Review



anti camkiiγ  (Proteintech)


Bioz Verified Symbol Proteintech is a verified supplier  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
    • 93
      Buy from Supplier

    Structured Review

    Proteintech anti camkiiγ
    Anti Camkiiγ, supplied by Proteintech, used in various techniques. Bioz Stars score: 93/100, based on 38 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/camkii%CE%B3/CaMKII+gamma+Antibody/pmc13042430-246-46-48
    Average 93 stars, based on 38 article reviews
    anti camkiiγ - by Bioz Stars, 2026-09
    93/100 stars

    Images

    Related Articles

    Immunofluorescence:


    Labeling:




    Similar Products

    anti camkiiγ  (Proteintech)
    93
    Proteintech anti camkiiγ
    Anti Camkiiγ, supplied by Proteintech, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/camkii%CE%B3/CaMKII+gamma+Antibody/pmc13042430-246-46-48
    Average 93 stars, based on 1 article reviews
    anti camkiiγ - by Bioz Stars, 2026-09
    93/100 stars
    		  Buy from Supplier
    camkii gamma polyclonal antibody  (Proteintech)
    94
    Proteintech camkii gamma polyclonal antibody
    RFR enhanced HSPC membrane fluidity and inhibited the activation of calcium-dependent kinases. a Sequential fluorescence patterns in a fluorescence bleach plot of RFR-treated or control HSPCs. Each main panel contains three subpanels: pre-bleach images, immediate post-bleach capture, and membrane recovery phases. Time-to-half-recovery (t1/2) values are annotated in the top right corners of the recovery subpanels. b Corresponding t1/2 values are compared, demonstrating significant differences between two groups. c Quantified fluorescence recovery kinetics through normalized intensity curves: blue (Con), and red (RFR). The x-axis represents time post-bleach (seconds), while the y-axis indicates relative fluorescence intensity. d Phosphorylation levels of downstream calcium-dependent kinases <t>(CaMKII,</t> PKA, PKC, and CREB) by western blot. e Model depicting: non-thermal radiofrequency radiation enhances HSPC function via a membrane fluidity-PMCA activation-Ca 2+ -energy metabolism axis. Datasets represent pooled results from three independent experimental replicates. Values are expressed as mean ± standard deviation (SD), with significance levels indicated as ****, p < 0.0001. Intergroup comparisons employed Student’s t-test for statistical evaluation
    Camkii Gamma Polyclonal Antibody, supplied by Proteintech, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/camkii%CE%B3/CAMK2G+Fusion+Protein/pmc13011509-166-21-25
    Average 94 stars, based on 1 article reviews
    camkii gamma polyclonal antibody - by Bioz Stars, 2026-09
    94/100 stars
    		  Buy from Supplier
    proteintech 12666 2 ap  (Proteintech)
    93
    Proteintech proteintech 12666 2 ap
    RFR enhanced HSPC membrane fluidity and inhibited the activation of calcium-dependent kinases. a Sequential fluorescence patterns in a fluorescence bleach plot of RFR-treated or control HSPCs. Each main panel contains three subpanels: pre-bleach images, immediate post-bleach capture, and membrane recovery phases. Time-to-half-recovery (t1/2) values are annotated in the top right corners of the recovery subpanels. b Corresponding t1/2 values are compared, demonstrating significant differences between two groups. c Quantified fluorescence recovery kinetics through normalized intensity curves: blue (Con), and red (RFR). The x-axis represents time post-bleach (seconds), while the y-axis indicates relative fluorescence intensity. d Phosphorylation levels of downstream calcium-dependent kinases <t>(CaMKII,</t> PKA, PKC, and CREB) by western blot. e Model depicting: non-thermal radiofrequency radiation enhances HSPC function via a membrane fluidity-PMCA activation-Ca 2+ -energy metabolism axis. Datasets represent pooled results from three independent experimental replicates. Values are expressed as mean ± standard deviation (SD), with significance levels indicated as ****, p < 0.0001. Intergroup comparisons employed Student’s t-test for statistical evaluation
    Proteintech 12666 2 Ap, supplied by Proteintech, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/camkii%CE%B3/CaMKII+gamma+Antibody/pmc13011509-166-25-25
    Average 93 stars, based on 1 article reviews
    proteintech 12666 2 ap - by Bioz Stars, 2026-09
    93/100 stars
    		  Buy from Supplier
    inhibitors camk2γ antibody  (Proteintech)
    93
    Proteintech inhibitors camk2γ antibody
    RFR enhanced HSPC membrane fluidity and inhibited the activation of calcium-dependent kinases. a Sequential fluorescence patterns in a fluorescence bleach plot of RFR-treated or control HSPCs. Each main panel contains three subpanels: pre-bleach images, immediate post-bleach capture, and membrane recovery phases. Time-to-half-recovery (t1/2) values are annotated in the top right corners of the recovery subpanels. b Corresponding t1/2 values are compared, demonstrating significant differences between two groups. c Quantified fluorescence recovery kinetics through normalized intensity curves: blue (Con), and red (RFR). The x-axis represents time post-bleach (seconds), while the y-axis indicates relative fluorescence intensity. d Phosphorylation levels of downstream calcium-dependent kinases <t>(CaMKII,</t> PKA, PKC, and CREB) by western blot. e Model depicting: non-thermal radiofrequency radiation enhances HSPC function via a membrane fluidity-PMCA activation-Ca 2+ -energy metabolism axis. Datasets represent pooled results from three independent experimental replicates. Values are expressed as mean ± standard deviation (SD), with significance levels indicated as ****, p < 0.0001. Intergroup comparisons employed Student’s t-test for statistical evaluation
    Inhibitors Camk2γ Antibody, supplied by Proteintech, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/camkii%CE%B3/CaMKII+gamma+Antibody/pm41638654-40-2-7
    Average 93 stars, based on 1 article reviews
    inhibitors camk2γ antibody - by Bioz Stars, 2026-09
    93/100 stars
    		  Buy from Supplier
    rabbit anti camkii gamma ab  (Proteintech)
    93
    Proteintech rabbit anti camkii gamma ab
    RFR enhanced HSPC membrane fluidity and inhibited the activation of calcium-dependent kinases. a Sequential fluorescence patterns in a fluorescence bleach plot of RFR-treated or control HSPCs. Each main panel contains three subpanels: pre-bleach images, immediate post-bleach capture, and membrane recovery phases. Time-to-half-recovery (t1/2) values are annotated in the top right corners of the recovery subpanels. b Corresponding t1/2 values are compared, demonstrating significant differences between two groups. c Quantified fluorescence recovery kinetics through normalized intensity curves: blue (Con), and red (RFR). The x-axis represents time post-bleach (seconds), while the y-axis indicates relative fluorescence intensity. d Phosphorylation levels of downstream calcium-dependent kinases <t>(CaMKII,</t> PKA, PKC, and CREB) by western blot. e Model depicting: non-thermal radiofrequency radiation enhances HSPC function via a membrane fluidity-PMCA activation-Ca 2+ -energy metabolism axis. Datasets represent pooled results from three independent experimental replicates. Values are expressed as mean ± standard deviation (SD), with significance levels indicated as ****, p < 0.0001. Intergroup comparisons employed Student’s t-test for statistical evaluation
    Rabbit Anti Camkii Gamma Ab, supplied by Proteintech, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/camkii%CE%B3/CaMKII+gamma+Antibody/pm41634382-224-29-34
    Average 93 stars, based on 1 article reviews
    rabbit anti camkii gamma ab - by Bioz Stars, 2026-09
    93/100 stars
    		  Buy from Supplier
    2 ap mouse anti camkii delta abcam  (Proteintech)
    93
    Proteintech 2 ap mouse anti camkii delta abcam
    RFR enhanced HSPC membrane fluidity and inhibited the activation of calcium-dependent kinases. a Sequential fluorescence patterns in a fluorescence bleach plot of RFR-treated or control HSPCs. Each main panel contains three subpanels: pre-bleach images, immediate post-bleach capture, and membrane recovery phases. Time-to-half-recovery (t1/2) values are annotated in the top right corners of the recovery subpanels. b Corresponding t1/2 values are compared, demonstrating significant differences between two groups. c Quantified fluorescence recovery kinetics through normalized intensity curves: blue (Con), and red (RFR). The x-axis represents time post-bleach (seconds), while the y-axis indicates relative fluorescence intensity. d Phosphorylation levels of downstream calcium-dependent kinases <t>(CaMKII,</t> PKA, PKC, and CREB) by western blot. e Model depicting: non-thermal radiofrequency radiation enhances HSPC function via a membrane fluidity-PMCA activation-Ca 2+ -energy metabolism axis. Datasets represent pooled results from three independent experimental replicates. Values are expressed as mean ± standard deviation (SD), with significance levels indicated as ****, p < 0.0001. Intergroup comparisons employed Student’s t-test for statistical evaluation
    2 Ap Mouse Anti Camkii Delta Abcam, supplied by Proteintech, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/camkii%CE%B3/CaMKII+gamma+Antibody/pm41634382-214-134-133
    Average 93 stars, based on 1 article reviews
    2 ap mouse anti camkii delta abcam - by Bioz Stars, 2026-09
    93/100 stars
    		  Buy from Supplier
    sequence based reagents crispr target sequence for camkiiγ human 5 ́ gtgctgatcctcatcccaga  (Bethyl)
    94
    Bethyl sequence based reagents crispr target sequence for camkiiγ human 5 ́ gtgctgatcctcatcccaga
    RFR enhanced HSPC membrane fluidity and inhibited the activation of calcium-dependent kinases. a Sequential fluorescence patterns in a fluorescence bleach plot of RFR-treated or control HSPCs. Each main panel contains three subpanels: pre-bleach images, immediate post-bleach capture, and membrane recovery phases. Time-to-half-recovery (t1/2) values are annotated in the top right corners of the recovery subpanels. b Corresponding t1/2 values are compared, demonstrating significant differences between two groups. c Quantified fluorescence recovery kinetics through normalized intensity curves: blue (Con), and red (RFR). The x-axis represents time post-bleach (seconds), while the y-axis indicates relative fluorescence intensity. d Phosphorylation levels of downstream calcium-dependent kinases <t>(CaMKII,</t> PKA, PKC, and CREB) by western blot. e Model depicting: non-thermal radiofrequency radiation enhances HSPC function via a membrane fluidity-PMCA activation-Ca 2+ -energy metabolism axis. Datasets represent pooled results from three independent experimental replicates. Values are expressed as mean ± standard deviation (SD), with significance levels indicated as ****, p < 0.0001. Intergroup comparisons employed Student’s t-test for statistical evaluation
    Sequence Based Reagents Crispr Target Sequence For Camkiiγ Human 5 ́ Gtgctgatcctcatcccaga, supplied by Bethyl, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/camkii%CE%B3/Mouse+IgG-heavy+and+light+chain+cross+adsorbed+Antibody/pm41634382-214-183-177
    Average 94 stars, based on 1 article reviews
    sequence based reagents crispr target sequence for camkiiγ human 5 ́ gtgctgatcctcatcccaga - by Bioz Stars, 2026-09
    94/100 stars
    		  Buy from Supplier
    collagen i  (Proteintech)
    93
    Proteintech collagen i
    RFR enhanced HSPC membrane fluidity and inhibited the activation of calcium-dependent kinases. a Sequential fluorescence patterns in a fluorescence bleach plot of RFR-treated or control HSPCs. Each main panel contains three subpanels: pre-bleach images, immediate post-bleach capture, and membrane recovery phases. Time-to-half-recovery (t1/2) values are annotated in the top right corners of the recovery subpanels. b Corresponding t1/2 values are compared, demonstrating significant differences between two groups. c Quantified fluorescence recovery kinetics through normalized intensity curves: blue (Con), and red (RFR). The x-axis represents time post-bleach (seconds), while the y-axis indicates relative fluorescence intensity. d Phosphorylation levels of downstream calcium-dependent kinases <t>(CaMKII,</t> PKA, PKC, and CREB) by western blot. e Model depicting: non-thermal radiofrequency radiation enhances HSPC function via a membrane fluidity-PMCA activation-Ca 2+ -energy metabolism axis. Datasets represent pooled results from three independent experimental replicates. Values are expressed as mean ± standard deviation (SD), with significance levels indicated as ****, p < 0.0001. Intergroup comparisons employed Student’s t-test for statistical evaluation
    Collagen I, supplied by Proteintech, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/camkii%CE%B3/CaMKII+gamma+Antibody/10__14744_slash_anatoljcardiol__2026__5822-71-20-28
    Average 93 stars, based on 1 article reviews
    collagen i - by Bioz Stars, 2026-09
    93/100 stars
    		  Buy from Supplier
    camkii  (Proteintech)
    93
    Proteintech camkii
    RFR enhanced HSPC membrane fluidity and inhibited the activation of calcium-dependent kinases. a Sequential fluorescence patterns in a fluorescence bleach plot of RFR-treated or control HSPCs. Each main panel contains three subpanels: pre-bleach images, immediate post-bleach capture, and membrane recovery phases. Time-to-half-recovery (t1/2) values are annotated in the top right corners of the recovery subpanels. b Corresponding t1/2 values are compared, demonstrating significant differences between two groups. c Quantified fluorescence recovery kinetics through normalized intensity curves: blue (Con), and red (RFR). The x-axis represents time post-bleach (seconds), while the y-axis indicates relative fluorescence intensity. d Phosphorylation levels of downstream calcium-dependent kinases <t>(CaMKII,</t> PKA, PKC, and CREB) by western blot. e Model depicting: non-thermal radiofrequency radiation enhances HSPC function via a membrane fluidity-PMCA activation-Ca 2+ -energy metabolism axis. Datasets represent pooled results from three independent experimental replicates. Values are expressed as mean ± standard deviation (SD), with significance levels indicated as ****, p < 0.0001. Intergroup comparisons employed Student’s t-test for statistical evaluation
    Camkii, supplied by Proteintech, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/camkii%CE%B3/CaMKII+gamma+Antibody/10__14744_slash_anatoljcardiol__2026__5822-71-25-28
    Average 93 stars, based on 1 article reviews
    camkii - by Bioz Stars, 2026-09
    93/100 stars
    		  Buy from Supplier
    camkii  (Santa Cruz Biotechnology)
    95
    Santa Cruz Biotechnology camkii
    RFR enhanced HSPC membrane fluidity and inhibited the activation of calcium-dependent kinases. a Sequential fluorescence patterns in a fluorescence bleach plot of RFR-treated or control HSPCs. Each main panel contains three subpanels: pre-bleach images, immediate post-bleach capture, and membrane recovery phases. Time-to-half-recovery (t1/2) values are annotated in the top right corners of the recovery subpanels. b Corresponding t1/2 values are compared, demonstrating significant differences between two groups. c Quantified fluorescence recovery kinetics through normalized intensity curves: blue (Con), and red (RFR). The x-axis represents time post-bleach (seconds), while the y-axis indicates relative fluorescence intensity. d Phosphorylation levels of downstream calcium-dependent kinases <t>(CaMKII,</t> PKA, PKC, and CREB) by western blot. e Model depicting: non-thermal radiofrequency radiation enhances HSPC function via a membrane fluidity-PMCA activation-Ca 2+ -energy metabolism axis. Datasets represent pooled results from three independent experimental replicates. Values are expressed as mean ± standard deviation (SD), with significance levels indicated as ****, p < 0.0001. Intergroup comparisons employed Student’s t-test for statistical evaluation
    Camkii, supplied by Santa Cruz Biotechnology, used in various techniques. Bioz Stars score: 95/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/camkii%CE%B3/CaMKII%CE%B1%2F%CE%B2%2F%CE%B3%2F%CE%B4+Antibody/pm41478600-107-33-37
    Average 95 stars, based on 1 article reviews
    camkii - by Bioz Stars, 2026-09
    95/100 stars
    		  Buy from Supplier

    Image Search Results


    RFR enhanced HSPC membrane fluidity and inhibited the activation of calcium-dependent kinases. a Sequential fluorescence patterns in a fluorescence bleach plot of RFR-treated or control HSPCs. Each main panel contains three subpanels: pre-bleach images, immediate post-bleach capture, and membrane recovery phases. Time-to-half-recovery (t1/2) values are annotated in the top right corners of the recovery subpanels. b Corresponding t1/2 values are compared, demonstrating significant differences between two groups. c Quantified fluorescence recovery kinetics through normalized intensity curves: blue (Con), and red (RFR). The x-axis represents time post-bleach (seconds), while the y-axis indicates relative fluorescence intensity. d Phosphorylation levels of downstream calcium-dependent kinases (CaMKII, PKA, PKC, and CREB) by western blot. e Model depicting: non-thermal radiofrequency radiation enhances HSPC function via a membrane fluidity-PMCA activation-Ca 2+ -energy metabolism axis. Datasets represent pooled results from three independent experimental replicates. Values are expressed as mean ± standard deviation (SD), with significance levels indicated as ****, p < 0.0001. Intergroup comparisons employed Student’s t-test for statistical evaluation

    Journal: Stem Cell Research & Therapy

    Article Title: Nonthermal radiofrequency radiation promotes hematopoietic stem and progenitor cells function by regulating Ca 2+ efflux

    doi: 10.1186/s13287-026-04937-2

    Figure Lengend Snippet: RFR enhanced HSPC membrane fluidity and inhibited the activation of calcium-dependent kinases. a Sequential fluorescence patterns in a fluorescence bleach plot of RFR-treated or control HSPCs. Each main panel contains three subpanels: pre-bleach images, immediate post-bleach capture, and membrane recovery phases. Time-to-half-recovery (t1/2) values are annotated in the top right corners of the recovery subpanels. b Corresponding t1/2 values are compared, demonstrating significant differences between two groups. c Quantified fluorescence recovery kinetics through normalized intensity curves: blue (Con), and red (RFR). The x-axis represents time post-bleach (seconds), while the y-axis indicates relative fluorescence intensity. d Phosphorylation levels of downstream calcium-dependent kinases (CaMKII, PKA, PKC, and CREB) by western blot. e Model depicting: non-thermal radiofrequency radiation enhances HSPC function via a membrane fluidity-PMCA activation-Ca 2+ -energy metabolism axis. Datasets represent pooled results from three independent experimental replicates. Values are expressed as mean ± standard deviation (SD), with significance levels indicated as ****, p < 0.0001. Intergroup comparisons employed Student’s t-test for statistical evaluation

    Article Snippet: For immunoblotting with phosphorylation-specific primary antibodies (GAPDH, Cell Signaling Technology, #3900; PMCA1, Abcam, #ab190355; Phospho-CaMKII (Thr286) (D21E4), Cell Signaling Technology, #12716; CaMKII Gamma Polyclonal antibody, Proteintech, #12666-2-AP; Phospho-PKCζ/λ(Thr410/403), Cell Signaling Technology, #9378; PKCζ Antibody, Cell Signaling Technology, #9372; PRKACB Polyclonal antibody, Proteintech, #55382-1-AP; Phospho-PKA C (Thr197), Cell Signaling Technology, #4781; Anti-CREB antibody, Abcam, #ab32515; Anti-CREB (phospho S133) antibody, Abcam, #ab32096; Beta Actin Monoclonal antibody, Proteintech, #66009-1-Ig), membranes were blocked with 5% skimmed milk prior to overnight incubation with the designated primary antibodies at 4 °C.

    Techniques: Membrane, Activation Assay, Fluorescence, Control, Phospho-proteomics, Western Blot, Standard Deviation