).

    Techniques: Staining, Marker, Control