Review




Structured Review

Sysmex Corporation cd38
Cd38, supplied by Sysmex Corporation, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/cd38/anti+cd38/pmc13202784-106-13-21
Average 86 stars, based on 1 article reviews
cd38 - by Bioz Stars, 2026-08
86/100 stars

Images



Similar Products

93
Miltenyi Biotec anti mouse cd38 pe vio770
Anti Mouse Cd38 Pe Vio770, supplied by Miltenyi Biotec, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/cd38/CD38+Antibody%2C+anti-mouse/pmc13337242-96-3-7
Average 93 stars, based on 1 article reviews
anti mouse cd38 pe vio770 - by Bioz Stars, 2026-08
93/100 stars
  Buy from Supplier

94
MedChemExpress 78c
In vitro inhibition of CD38 enzymatic activity (A–C) Time course of CD38 inhibition. CD38 enzymatic activity was measured over time in the presence of increasing concentrations of RP02 (scFv-Fc) (A), 028 (IgG1) (B), and hIgG1(Negative control) (C). Inhibition was quantified as the reduction in cyclic GDP-ribose (cGDPR) generated from the substrate NGD + . Error bars are represented by the shaded region. Different concentrations of antibodies are indicated on the graph. Statistical significance between the 0 nM group and other concentrations in (C) was determined by two-way ANOVA. Non-significant ( ns ) comparisons are not displayed. (D) cGDPR production at 120 min. Product yield was measured for the samples (hIgG, RP02, 028, and <t>78c)</t> over a concentration gradient. For all panels, product formation was quantified in Relative Fluorescence Units (RFU) with excitation at 300 nm and emission at 410 nm. The corresponding IC 50 value is displayed alongside its legend.
78c, supplied by MedChemExpress, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/cd38/CD38+inhibitor+1/pmc13233800-43-0-2
Average 94 stars, based on 1 article reviews
78c - by Bioz Stars, 2026-08
94/100 stars
  Buy from Supplier

93
NSJ Bioreagents cd38 antibody
In vitro inhibition of CD38 enzymatic activity (A–C) Time course of CD38 inhibition. CD38 enzymatic activity was measured over time in the presence of increasing concentrations of RP02 (scFv-Fc) (A), 028 (IgG1) (B), and hIgG1(Negative control) (C). Inhibition was quantified as the reduction in cyclic GDP-ribose (cGDPR) generated from the substrate NGD + . Error bars are represented by the shaded region. Different concentrations of antibodies are indicated on the graph. Statistical significance between the 0 nM group and other concentrations in (C) was determined by two-way ANOVA. Non-significant ( ns ) comparisons are not displayed. (D) cGDPR production at 120 min. Product yield was measured for the samples (hIgG, RP02, 028, and <t>78c)</t> over a concentration gradient. For all panels, product formation was quantified in Relative Fluorescence Units (RFU) with excitation at 300 nm and emission at 410 nm. The corresponding IC 50 value is displayed alongside its legend.
Cd38 Antibody, supplied by NSJ Bioreagents, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/cd38/CD38+Antibody/custom%40v3007%4042091932
Average 93 stars, based on 1 article reviews
cd38 antibody - by Bioz Stars, 2026-08
93/100 stars
  Buy from Supplier

94
OriGene ggtccaagtgatgctcaatggg
In vitro inhibition of CD38 enzymatic activity (A–C) Time course of CD38 inhibition. CD38 enzymatic activity was measured over time in the presence of increasing concentrations of RP02 (scFv-Fc) (A), 028 (IgG1) (B), and hIgG1(Negative control) (C). Inhibition was quantified as the reduction in cyclic GDP-ribose (cGDPR) generated from the substrate NGD + . Error bars are represented by the shaded region. Different concentrations of antibodies are indicated on the graph. Statistical significance between the 0 nM group and other concentrations in (C) was determined by two-way ANOVA. Non-significant ( ns ) comparisons are not displayed. (D) cGDPR production at 120 min. Product yield was measured for the samples (hIgG, RP02, 028, and <t>78c)</t> over a concentration gradient. For all panels, product formation was quantified in Relative Fluorescence Units (RFU) with excitation at 300 nm and emission at 410 nm. The corresponding IC 50 value is displayed alongside its legend.
Ggtccaagtgatgctcaatggg, supplied by OriGene, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/cd38/Cd38+Mouse+qPCR+Primer+Pair/pm42244013-162-8-13
Average 94 stars, based on 1 article reviews
ggtccaagtgatgctcaatggg - by Bioz Stars, 2026-08
94/100 stars
  Buy from Supplier

86
Johnson & Johnson daratumumab cd38
In vitro inhibition of CD38 enzymatic activity (A–C) Time course of CD38 inhibition. CD38 enzymatic activity was measured over time in the presence of increasing concentrations of RP02 (scFv-Fc) (A), 028 (IgG1) (B), and hIgG1(Negative control) (C). Inhibition was quantified as the reduction in cyclic GDP-ribose (cGDPR) generated from the substrate NGD + . Error bars are represented by the shaded region. Different concentrations of antibodies are indicated on the graph. Statistical significance between the 0 nM group and other concentrations in (C) was determined by two-way ANOVA. Non-significant ( ns ) comparisons are not displayed. (D) cGDPR production at 120 min. Product yield was measured for the samples (hIgG, RP02, 028, and <t>78c)</t> over a concentration gradient. For all panels, product formation was quantified in Relative Fluorescence Units (RFU) with excitation at 300 nm and emission at 410 nm. The corresponding IC 50 value is displayed alongside its legend.
Daratumumab Cd38, supplied by Johnson & Johnson, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/cd38/cd38+daratumumab/pmc13059328-67-0-17
Average 86 stars, based on 1 article reviews
daratumumab cd38 - by Bioz Stars, 2026-08
86/100 stars
  Buy from Supplier

86
Grifols soluble cd38
In vitro inhibition of CD38 enzymatic activity (A–C) Time course of CD38 inhibition. CD38 enzymatic activity was measured over time in the presence of increasing concentrations of RP02 (scFv-Fc) (A), 028 (IgG1) (B), and hIgG1(Negative control) (C). Inhibition was quantified as the reduction in cyclic GDP-ribose (cGDPR) generated from the substrate NGD + . Error bars are represented by the shaded region. Different concentrations of antibodies are indicated on the graph. Statistical significance between the 0 nM group and other concentrations in (C) was determined by two-way ANOVA. Non-significant ( ns ) comparisons are not displayed. (D) cGDPR production at 120 min. Product yield was measured for the samples (hIgG, RP02, 028, and <t>78c)</t> over a concentration gradient. For all panels, product formation was quantified in Relative Fluorescence Units (RFU) with excitation at 300 nm and emission at 410 nm. The corresponding IC 50 value is displayed alongside its legend.
Soluble Cd38, supplied by Grifols, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/cd38/grifols+scd38/pm42312388-11531-0-3
Average 86 stars, based on 1 article reviews
soluble cd38 - by Bioz Stars, 2026-08
86/100 stars
  Buy from Supplier

86
Grifols soluble cd38 reagent
In vitro inhibition of CD38 enzymatic activity (A–C) Time course of CD38 inhibition. CD38 enzymatic activity was measured over time in the presence of increasing concentrations of RP02 (scFv-Fc) (A), 028 (IgG1) (B), and hIgG1(Negative control) (C). Inhibition was quantified as the reduction in cyclic GDP-ribose (cGDPR) generated from the substrate NGD + . Error bars are represented by the shaded region. Different concentrations of antibodies are indicated on the graph. Statistical significance between the 0 nM group and other concentrations in (C) was determined by two-way ANOVA. Non-significant ( ns ) comparisons are not displayed. (D) cGDPR production at 120 min. Product yield was measured for the samples (hIgG, RP02, 028, and <t>78c)</t> over a concentration gradient. For all panels, product formation was quantified in Relative Fluorescence Units (RFU) with excitation at 300 nm and emission at 410 nm. The corresponding IC 50 value is displayed alongside its legend.
Soluble Cd38 Reagent, supplied by Grifols, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/cd38/grifols+scd38/pm42312388-12661-1-5
Average 86 stars, based on 1 article reviews
soluble cd38 reagent - by Bioz Stars, 2026-08
86/100 stars
  Buy from Supplier

93
R&D Systems cd38
Establishment and characterization of a fibrotic macrophage-muscle fibrosis model. a) Brightfield image of unstimulated RAW264.7 cells in the top chamber of a RAW-C2C12 coculture system, b) Brightfield image of C2C12 cells in the bottom chamber under basal coculture conditions, c) Fluorescence image of C2C12 cells in the bottom chamber exhibiting myotube morphology, d) Fluorescence image confirming the absence of fibrotic marker expression in C2C12 cells under basal conditions, e) Brightfield image of LPS-activated RAW264.7 cells in the top chamber, f) Brightfield image of C2C12 cells in the bottom chamber displaying a myofibroblast-like morphology post-LPS activation, g) Fluorescence image of phenotypic transition of C2C12 cells to myofibroblast-like cells, h) Fluorescence image demonstrating fibrotic protein expression in LPS-treated C2C12 cells (magenta arrow indicates <t>CD38</t> cells). Immunostaining images: In panels c) and g), TGF-β, DAPI, and actin are colored red, blue, and green, respectively. In panels d) and h), COL1, α-SMA, CD38, and DAPI are colored red, blue, magenta, and green, respectively. (For interpretation of the references to color in this figure legend, the reader is referred to the Web version of this article.)
Cd38, supplied by R&D Systems, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/cd38/Mouse+CD38+Antibody/pmc13059309-44-8-27
Average 93 stars, based on 1 article reviews
cd38 - by Bioz Stars, 2026-08
93/100 stars
  Buy from Supplier

86
Sysmex Corporation cd38
Establishment and characterization of a fibrotic macrophage-muscle fibrosis model. a) Brightfield image of unstimulated RAW264.7 cells in the top chamber of a RAW-C2C12 coculture system, b) Brightfield image of C2C12 cells in the bottom chamber under basal coculture conditions, c) Fluorescence image of C2C12 cells in the bottom chamber exhibiting myotube morphology, d) Fluorescence image confirming the absence of fibrotic marker expression in C2C12 cells under basal conditions, e) Brightfield image of LPS-activated RAW264.7 cells in the top chamber, f) Brightfield image of C2C12 cells in the bottom chamber displaying a myofibroblast-like morphology post-LPS activation, g) Fluorescence image of phenotypic transition of C2C12 cells to myofibroblast-like cells, h) Fluorescence image demonstrating fibrotic protein expression in LPS-treated C2C12 cells (magenta arrow indicates <t>CD38</t> cells). Immunostaining images: In panels c) and g), TGF-β, DAPI, and actin are colored red, blue, and green, respectively. In panels d) and h), COL1, α-SMA, CD38, and DAPI are colored red, blue, magenta, and green, respectively. (For interpretation of the references to color in this figure legend, the reader is referred to the Web version of this article.)
Cd38, supplied by Sysmex Corporation, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/cd38/anti+cd38/pmc13202784-106-13-21
Average 86 stars, based on 1 article reviews
cd38 - by Bioz Stars, 2026-08
86/100 stars
  Buy from Supplier

95
Miltenyi Biotec cd38
Reconstitution of B-cells over time. To characterize B-cell subsets, peripheral blood mononuclear cells were stained with fluorochrome-conjugated monoclonal antibodies (BD Biosciences) directed against the following antigens: CD45 (V500-C), CD3 (APC), CD19 (APC-H7), CD27 (BV421), IgD (PE), <t>CD38</t> <t>(BV711),</t> CD4 (BV605), and CD8 (PE), as well as 7-AAD (Miltenyi Biotech). The stained cells were then analyzed using multicolor flow cytometry (BD FACS Lyric). The subsets of gated CD19 + cells were identified based on surface marker expression as follows: naïve (CD19+CD27-IgD+), nonswitched memory (CD19+CD27+IgD+), switched memory (CD19+CD27+IgD-), and double negative (CD19+CD27-IgD-); and within the CD19+CD38++ population, we distinguished transitional cells (CD19+CD38++CD27-IgD+), plasmablasts (CD19+CD38++CD27+IgD-), and double-negative CD38 + cells (CD19+CD38++CD27-IgD-). B-cell subsets were expressed as a percentage of the total lymphocyte count. (a) B-cell subpopulations were assessed in 39 patients at baseline and in 36 patients at 3 (M3), 6 (M6), 9 (M9), 12 (M12), and 18 (M18) months following the first rituximab infusion. The 3 patients who did not receive treatment were excluded from the follow-up. Complete depletion of B-cells was observed in all patients at M3 post-rituximab for all B-cell subpopulations. CD19 + cells reappeared 6 months after rituximab infusion. Naive cells re-emerged the most among B-cells, followed by CD38 + cells, transitional cells and finally memory cells. Data are shown as mean values (dots). (b–k) B-cell subpopulations at baseline and at subsequent time points were compared between relapsing patients ( n = 8) and nonrelapsing patients ( n = 19); the 2 patients who received additional anti-CD20 infusions were excluded from subsequent analyses. Data are shown as medians and interquartile range (IQR). P -values were calculated by comparing the median values of each cell subpopulation between relapsing and nonrelapsing patients using a nonparametric, unpaired Mann–Whitney U test.
Cd38, supplied by Miltenyi Biotec, used in various techniques. Bioz Stars score: 95/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/cd38/CD271+(LNGFR)+Antibody%2C+anti-human%2C+REAfinity/pmc13022648-89-31-42
Average 95 stars, based on 1 article reviews
cd38 - by Bioz Stars, 2026-08
95/100 stars
  Buy from Supplier

Image Search Results


In vitro inhibition of CD38 enzymatic activity (A–C) Time course of CD38 inhibition. CD38 enzymatic activity was measured over time in the presence of increasing concentrations of RP02 (scFv-Fc) (A), 028 (IgG1) (B), and hIgG1(Negative control) (C). Inhibition was quantified as the reduction in cyclic GDP-ribose (cGDPR) generated from the substrate NGD + . Error bars are represented by the shaded region. Different concentrations of antibodies are indicated on the graph. Statistical significance between the 0 nM group and other concentrations in (C) was determined by two-way ANOVA. Non-significant ( ns ) comparisons are not displayed. (D) cGDPR production at 120 min. Product yield was measured for the samples (hIgG, RP02, 028, and 78c) over a concentration gradient. For all panels, product formation was quantified in Relative Fluorescence Units (RFU) with excitation at 300 nm and emission at 410 nm. The corresponding IC 50 value is displayed alongside its legend.

Journal: iScience

Article Title: Structural dissection of CD38 antigen engagement by CAR binders and rational affinity tuning

doi: 10.1016/j.isci.2026.115937

Figure Lengend Snippet: In vitro inhibition of CD38 enzymatic activity (A–C) Time course of CD38 inhibition. CD38 enzymatic activity was measured over time in the presence of increasing concentrations of RP02 (scFv-Fc) (A), 028 (IgG1) (B), and hIgG1(Negative control) (C). Inhibition was quantified as the reduction in cyclic GDP-ribose (cGDPR) generated from the substrate NGD + . Error bars are represented by the shaded region. Different concentrations of antibodies are indicated on the graph. Statistical significance between the 0 nM group and other concentrations in (C) was determined by two-way ANOVA. Non-significant ( ns ) comparisons are not displayed. (D) cGDPR production at 120 min. Product yield was measured for the samples (hIgG, RP02, 028, and 78c) over a concentration gradient. For all panels, product formation was quantified in Relative Fluorescence Units (RFU) with excitation at 300 nm and emission at 410 nm. The corresponding IC 50 value is displayed alongside its legend.

Article Snippet: 78c , MedChemExpress , Cat#HY-123999.

Techniques: In Vitro, Inhibition, Activity Assay, Negative Control, Generated, Concentration Assay, Fluorescence

Establishment and characterization of a fibrotic macrophage-muscle fibrosis model. a) Brightfield image of unstimulated RAW264.7 cells in the top chamber of a RAW-C2C12 coculture system, b) Brightfield image of C2C12 cells in the bottom chamber under basal coculture conditions, c) Fluorescence image of C2C12 cells in the bottom chamber exhibiting myotube morphology, d) Fluorescence image confirming the absence of fibrotic marker expression in C2C12 cells under basal conditions, e) Brightfield image of LPS-activated RAW264.7 cells in the top chamber, f) Brightfield image of C2C12 cells in the bottom chamber displaying a myofibroblast-like morphology post-LPS activation, g) Fluorescence image of phenotypic transition of C2C12 cells to myofibroblast-like cells, h) Fluorescence image demonstrating fibrotic protein expression in LPS-treated C2C12 cells (magenta arrow indicates CD38 cells). Immunostaining images: In panels c) and g), TGF-β, DAPI, and actin are colored red, blue, and green, respectively. In panels d) and h), COL1, α-SMA, CD38, and DAPI are colored red, blue, magenta, and green, respectively. (For interpretation of the references to color in this figure legend, the reader is referred to the Web version of this article.)

Journal: Materials Today Bio

Article Title: Injectable antifibrotic drug-loaded hydrogels reduce fibrosis and restore myogenesis by enhancing mitochondrial metabolism and cell mechanics in an in vitro coculture model

doi: 10.1016/j.mtbio.2026.103033

Figure Lengend Snippet: Establishment and characterization of a fibrotic macrophage-muscle fibrosis model. a) Brightfield image of unstimulated RAW264.7 cells in the top chamber of a RAW-C2C12 coculture system, b) Brightfield image of C2C12 cells in the bottom chamber under basal coculture conditions, c) Fluorescence image of C2C12 cells in the bottom chamber exhibiting myotube morphology, d) Fluorescence image confirming the absence of fibrotic marker expression in C2C12 cells under basal conditions, e) Brightfield image of LPS-activated RAW264.7 cells in the top chamber, f) Brightfield image of C2C12 cells in the bottom chamber displaying a myofibroblast-like morphology post-LPS activation, g) Fluorescence image of phenotypic transition of C2C12 cells to myofibroblast-like cells, h) Fluorescence image demonstrating fibrotic protein expression in LPS-treated C2C12 cells (magenta arrow indicates CD38 cells). Immunostaining images: In panels c) and g), TGF-β, DAPI, and actin are colored red, blue, and green, respectively. In panels d) and h), COL1, α-SMA, CD38, and DAPI are colored red, blue, magenta, and green, respectively. (For interpretation of the references to color in this figure legend, the reader is referred to the Web version of this article.)

Article Snippet: Mouse monoclonal antibodies against myosin heavy chain (MyHC), CD38, and transforming growth factor-β (TGF-β), as well as rabbit polyclonal α-smooth muscle actin (α-SMA) antibodies, were purchased from R&D Systems (USA).

Techniques: Fluorescence, Marker, Expressing, Activation Assay, Immunostaining

Reconstitution of B-cells over time. To characterize B-cell subsets, peripheral blood mononuclear cells were stained with fluorochrome-conjugated monoclonal antibodies (BD Biosciences) directed against the following antigens: CD45 (V500-C), CD3 (APC), CD19 (APC-H7), CD27 (BV421), IgD (PE), CD38 (BV711), CD4 (BV605), and CD8 (PE), as well as 7-AAD (Miltenyi Biotech). The stained cells were then analyzed using multicolor flow cytometry (BD FACS Lyric). The subsets of gated CD19 + cells were identified based on surface marker expression as follows: naïve (CD19+CD27-IgD+), nonswitched memory (CD19+CD27+IgD+), switched memory (CD19+CD27+IgD-), and double negative (CD19+CD27-IgD-); and within the CD19+CD38++ population, we distinguished transitional cells (CD19+CD38++CD27-IgD+), plasmablasts (CD19+CD38++CD27+IgD-), and double-negative CD38 + cells (CD19+CD38++CD27-IgD-). B-cell subsets were expressed as a percentage of the total lymphocyte count. (a) B-cell subpopulations were assessed in 39 patients at baseline and in 36 patients at 3 (M3), 6 (M6), 9 (M9), 12 (M12), and 18 (M18) months following the first rituximab infusion. The 3 patients who did not receive treatment were excluded from the follow-up. Complete depletion of B-cells was observed in all patients at M3 post-rituximab for all B-cell subpopulations. CD19 + cells reappeared 6 months after rituximab infusion. Naive cells re-emerged the most among B-cells, followed by CD38 + cells, transitional cells and finally memory cells. Data are shown as mean values (dots). (b–k) B-cell subpopulations at baseline and at subsequent time points were compared between relapsing patients ( n = 8) and nonrelapsing patients ( n = 19); the 2 patients who received additional anti-CD20 infusions were excluded from subsequent analyses. Data are shown as medians and interquartile range (IQR). P -values were calculated by comparing the median values of each cell subpopulation between relapsing and nonrelapsing patients using a nonparametric, unpaired Mann–Whitney U test.

Journal: Kidney International Reports

Article Title: Early-Stage B-cells Predict Relapse After Rituximab Treatment in Patients With Membranous Nephropathy

doi: 10.1016/j.ekir.2026.106365

Figure Lengend Snippet: Reconstitution of B-cells over time. To characterize B-cell subsets, peripheral blood mononuclear cells were stained with fluorochrome-conjugated monoclonal antibodies (BD Biosciences) directed against the following antigens: CD45 (V500-C), CD3 (APC), CD19 (APC-H7), CD27 (BV421), IgD (PE), CD38 (BV711), CD4 (BV605), and CD8 (PE), as well as 7-AAD (Miltenyi Biotech). The stained cells were then analyzed using multicolor flow cytometry (BD FACS Lyric). The subsets of gated CD19 + cells were identified based on surface marker expression as follows: naïve (CD19+CD27-IgD+), nonswitched memory (CD19+CD27+IgD+), switched memory (CD19+CD27+IgD-), and double negative (CD19+CD27-IgD-); and within the CD19+CD38++ population, we distinguished transitional cells (CD19+CD38++CD27-IgD+), plasmablasts (CD19+CD38++CD27+IgD-), and double-negative CD38 + cells (CD19+CD38++CD27-IgD-). B-cell subsets were expressed as a percentage of the total lymphocyte count. (a) B-cell subpopulations were assessed in 39 patients at baseline and in 36 patients at 3 (M3), 6 (M6), 9 (M9), 12 (M12), and 18 (M18) months following the first rituximab infusion. The 3 patients who did not receive treatment were excluded from the follow-up. Complete depletion of B-cells was observed in all patients at M3 post-rituximab for all B-cell subpopulations. CD19 + cells reappeared 6 months after rituximab infusion. Naive cells re-emerged the most among B-cells, followed by CD38 + cells, transitional cells and finally memory cells. Data are shown as mean values (dots). (b–k) B-cell subpopulations at baseline and at subsequent time points were compared between relapsing patients ( n = 8) and nonrelapsing patients ( n = 19); the 2 patients who received additional anti-CD20 infusions were excluded from subsequent analyses. Data are shown as medians and interquartile range (IQR). P -values were calculated by comparing the median values of each cell subpopulation between relapsing and nonrelapsing patients using a nonparametric, unpaired Mann–Whitney U test.

Article Snippet: To characterize B-cell subsets, peripheral blood mononuclear cells were stained with fluorochrome-conjugated monoclonal antibodies (BD Biosciences) directed against the following antigens: CD45 (V500-C), CD3 (APC), CD19 (APC-H7), CD27 (BV421), IgD (PE), CD38 (BV711), CD4 (BV605), and CD8 (PE), as well as 7-AAD (Miltenyi Biotech).

Techniques: Staining, Bioprocessing, Flow Cytometry, Marker, Expressing, MANN-WHITNEY