Review



ca074-me  (Millipore)


Bioz Verified Symbol Millipore is a verified supplier  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
    • 90
      Buy from Supplier

    Structured Review

    Millipore ca074-me
    Ca074 Me, supplied by Millipore, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/ca074-me/ca+074/pmc11389378__mbio__00384___24___s0007-4-0-1
    Average 90 stars, based on 1 article reviews
    ca074-me - by Bioz Stars, 2026-10
    90/100 stars

    Images

    Related Articles

    Sequencing:

    Article Title:
    Article Snippet: CA074-Me CalBiochem Cat# 205531 E64 Sigma-Aldrich Cat# E3132 Pepstatin A Sigma-Aldrich Cat# P5318 RKLLW-NH2 Sigma-Aldrich Cat# SCP0110 Primers Sequence (5’ - 3’) reep5 (forward) GATACCCAGCCTACATCTCAATG reep5 (reverse) GCAATGCTGAACACACCATATAC ifnb (forward) ATGAGTGGTGGTTGCAGGC ifnb (reverse) TGACCTTTCAAATGCAGTAGATTCA cathepsin B (forward) TCCTTGATCCTTCTTTCTTGCC cathepsin B (reverse) ACAGTGCCACACAGCTTCTTC a3 serpins (forward) TTTCCAGCAACCTCTCAAGGC a3 serpins (reverse) CTGGGTGTGATTGCCCACATA serpina3a (forward) AGATGTCATCACAATAGCCCG serpina3a (reverse) TTTGTTAAAGGGTTGATAACC serpina3b (forward) GATGCAATCACAATAGTCGGATAC serpina3b (reverse) GGTTGATAACCTTGCCCATTAC serpina3c (forward) CTTAGTAGAAGAACCAGTCTG serpina3c (reverse) CTTAGGGTGAGTGATTTTGGC serpina3f (forward) ATCTCCAATGTTGTCAAGGTG serpina3f (reverse) TGAAACTTTTGCCATAAAGAG serpina3g (forward) ACAGGAATGGCAGGTGTCGG serpina3g (reverse) TGTAACTTTTGCCATAAAGA serpina3h (forward) ACAGGGGTCAAATTAATTC serpina3h (reverse) CTTGGGATTTGTAACTTTGGC serpina3i (forward) AGGAGTCAAAGTTAATCTACG serpina3i (reverse) CTTGGGATTTGTAACTTTGGC serpina3j (forward) CAAGAGACAAATATGACTTC serpina3j (reverse) GTGCAGGGTTGTTGATCTTGC serpina3k (forward) GGCCATTCCTGATTGTTATC serpina3k (reverse) TGAGAACTTGGTGAGCTTTA serpina3m (forward) GCTTTCGTTCTAGAAGATTAC serpina3m (reverse) CTTGGGGTTAGTGACTTTGGC serpina3n (forward) CAATGTCTGCGAAACTGTACC serpina3n (reverse) TTTGGGGTTGGCTATCTTGGC Primers for genotyping Sequence (5’ - 3’) oSB073 GGGCGGTGTAGGCCGCTGGACC oSB080 CCATCTGGGCATGTGGGATTGGGAC oSB085 CCAGAAAGTCAAAAACTGCACAACATCCG oSB086 CTGGAGCACATCCTTCCTGAGTTGG Antibodies Source Catalog number Monoclonal rat anti-CD3 BioLegend Cat# 100227, clone 17A2 Monoclonal rat antiCD11b BioLegend Cat# 101237, clone M1/70 Monoclonal rat antiCD19 BioLegend Cat# 115537, clone 6D5 Monoclonal mouse antiCD45.2 eBiosciences Cat# 56-0454-82, clone 104 3(3) Monoclonal rat antiLy6C BioLegend Cat# 128012, clone HK1.4 Monoclonal rat antiLy6G BD Biosciences Cat# 563979, clone 1A8 Monoclonal rat antiMHCII/I-A/I-E BD Biosciences Cat# 563415, clone M5/114.15.2 Monoclonal Armenian Hamster anti-TCRβ BioLegend Cat# 109230, clone H57-597 Purified rat antiCD16/CD32 block BD Biosciences Cat# 553142, clone 2.4G2 Equipment Source iQ5 Real-Time PCR Detection System Bio-Rad CFX384 Touch RealTime PCR Detection System Bio-Rad SPECTROstar BMG Labtech Varioskan Lux ThermoFisher Scientific TissueLyser II Qiagen Biopulverizer Biospec Products Homogenizer PT1200 E Polytron Flow cytometer LSRII BD Biosciences Software Source Prism 9 GraphPad Illustrator 2023 Adobe CFX Maestro Bio-Rad FlowJo, version 9.9.6 and v10.7.1 BD Biosciences FACSDiva, version 8.0 BD Biosciences

    Article Title: Treponema pallidum promotes macrophage polarization and activates the NLRP3 inflammasome pathway to induce interleukin-1β production.
    Article Snippet: Inhibitory effects of cathepsin B, ROS, K+, and caspase-1 and their impact on IL-1β expression M0 macrophages were preincubated for 30 min with various inhibitors, namely, 25 mM N-acetylcysteine (NAC) (a ROS inhibitor; Sigma-Aldrich, St. Louis, MO, USA), 30 mM CA074-Me (a cathepsin B inhibitor; Calbiochem, San Diego, CA, USA), 100 mM KCl (a potassium channel inhibitor; Sigma, St. Louis, MO, USA), or 2 μM N-benzyloxycarbonyl-Val-Ala-Asp(O-methyl)-fluoromethyl ketone (Z-VAD-FMK; a caspase-1 inhibitor; Invitrogen Inc., USA).

    Article Title: Fluid shear-induced cathepsin B release in the control of Mac1-dependent neutrophil adhesion
    Article Snippet: Experiments were conducted with cell populations treated with and without 30 μM E64 (cysteine protease inhibitor; Sigma-Aldrich), 50 μM CA074-me (ctsB inhibitor; EMD Millipore, Billerica, MA), or 5 μM AP (negative control inhibitor; Sigma-Aldrich) for 5 min before shear exposure, as reported [ 17 ].

    Article Title: Treponema pallidum promotes macrophage polarization and activates the NLRP3 inflammasome pathway to induce interleukin-1β production
    Article Snippet: M0 macrophages were preincubated for 30 min with various inhibitors, namely, 25 mM N-acetylcysteine (NAC) (a ROS inhibitor; Sigma-Aldrich, St. Louis, MO, USA), 30 mM CA074-Me (a cathepsin B inhibitor; Calbiochem, San Diego, CA, USA), 100 mM KCl (a potassium channel inhibitor; Sigma, St. Louis, MO, USA), or 2 μM N -benzyloxycarbonyl-Val-Ala-Asp( O -methyl)-fluoromethyl ketone (Z-VAD-FMK; a caspase-1 inhibitor; Invitrogen Inc., USA).

    Article Title: Functional inhibition of acid sphingomyelinase disrupts infection by intracellular bacterial pathogens
    Article Snippet: Language Please check spelling and correct notat ion part icularly of chemicals throughout the text , for example: Line 517f: Spelling mistakes: Hoeschst 33342 should be Hoechst amitrypt iline (MilliporeSigma) should be amitriptyline nortrypt iline (MilliporeSigma)should be nortriptyline Ca074-Me (MilliporeSigma) should be CA-074 Me Bodipy (e.g. figures 4D, E) should be consistent ly BODIPY 1st Authors' Response to Reviewers: March 5, 2019 March 5, 2019 RE: Response to reviewer comments for manuscript LSA-2018-00292-TR Dear Reviewers: We hereby resubmit our manuscript, “Functional inhibition of acid sphingomyelinase disrupts infection by intracellular bacterial pathogens” (LSA-2018-00292-TR) for your consideration for publication in Life Science Alliance.

    Article Title: Protective mechanisms of CA074-me (other than cathepsin-B inhibition) against programmed necrosis induced by global cerebral ischemia/reperfusion injury in rats.
    Article Snippet: Many studies have demonstrated the key role of lysosomes in ischemic cell death in the brain and have led to the “lysosomocentric” hypothesis.. In this hypothesis, the release of cathepsin-B due to a change of lysosomal membrane permeabilization (LMP) or rupture is critical, and this can be prevented by its inhibitors CA074 and CA074-me.. However, the role of CA074-me in neuronal death and its effect on the change of lysosomal membrane integrity after global cerebral ischemia/reperfusion (I/R) injury is not clear, so we investigated this here.

    Article Title: Lysophosphatidylcholine Induces NLRP3 Inflammasome-Mediated Foam Cell Formation and Pyroptosis in Human Monocytes and Endothelial Cells
    Article Snippet: Depending on the assay, the cells were also treated with pharmacological inhibitors: N -acetyl- l -cysteine (NAC), 5 mM (Sigma-Aldrich); Ac-YVAD-cho, 20 μM (Enzo Life Sciences); glyburide, 150 μM (Sigma-Aldrich); CA074-ME, 50 μM (Sigma-Aldrich); statin, 25 μM (Sigma-Aldrich); GW9662, 1 μM (Sigma-Aldrich); methyl-beta-cyclodextrin, 10 μM (Sigma-Aldrich); and PAb-hTLR2, 10 μg/ml (InvivoGen).

    Article Title: Functional inhibition of acid sphingomyelinase disrupts infection by intracellular bacterial pathogens
    Article Snippet: Ca074-Me (MilliporeSigma) should be CA-074 Me RESPONSE: Thank you for noting this error, which has now been corrected throughout.

    Purification:

    Article Title:
    Article Snippet: CA074-Me CalBiochem Cat# 205531 E64 Sigma-Aldrich Cat# E3132 Pepstatin A Sigma-Aldrich Cat# P5318 RKLLW-NH2 Sigma-Aldrich Cat# SCP0110 Primers Sequence (5’ - 3’) reep5 (forward) GATACCCAGCCTACATCTCAATG reep5 (reverse) GCAATGCTGAACACACCATATAC ifnb (forward) ATGAGTGGTGGTTGCAGGC ifnb (reverse) TGACCTTTCAAATGCAGTAGATTCA cathepsin B (forward) TCCTTGATCCTTCTTTCTTGCC cathepsin B (reverse) ACAGTGCCACACAGCTTCTTC a3 serpins (forward) TTTCCAGCAACCTCTCAAGGC a3 serpins (reverse) CTGGGTGTGATTGCCCACATA serpina3a (forward) AGATGTCATCACAATAGCCCG serpina3a (reverse) TTTGTTAAAGGGTTGATAACC serpina3b (forward) GATGCAATCACAATAGTCGGATAC serpina3b (reverse) GGTTGATAACCTTGCCCATTAC serpina3c (forward) CTTAGTAGAAGAACCAGTCTG serpina3c (reverse) CTTAGGGTGAGTGATTTTGGC serpina3f (forward) ATCTCCAATGTTGTCAAGGTG serpina3f (reverse) TGAAACTTTTGCCATAAAGAG serpina3g (forward) ACAGGAATGGCAGGTGTCGG serpina3g (reverse) TGTAACTTTTGCCATAAAGA serpina3h (forward) ACAGGGGTCAAATTAATTC serpina3h (reverse) CTTGGGATTTGTAACTTTGGC serpina3i (forward) AGGAGTCAAAGTTAATCTACG serpina3i (reverse) CTTGGGATTTGTAACTTTGGC serpina3j (forward) CAAGAGACAAATATGACTTC serpina3j (reverse) GTGCAGGGTTGTTGATCTTGC serpina3k (forward) GGCCATTCCTGATTGTTATC serpina3k (reverse) TGAGAACTTGGTGAGCTTTA serpina3m (forward) GCTTTCGTTCTAGAAGATTAC serpina3m (reverse) CTTGGGGTTAGTGACTTTGGC serpina3n (forward) CAATGTCTGCGAAACTGTACC serpina3n (reverse) TTTGGGGTTGGCTATCTTGGC Primers for genotyping Sequence (5’ - 3’) oSB073 GGGCGGTGTAGGCCGCTGGACC oSB080 CCATCTGGGCATGTGGGATTGGGAC oSB085 CCAGAAAGTCAAAAACTGCACAACATCCG oSB086 CTGGAGCACATCCTTCCTGAGTTGG Antibodies Source Catalog number Monoclonal rat anti-CD3 BioLegend Cat# 100227, clone 17A2 Monoclonal rat antiCD11b BioLegend Cat# 101237, clone M1/70 Monoclonal rat antiCD19 BioLegend Cat# 115537, clone 6D5 Monoclonal mouse antiCD45.2 eBiosciences Cat# 56-0454-82, clone 104 3(3) Monoclonal rat antiLy6C BioLegend Cat# 128012, clone HK1.4 Monoclonal rat antiLy6G BD Biosciences Cat# 563979, clone 1A8 Monoclonal rat antiMHCII/I-A/I-E BD Biosciences Cat# 563415, clone M5/114.15.2 Monoclonal Armenian Hamster anti-TCRβ BioLegend Cat# 109230, clone H57-597 Purified rat antiCD16/CD32 block BD Biosciences Cat# 553142, clone 2.4G2 Equipment Source iQ5 Real-Time PCR Detection System Bio-Rad CFX384 Touch RealTime PCR Detection System Bio-Rad SPECTROstar BMG Labtech Varioskan Lux ThermoFisher Scientific TissueLyser II Qiagen Biopulverizer Biospec Products Homogenizer PT1200 E Polytron Flow cytometer LSRII BD Biosciences Software Source Prism 9 GraphPad Illustrator 2023 Adobe CFX Maestro Bio-Rad FlowJo, version 9.9.6 and v10.7.1 BD Biosciences FACSDiva, version 8.0 BD Biosciences

    Article Title: Treponema pallidum promotes macrophage polarization and activates the NLRP3 inflammasome pathway to induce interleukin-1β production.
    Article Snippet: Inhibitory effects of cathepsin B, ROS, K+, and caspase-1 and their impact on IL-1β expression M0 macrophages were preincubated for 30 min with various inhibitors, namely, 25 mM N-acetylcysteine (NAC) (a ROS inhibitor; Sigma-Aldrich, St. Louis, MO, USA), 30 mM CA074-Me (a cathepsin B inhibitor; Calbiochem, San Diego, CA, USA), 100 mM KCl (a potassium channel inhibitor; Sigma, St. Louis, MO, USA), or 2 μM N-benzyloxycarbonyl-Val-Ala-Asp(O-methyl)-fluoromethyl ketone (Z-VAD-FMK; a caspase-1 inhibitor; Invitrogen Inc., USA).

    Article Title: Fluid shear-induced cathepsin B release in the control of Mac1-dependent neutrophil adhesion
    Article Snippet: Experiments were conducted with cell populations treated with and without 30 μM E64 (cysteine protease inhibitor; Sigma-Aldrich), 50 μM CA074-me (ctsB inhibitor; EMD Millipore, Billerica, MA), or 5 μM AP (negative control inhibitor; Sigma-Aldrich) for 5 min before shear exposure, as reported [ 17 ].

    Article Title: Treponema pallidum promotes macrophage polarization and activates the NLRP3 inflammasome pathway to induce interleukin-1β production
    Article Snippet: M0 macrophages were preincubated for 30 min with various inhibitors, namely, 25 mM N-acetylcysteine (NAC) (a ROS inhibitor; Sigma-Aldrich, St. Louis, MO, USA), 30 mM CA074-Me (a cathepsin B inhibitor; Calbiochem, San Diego, CA, USA), 100 mM KCl (a potassium channel inhibitor; Sigma, St. Louis, MO, USA), or 2 μM N -benzyloxycarbonyl-Val-Ala-Asp( O -methyl)-fluoromethyl ketone (Z-VAD-FMK; a caspase-1 inhibitor; Invitrogen Inc., USA).

    Article Title: Functional inhibition of acid sphingomyelinase disrupts infection by intracellular bacterial pathogens
    Article Snippet: Language Please check spelling and correct notat ion part icularly of chemicals throughout the text , for example: Line 517f: Spelling mistakes: Hoeschst 33342 should be Hoechst amitrypt iline (MilliporeSigma) should be amitriptyline nortrypt iline (MilliporeSigma)should be nortriptyline Ca074-Me (MilliporeSigma) should be CA-074 Me Bodipy (e.g. figures 4D, E) should be consistent ly BODIPY 1st Authors' Response to Reviewers: March 5, 2019 March 5, 2019 RE: Response to reviewer comments for manuscript LSA-2018-00292-TR Dear Reviewers: We hereby resubmit our manuscript, “Functional inhibition of acid sphingomyelinase disrupts infection by intracellular bacterial pathogens” (LSA-2018-00292-TR) for your consideration for publication in Life Science Alliance.

    Article Title: Protective mechanisms of CA074-me (other than cathepsin-B inhibition) against programmed necrosis induced by global cerebral ischemia/reperfusion injury in rats.
    Article Snippet: Many studies have demonstrated the key role of lysosomes in ischemic cell death in the brain and have led to the “lysosomocentric” hypothesis.. In this hypothesis, the release of cathepsin-B due to a change of lysosomal membrane permeabilization (LMP) or rupture is critical, and this can be prevented by its inhibitors CA074 and CA074-me.. However, the role of CA074-me in neuronal death and its effect on the change of lysosomal membrane integrity after global cerebral ischemia/reperfusion (I/R) injury is not clear, so we investigated this here.

    Article Title: Lysophosphatidylcholine Induces NLRP3 Inflammasome-Mediated Foam Cell Formation and Pyroptosis in Human Monocytes and Endothelial Cells
    Article Snippet: Depending on the assay, the cells were also treated with pharmacological inhibitors: N -acetyl- l -cysteine (NAC), 5 mM (Sigma-Aldrich); Ac-YVAD-cho, 20 μM (Enzo Life Sciences); glyburide, 150 μM (Sigma-Aldrich); CA074-ME, 50 μM (Sigma-Aldrich); statin, 25 μM (Sigma-Aldrich); GW9662, 1 μM (Sigma-Aldrich); methyl-beta-cyclodextrin, 10 μM (Sigma-Aldrich); and PAb-hTLR2, 10 μg/ml (InvivoGen).

    Article Title: Functional inhibition of acid sphingomyelinase disrupts infection by intracellular bacterial pathogens
    Article Snippet: Ca074-Me (MilliporeSigma) should be CA-074 Me RESPONSE: Thank you for noting this error, which has now been corrected throughout.

    Blocking Assay:

    Article Title:
    Article Snippet: CA074-Me CalBiochem Cat# 205531 E64 Sigma-Aldrich Cat# E3132 Pepstatin A Sigma-Aldrich Cat# P5318 RKLLW-NH2 Sigma-Aldrich Cat# SCP0110 Primers Sequence (5’ - 3’) reep5 (forward) GATACCCAGCCTACATCTCAATG reep5 (reverse) GCAATGCTGAACACACCATATAC ifnb (forward) ATGAGTGGTGGTTGCAGGC ifnb (reverse) TGACCTTTCAAATGCAGTAGATTCA cathepsin B (forward) TCCTTGATCCTTCTTTCTTGCC cathepsin B (reverse) ACAGTGCCACACAGCTTCTTC a3 serpins (forward) TTTCCAGCAACCTCTCAAGGC a3 serpins (reverse) CTGGGTGTGATTGCCCACATA serpina3a (forward) AGATGTCATCACAATAGCCCG serpina3a (reverse) TTTGTTAAAGGGTTGATAACC serpina3b (forward) GATGCAATCACAATAGTCGGATAC serpina3b (reverse) GGTTGATAACCTTGCCCATTAC serpina3c (forward) CTTAGTAGAAGAACCAGTCTG serpina3c (reverse) CTTAGGGTGAGTGATTTTGGC serpina3f (forward) ATCTCCAATGTTGTCAAGGTG serpina3f (reverse) TGAAACTTTTGCCATAAAGAG serpina3g (forward) ACAGGAATGGCAGGTGTCGG serpina3g (reverse) TGTAACTTTTGCCATAAAGA serpina3h (forward) ACAGGGGTCAAATTAATTC serpina3h (reverse) CTTGGGATTTGTAACTTTGGC serpina3i (forward) AGGAGTCAAAGTTAATCTACG serpina3i (reverse) CTTGGGATTTGTAACTTTGGC serpina3j (forward) CAAGAGACAAATATGACTTC serpina3j (reverse) GTGCAGGGTTGTTGATCTTGC serpina3k (forward) GGCCATTCCTGATTGTTATC serpina3k (reverse) TGAGAACTTGGTGAGCTTTA serpina3m (forward) GCTTTCGTTCTAGAAGATTAC serpina3m (reverse) CTTGGGGTTAGTGACTTTGGC serpina3n (forward) CAATGTCTGCGAAACTGTACC serpina3n (reverse) TTTGGGGTTGGCTATCTTGGC Primers for genotyping Sequence (5’ - 3’) oSB073 GGGCGGTGTAGGCCGCTGGACC oSB080 CCATCTGGGCATGTGGGATTGGGAC oSB085 CCAGAAAGTCAAAAACTGCACAACATCCG oSB086 CTGGAGCACATCCTTCCTGAGTTGG Antibodies Source Catalog number Monoclonal rat anti-CD3 BioLegend Cat# 100227, clone 17A2 Monoclonal rat antiCD11b BioLegend Cat# 101237, clone M1/70 Monoclonal rat antiCD19 BioLegend Cat# 115537, clone 6D5 Monoclonal mouse antiCD45.2 eBiosciences Cat# 56-0454-82, clone 104 3(3) Monoclonal rat antiLy6C BioLegend Cat# 128012, clone HK1.4 Monoclonal rat antiLy6G BD Biosciences Cat# 563979, clone 1A8 Monoclonal rat antiMHCII/I-A/I-E BD Biosciences Cat# 563415, clone M5/114.15.2 Monoclonal Armenian Hamster anti-TCRβ BioLegend Cat# 109230, clone H57-597 Purified rat antiCD16/CD32 block BD Biosciences Cat# 553142, clone 2.4G2 Equipment Source iQ5 Real-Time PCR Detection System Bio-Rad CFX384 Touch RealTime PCR Detection System Bio-Rad SPECTROstar BMG Labtech Varioskan Lux ThermoFisher Scientific TissueLyser II Qiagen Biopulverizer Biospec Products Homogenizer PT1200 E Polytron Flow cytometer LSRII BD Biosciences Software Source Prism 9 GraphPad Illustrator 2023 Adobe CFX Maestro Bio-Rad FlowJo, version 9.9.6 and v10.7.1 BD Biosciences FACSDiva, version 8.0 BD Biosciences

    Article Title: Treponema pallidum promotes macrophage polarization and activates the NLRP3 inflammasome pathway to induce interleukin-1β production.
    Article Snippet: Inhibitory effects of cathepsin B, ROS, K+, and caspase-1 and their impact on IL-1β expression M0 macrophages were preincubated for 30 min with various inhibitors, namely, 25 mM N-acetylcysteine (NAC) (a ROS inhibitor; Sigma-Aldrich, St. Louis, MO, USA), 30 mM CA074-Me (a cathepsin B inhibitor; Calbiochem, San Diego, CA, USA), 100 mM KCl (a potassium channel inhibitor; Sigma, St. Louis, MO, USA), or 2 μM N-benzyloxycarbonyl-Val-Ala-Asp(O-methyl)-fluoromethyl ketone (Z-VAD-FMK; a caspase-1 inhibitor; Invitrogen Inc., USA).

    Article Title: Fluid shear-induced cathepsin B release in the control of Mac1-dependent neutrophil adhesion
    Article Snippet: Experiments were conducted with cell populations treated with and without 30 μM E64 (cysteine protease inhibitor; Sigma-Aldrich), 50 μM CA074-me (ctsB inhibitor; EMD Millipore, Billerica, MA), or 5 μM AP (negative control inhibitor; Sigma-Aldrich) for 5 min before shear exposure, as reported [ 17 ].

    Article Title: Treponema pallidum promotes macrophage polarization and activates the NLRP3 inflammasome pathway to induce interleukin-1β production
    Article Snippet: M0 macrophages were preincubated for 30 min with various inhibitors, namely, 25 mM N-acetylcysteine (NAC) (a ROS inhibitor; Sigma-Aldrich, St. Louis, MO, USA), 30 mM CA074-Me (a cathepsin B inhibitor; Calbiochem, San Diego, CA, USA), 100 mM KCl (a potassium channel inhibitor; Sigma, St. Louis, MO, USA), or 2 μM N -benzyloxycarbonyl-Val-Ala-Asp( O -methyl)-fluoromethyl ketone (Z-VAD-FMK; a caspase-1 inhibitor; Invitrogen Inc., USA).

    Article Title: Functional inhibition of acid sphingomyelinase disrupts infection by intracellular bacterial pathogens
    Article Snippet: Language Please check spelling and correct notat ion part icularly of chemicals throughout the text , for example: Line 517f: Spelling mistakes: Hoeschst 33342 should be Hoechst amitrypt iline (MilliporeSigma) should be amitriptyline nortrypt iline (MilliporeSigma)should be nortriptyline Ca074-Me (MilliporeSigma) should be CA-074 Me Bodipy (e.g. figures 4D, E) should be consistent ly BODIPY 1st Authors' Response to Reviewers: March 5, 2019 March 5, 2019 RE: Response to reviewer comments for manuscript LSA-2018-00292-TR Dear Reviewers: We hereby resubmit our manuscript, “Functional inhibition of acid sphingomyelinase disrupts infection by intracellular bacterial pathogens” (LSA-2018-00292-TR) for your consideration for publication in Life Science Alliance.

    Article Title: Protective mechanisms of CA074-me (other than cathepsin-B inhibition) against programmed necrosis induced by global cerebral ischemia/reperfusion injury in rats.
    Article Snippet: Many studies have demonstrated the key role of lysosomes in ischemic cell death in the brain and have led to the “lysosomocentric” hypothesis.. In this hypothesis, the release of cathepsin-B due to a change of lysosomal membrane permeabilization (LMP) or rupture is critical, and this can be prevented by its inhibitors CA074 and CA074-me.. However, the role of CA074-me in neuronal death and its effect on the change of lysosomal membrane integrity after global cerebral ischemia/reperfusion (I/R) injury is not clear, so we investigated this here.

    Article Title: Lysophosphatidylcholine Induces NLRP3 Inflammasome-Mediated Foam Cell Formation and Pyroptosis in Human Monocytes and Endothelial Cells
    Article Snippet: Depending on the assay, the cells were also treated with pharmacological inhibitors: N -acetyl- l -cysteine (NAC), 5 mM (Sigma-Aldrich); Ac-YVAD-cho, 20 μM (Enzo Life Sciences); glyburide, 150 μM (Sigma-Aldrich); CA074-ME, 50 μM (Sigma-Aldrich); statin, 25 μM (Sigma-Aldrich); GW9662, 1 μM (Sigma-Aldrich); methyl-beta-cyclodextrin, 10 μM (Sigma-Aldrich); and PAb-hTLR2, 10 μg/ml (InvivoGen).

    Article Title: Functional inhibition of acid sphingomyelinase disrupts infection by intracellular bacterial pathogens
    Article Snippet: Ca074-Me (MilliporeSigma) should be CA-074 Me RESPONSE: Thank you for noting this error, which has now been corrected throughout.

    Real-time Polymerase Chain Reaction:

    Article Title:
    Article Snippet: CA074-Me CalBiochem Cat# 205531 E64 Sigma-Aldrich Cat# E3132 Pepstatin A Sigma-Aldrich Cat# P5318 RKLLW-NH2 Sigma-Aldrich Cat# SCP0110 Primers Sequence (5’ - 3’) reep5 (forward) GATACCCAGCCTACATCTCAATG reep5 (reverse) GCAATGCTGAACACACCATATAC ifnb (forward) ATGAGTGGTGGTTGCAGGC ifnb (reverse) TGACCTTTCAAATGCAGTAGATTCA cathepsin B (forward) TCCTTGATCCTTCTTTCTTGCC cathepsin B (reverse) ACAGTGCCACACAGCTTCTTC a3 serpins (forward) TTTCCAGCAACCTCTCAAGGC a3 serpins (reverse) CTGGGTGTGATTGCCCACATA serpina3a (forward) AGATGTCATCACAATAGCCCG serpina3a (reverse) TTTGTTAAAGGGTTGATAACC serpina3b (forward) GATGCAATCACAATAGTCGGATAC serpina3b (reverse) GGTTGATAACCTTGCCCATTAC serpina3c (forward) CTTAGTAGAAGAACCAGTCTG serpina3c (reverse) CTTAGGGTGAGTGATTTTGGC serpina3f (forward) ATCTCCAATGTTGTCAAGGTG serpina3f (reverse) TGAAACTTTTGCCATAAAGAG serpina3g (forward) ACAGGAATGGCAGGTGTCGG serpina3g (reverse) TGTAACTTTTGCCATAAAGA serpina3h (forward) ACAGGGGTCAAATTAATTC serpina3h (reverse) CTTGGGATTTGTAACTTTGGC serpina3i (forward) AGGAGTCAAAGTTAATCTACG serpina3i (reverse) CTTGGGATTTGTAACTTTGGC serpina3j (forward) CAAGAGACAAATATGACTTC serpina3j (reverse) GTGCAGGGTTGTTGATCTTGC serpina3k (forward) GGCCATTCCTGATTGTTATC serpina3k (reverse) TGAGAACTTGGTGAGCTTTA serpina3m (forward) GCTTTCGTTCTAGAAGATTAC serpina3m (reverse) CTTGGGGTTAGTGACTTTGGC serpina3n (forward) CAATGTCTGCGAAACTGTACC serpina3n (reverse) TTTGGGGTTGGCTATCTTGGC Primers for genotyping Sequence (5’ - 3’) oSB073 GGGCGGTGTAGGCCGCTGGACC oSB080 CCATCTGGGCATGTGGGATTGGGAC oSB085 CCAGAAAGTCAAAAACTGCACAACATCCG oSB086 CTGGAGCACATCCTTCCTGAGTTGG Antibodies Source Catalog number Monoclonal rat anti-CD3 BioLegend Cat# 100227, clone 17A2 Monoclonal rat antiCD11b BioLegend Cat# 101237, clone M1/70 Monoclonal rat antiCD19 BioLegend Cat# 115537, clone 6D5 Monoclonal mouse antiCD45.2 eBiosciences Cat# 56-0454-82, clone 104 3(3) Monoclonal rat antiLy6C BioLegend Cat# 128012, clone HK1.4 Monoclonal rat antiLy6G BD Biosciences Cat# 563979, clone 1A8 Monoclonal rat antiMHCII/I-A/I-E BD Biosciences Cat# 563415, clone M5/114.15.2 Monoclonal Armenian Hamster anti-TCRβ BioLegend Cat# 109230, clone H57-597 Purified rat antiCD16/CD32 block BD Biosciences Cat# 553142, clone 2.4G2 Equipment Source iQ5 Real-Time PCR Detection System Bio-Rad CFX384 Touch RealTime PCR Detection System Bio-Rad SPECTROstar BMG Labtech Varioskan Lux ThermoFisher Scientific TissueLyser II Qiagen Biopulverizer Biospec Products Homogenizer PT1200 E Polytron Flow cytometer LSRII BD Biosciences Software Source Prism 9 GraphPad Illustrator 2023 Adobe CFX Maestro Bio-Rad FlowJo, version 9.9.6 and v10.7.1 BD Biosciences FACSDiva, version 8.0 BD Biosciences

    Article Title: Treponema pallidum promotes macrophage polarization and activates the NLRP3 inflammasome pathway to induce interleukin-1β production.
    Article Snippet: Inhibitory effects of cathepsin B, ROS, K+, and caspase-1 and their impact on IL-1β expression M0 macrophages were preincubated for 30 min with various inhibitors, namely, 25 mM N-acetylcysteine (NAC) (a ROS inhibitor; Sigma-Aldrich, St. Louis, MO, USA), 30 mM CA074-Me (a cathepsin B inhibitor; Calbiochem, San Diego, CA, USA), 100 mM KCl (a potassium channel inhibitor; Sigma, St. Louis, MO, USA), or 2 μM N-benzyloxycarbonyl-Val-Ala-Asp(O-methyl)-fluoromethyl ketone (Z-VAD-FMK; a caspase-1 inhibitor; Invitrogen Inc., USA).

    Article Title: Fluid shear-induced cathepsin B release in the control of Mac1-dependent neutrophil adhesion
    Article Snippet: Experiments were conducted with cell populations treated with and without 30 μM E64 (cysteine protease inhibitor; Sigma-Aldrich), 50 μM CA074-me (ctsB inhibitor; EMD Millipore, Billerica, MA), or 5 μM AP (negative control inhibitor; Sigma-Aldrich) for 5 min before shear exposure, as reported [ 17 ].

    Article Title: Treponema pallidum promotes macrophage polarization and activates the NLRP3 inflammasome pathway to induce interleukin-1β production
    Article Snippet: M0 macrophages were preincubated for 30 min with various inhibitors, namely, 25 mM N-acetylcysteine (NAC) (a ROS inhibitor; Sigma-Aldrich, St. Louis, MO, USA), 30 mM CA074-Me (a cathepsin B inhibitor; Calbiochem, San Diego, CA, USA), 100 mM KCl (a potassium channel inhibitor; Sigma, St. Louis, MO, USA), or 2 μM N -benzyloxycarbonyl-Val-Ala-Asp( O -methyl)-fluoromethyl ketone (Z-VAD-FMK; a caspase-1 inhibitor; Invitrogen Inc., USA).

    Article Title: Functional inhibition of acid sphingomyelinase disrupts infection by intracellular bacterial pathogens
    Article Snippet: Language Please check spelling and correct notat ion part icularly of chemicals throughout the text , for example: Line 517f: Spelling mistakes: Hoeschst 33342 should be Hoechst amitrypt iline (MilliporeSigma) should be amitriptyline nortrypt iline (MilliporeSigma)should be nortriptyline Ca074-Me (MilliporeSigma) should be CA-074 Me Bodipy (e.g. figures 4D, E) should be consistent ly BODIPY 1st Authors' Response to Reviewers: March 5, 2019 March 5, 2019 RE: Response to reviewer comments for manuscript LSA-2018-00292-TR Dear Reviewers: We hereby resubmit our manuscript, “Functional inhibition of acid sphingomyelinase disrupts infection by intracellular bacterial pathogens” (LSA-2018-00292-TR) for your consideration for publication in Life Science Alliance.

    Article Title: Protective mechanisms of CA074-me (other than cathepsin-B inhibition) against programmed necrosis induced by global cerebral ischemia/reperfusion injury in rats.
    Article Snippet: Many studies have demonstrated the key role of lysosomes in ischemic cell death in the brain and have led to the “lysosomocentric” hypothesis.. In this hypothesis, the release of cathepsin-B due to a change of lysosomal membrane permeabilization (LMP) or rupture is critical, and this can be prevented by its inhibitors CA074 and CA074-me.. However, the role of CA074-me in neuronal death and its effect on the change of lysosomal membrane integrity after global cerebral ischemia/reperfusion (I/R) injury is not clear, so we investigated this here.

    Article Title: Lysophosphatidylcholine Induces NLRP3 Inflammasome-Mediated Foam Cell Formation and Pyroptosis in Human Monocytes and Endothelial Cells
    Article Snippet: Depending on the assay, the cells were also treated with pharmacological inhibitors: N -acetyl- l -cysteine (NAC), 5 mM (Sigma-Aldrich); Ac-YVAD-cho, 20 μM (Enzo Life Sciences); glyburide, 150 μM (Sigma-Aldrich); CA074-ME, 50 μM (Sigma-Aldrich); statin, 25 μM (Sigma-Aldrich); GW9662, 1 μM (Sigma-Aldrich); methyl-beta-cyclodextrin, 10 μM (Sigma-Aldrich); and PAb-hTLR2, 10 μg/ml (InvivoGen).

    Article Title: Functional inhibition of acid sphingomyelinase disrupts infection by intracellular bacterial pathogens
    Article Snippet: Ca074-Me (MilliporeSigma) should be CA-074 Me RESPONSE: Thank you for noting this error, which has now been corrected throughout.

    Polymerase Chain Reaction:

    Article Title:
    Article Snippet: CA074-Me CalBiochem Cat# 205531 E64 Sigma-Aldrich Cat# E3132 Pepstatin A Sigma-Aldrich Cat# P5318 RKLLW-NH2 Sigma-Aldrich Cat# SCP0110 Primers Sequence (5’ - 3’) reep5 (forward) GATACCCAGCCTACATCTCAATG reep5 (reverse) GCAATGCTGAACACACCATATAC ifnb (forward) ATGAGTGGTGGTTGCAGGC ifnb (reverse) TGACCTTTCAAATGCAGTAGATTCA cathepsin B (forward) TCCTTGATCCTTCTTTCTTGCC cathepsin B (reverse) ACAGTGCCACACAGCTTCTTC a3 serpins (forward) TTTCCAGCAACCTCTCAAGGC a3 serpins (reverse) CTGGGTGTGATTGCCCACATA serpina3a (forward) AGATGTCATCACAATAGCCCG serpina3a (reverse) TTTGTTAAAGGGTTGATAACC serpina3b (forward) GATGCAATCACAATAGTCGGATAC serpina3b (reverse) GGTTGATAACCTTGCCCATTAC serpina3c (forward) CTTAGTAGAAGAACCAGTCTG serpina3c (reverse) CTTAGGGTGAGTGATTTTGGC serpina3f (forward) ATCTCCAATGTTGTCAAGGTG serpina3f (reverse) TGAAACTTTTGCCATAAAGAG serpina3g (forward) ACAGGAATGGCAGGTGTCGG serpina3g (reverse) TGTAACTTTTGCCATAAAGA serpina3h (forward) ACAGGGGTCAAATTAATTC serpina3h (reverse) CTTGGGATTTGTAACTTTGGC serpina3i (forward) AGGAGTCAAAGTTAATCTACG serpina3i (reverse) CTTGGGATTTGTAACTTTGGC serpina3j (forward) CAAGAGACAAATATGACTTC serpina3j (reverse) GTGCAGGGTTGTTGATCTTGC serpina3k (forward) GGCCATTCCTGATTGTTATC serpina3k (reverse) TGAGAACTTGGTGAGCTTTA serpina3m (forward) GCTTTCGTTCTAGAAGATTAC serpina3m (reverse) CTTGGGGTTAGTGACTTTGGC serpina3n (forward) CAATGTCTGCGAAACTGTACC serpina3n (reverse) TTTGGGGTTGGCTATCTTGGC Primers for genotyping Sequence (5’ - 3’) oSB073 GGGCGGTGTAGGCCGCTGGACC oSB080 CCATCTGGGCATGTGGGATTGGGAC oSB085 CCAGAAAGTCAAAAACTGCACAACATCCG oSB086 CTGGAGCACATCCTTCCTGAGTTGG Antibodies Source Catalog number Monoclonal rat anti-CD3 BioLegend Cat# 100227, clone 17A2 Monoclonal rat antiCD11b BioLegend Cat# 101237, clone M1/70 Monoclonal rat antiCD19 BioLegend Cat# 115537, clone 6D5 Monoclonal mouse antiCD45.2 eBiosciences Cat# 56-0454-82, clone 104 3(3) Monoclonal rat antiLy6C BioLegend Cat# 128012, clone HK1.4 Monoclonal rat antiLy6G BD Biosciences Cat# 563979, clone 1A8 Monoclonal rat antiMHCII/I-A/I-E BD Biosciences Cat# 563415, clone M5/114.15.2 Monoclonal Armenian Hamster anti-TCRβ BioLegend Cat# 109230, clone H57-597 Purified rat antiCD16/CD32 block BD Biosciences Cat# 553142, clone 2.4G2 Equipment Source iQ5 Real-Time PCR Detection System Bio-Rad CFX384 Touch RealTime PCR Detection System Bio-Rad SPECTROstar BMG Labtech Varioskan Lux ThermoFisher Scientific TissueLyser II Qiagen Biopulverizer Biospec Products Homogenizer PT1200 E Polytron Flow cytometer LSRII BD Biosciences Software Source Prism 9 GraphPad Illustrator 2023 Adobe CFX Maestro Bio-Rad FlowJo, version 9.9.6 and v10.7.1 BD Biosciences FACSDiva, version 8.0 BD Biosciences

    Article Title: Treponema pallidum promotes macrophage polarization and activates the NLRP3 inflammasome pathway to induce interleukin-1β production.
    Article Snippet: Inhibitory effects of cathepsin B, ROS, K+, and caspase-1 and their impact on IL-1β expression M0 macrophages were preincubated for 30 min with various inhibitors, namely, 25 mM N-acetylcysteine (NAC) (a ROS inhibitor; Sigma-Aldrich, St. Louis, MO, USA), 30 mM CA074-Me (a cathepsin B inhibitor; Calbiochem, San Diego, CA, USA), 100 mM KCl (a potassium channel inhibitor; Sigma, St. Louis, MO, USA), or 2 μM N-benzyloxycarbonyl-Val-Ala-Asp(O-methyl)-fluoromethyl ketone (Z-VAD-FMK; a caspase-1 inhibitor; Invitrogen Inc., USA).

    Article Title: Fluid shear-induced cathepsin B release in the control of Mac1-dependent neutrophil adhesion
    Article Snippet: Experiments were conducted with cell populations treated with and without 30 μM E64 (cysteine protease inhibitor; Sigma-Aldrich), 50 μM CA074-me (ctsB inhibitor; EMD Millipore, Billerica, MA), or 5 μM AP (negative control inhibitor; Sigma-Aldrich) for 5 min before shear exposure, as reported [ 17 ].

    Article Title: Treponema pallidum promotes macrophage polarization and activates the NLRP3 inflammasome pathway to induce interleukin-1β production
    Article Snippet: M0 macrophages were preincubated for 30 min with various inhibitors, namely, 25 mM N-acetylcysteine (NAC) (a ROS inhibitor; Sigma-Aldrich, St. Louis, MO, USA), 30 mM CA074-Me (a cathepsin B inhibitor; Calbiochem, San Diego, CA, USA), 100 mM KCl (a potassium channel inhibitor; Sigma, St. Louis, MO, USA), or 2 μM N -benzyloxycarbonyl-Val-Ala-Asp( O -methyl)-fluoromethyl ketone (Z-VAD-FMK; a caspase-1 inhibitor; Invitrogen Inc., USA).

    Article Title: Functional inhibition of acid sphingomyelinase disrupts infection by intracellular bacterial pathogens
    Article Snippet: Language Please check spelling and correct notat ion part icularly of chemicals throughout the text , for example: Line 517f: Spelling mistakes: Hoeschst 33342 should be Hoechst amitrypt iline (MilliporeSigma) should be amitriptyline nortrypt iline (MilliporeSigma)should be nortriptyline Ca074-Me (MilliporeSigma) should be CA-074 Me Bodipy (e.g. figures 4D, E) should be consistent ly BODIPY 1st Authors' Response to Reviewers: March 5, 2019 March 5, 2019 RE: Response to reviewer comments for manuscript LSA-2018-00292-TR Dear Reviewers: We hereby resubmit our manuscript, “Functional inhibition of acid sphingomyelinase disrupts infection by intracellular bacterial pathogens” (LSA-2018-00292-TR) for your consideration for publication in Life Science Alliance.

    Article Title: Protective mechanisms of CA074-me (other than cathepsin-B inhibition) against programmed necrosis induced by global cerebral ischemia/reperfusion injury in rats.
    Article Snippet: Many studies have demonstrated the key role of lysosomes in ischemic cell death in the brain and have led to the “lysosomocentric” hypothesis.. In this hypothesis, the release of cathepsin-B due to a change of lysosomal membrane permeabilization (LMP) or rupture is critical, and this can be prevented by its inhibitors CA074 and CA074-me.. However, the role of CA074-me in neuronal death and its effect on the change of lysosomal membrane integrity after global cerebral ischemia/reperfusion (I/R) injury is not clear, so we investigated this here.

    Article Title: Lysophosphatidylcholine Induces NLRP3 Inflammasome-Mediated Foam Cell Formation and Pyroptosis in Human Monocytes and Endothelial Cells
    Article Snippet: Depending on the assay, the cells were also treated with pharmacological inhibitors: N -acetyl- l -cysteine (NAC), 5 mM (Sigma-Aldrich); Ac-YVAD-cho, 20 μM (Enzo Life Sciences); glyburide, 150 μM (Sigma-Aldrich); CA074-ME, 50 μM (Sigma-Aldrich); statin, 25 μM (Sigma-Aldrich); GW9662, 1 μM (Sigma-Aldrich); methyl-beta-cyclodextrin, 10 μM (Sigma-Aldrich); and PAb-hTLR2, 10 μg/ml (InvivoGen).

    Article Title: Functional inhibition of acid sphingomyelinase disrupts infection by intracellular bacterial pathogens
    Article Snippet: Ca074-Me (MilliporeSigma) should be CA-074 Me RESPONSE: Thank you for noting this error, which has now been corrected throughout.

    Flow Cytometry:

    Article Title:
    Article Snippet: CA074-Me CalBiochem Cat# 205531 E64 Sigma-Aldrich Cat# E3132 Pepstatin A Sigma-Aldrich Cat# P5318 RKLLW-NH2 Sigma-Aldrich Cat# SCP0110 Primers Sequence (5’ - 3’) reep5 (forward) GATACCCAGCCTACATCTCAATG reep5 (reverse) GCAATGCTGAACACACCATATAC ifnb (forward) ATGAGTGGTGGTTGCAGGC ifnb (reverse) TGACCTTTCAAATGCAGTAGATTCA cathepsin B (forward) TCCTTGATCCTTCTTTCTTGCC cathepsin B (reverse) ACAGTGCCACACAGCTTCTTC a3 serpins (forward) TTTCCAGCAACCTCTCAAGGC a3 serpins (reverse) CTGGGTGTGATTGCCCACATA serpina3a (forward) AGATGTCATCACAATAGCCCG serpina3a (reverse) TTTGTTAAAGGGTTGATAACC serpina3b (forward) GATGCAATCACAATAGTCGGATAC serpina3b (reverse) GGTTGATAACCTTGCCCATTAC serpina3c (forward) CTTAGTAGAAGAACCAGTCTG serpina3c (reverse) CTTAGGGTGAGTGATTTTGGC serpina3f (forward) ATCTCCAATGTTGTCAAGGTG serpina3f (reverse) TGAAACTTTTGCCATAAAGAG serpina3g (forward) ACAGGAATGGCAGGTGTCGG serpina3g (reverse) TGTAACTTTTGCCATAAAGA serpina3h (forward) ACAGGGGTCAAATTAATTC serpina3h (reverse) CTTGGGATTTGTAACTTTGGC serpina3i (forward) AGGAGTCAAAGTTAATCTACG serpina3i (reverse) CTTGGGATTTGTAACTTTGGC serpina3j (forward) CAAGAGACAAATATGACTTC serpina3j (reverse) GTGCAGGGTTGTTGATCTTGC serpina3k (forward) GGCCATTCCTGATTGTTATC serpina3k (reverse) TGAGAACTTGGTGAGCTTTA serpina3m (forward) GCTTTCGTTCTAGAAGATTAC serpina3m (reverse) CTTGGGGTTAGTGACTTTGGC serpina3n (forward) CAATGTCTGCGAAACTGTACC serpina3n (reverse) TTTGGGGTTGGCTATCTTGGC Primers for genotyping Sequence (5’ - 3’) oSB073 GGGCGGTGTAGGCCGCTGGACC oSB080 CCATCTGGGCATGTGGGATTGGGAC oSB085 CCAGAAAGTCAAAAACTGCACAACATCCG oSB086 CTGGAGCACATCCTTCCTGAGTTGG Antibodies Source Catalog number Monoclonal rat anti-CD3 BioLegend Cat# 100227, clone 17A2 Monoclonal rat antiCD11b BioLegend Cat# 101237, clone M1/70 Monoclonal rat antiCD19 BioLegend Cat# 115537, clone 6D5 Monoclonal mouse antiCD45.2 eBiosciences Cat# 56-0454-82, clone 104 3(3) Monoclonal rat antiLy6C BioLegend Cat# 128012, clone HK1.4 Monoclonal rat antiLy6G BD Biosciences Cat# 563979, clone 1A8 Monoclonal rat antiMHCII/I-A/I-E BD Biosciences Cat# 563415, clone M5/114.15.2 Monoclonal Armenian Hamster anti-TCRβ BioLegend Cat# 109230, clone H57-597 Purified rat antiCD16/CD32 block BD Biosciences Cat# 553142, clone 2.4G2 Equipment Source iQ5 Real-Time PCR Detection System Bio-Rad CFX384 Touch RealTime PCR Detection System Bio-Rad SPECTROstar BMG Labtech Varioskan Lux ThermoFisher Scientific TissueLyser II Qiagen Biopulverizer Biospec Products Homogenizer PT1200 E Polytron Flow cytometer LSRII BD Biosciences Software Source Prism 9 GraphPad Illustrator 2023 Adobe CFX Maestro Bio-Rad FlowJo, version 9.9.6 and v10.7.1 BD Biosciences FACSDiva, version 8.0 BD Biosciences

    Article Title: Treponema pallidum promotes macrophage polarization and activates the NLRP3 inflammasome pathway to induce interleukin-1β production.
    Article Snippet: Inhibitory effects of cathepsin B, ROS, K+, and caspase-1 and their impact on IL-1β expression M0 macrophages were preincubated for 30 min with various inhibitors, namely, 25 mM N-acetylcysteine (NAC) (a ROS inhibitor; Sigma-Aldrich, St. Louis, MO, USA), 30 mM CA074-Me (a cathepsin B inhibitor; Calbiochem, San Diego, CA, USA), 100 mM KCl (a potassium channel inhibitor; Sigma, St. Louis, MO, USA), or 2 μM N-benzyloxycarbonyl-Val-Ala-Asp(O-methyl)-fluoromethyl ketone (Z-VAD-FMK; a caspase-1 inhibitor; Invitrogen Inc., USA).

    Article Title: Fluid shear-induced cathepsin B release in the control of Mac1-dependent neutrophil adhesion
    Article Snippet: Experiments were conducted with cell populations treated with and without 30 μM E64 (cysteine protease inhibitor; Sigma-Aldrich), 50 μM CA074-me (ctsB inhibitor; EMD Millipore, Billerica, MA), or 5 μM AP (negative control inhibitor; Sigma-Aldrich) for 5 min before shear exposure, as reported [ 17 ].

    Article Title: Treponema pallidum promotes macrophage polarization and activates the NLRP3 inflammasome pathway to induce interleukin-1β production
    Article Snippet: M0 macrophages were preincubated for 30 min with various inhibitors, namely, 25 mM N-acetylcysteine (NAC) (a ROS inhibitor; Sigma-Aldrich, St. Louis, MO, USA), 30 mM CA074-Me (a cathepsin B inhibitor; Calbiochem, San Diego, CA, USA), 100 mM KCl (a potassium channel inhibitor; Sigma, St. Louis, MO, USA), or 2 μM N -benzyloxycarbonyl-Val-Ala-Asp( O -methyl)-fluoromethyl ketone (Z-VAD-FMK; a caspase-1 inhibitor; Invitrogen Inc., USA).

    Article Title: Functional inhibition of acid sphingomyelinase disrupts infection by intracellular bacterial pathogens
    Article Snippet: Language Please check spelling and correct notat ion part icularly of chemicals throughout the text , for example: Line 517f: Spelling mistakes: Hoeschst 33342 should be Hoechst amitrypt iline (MilliporeSigma) should be amitriptyline nortrypt iline (MilliporeSigma)should be nortriptyline Ca074-Me (MilliporeSigma) should be CA-074 Me Bodipy (e.g. figures 4D, E) should be consistent ly BODIPY 1st Authors' Response to Reviewers: March 5, 2019 March 5, 2019 RE: Response to reviewer comments for manuscript LSA-2018-00292-TR Dear Reviewers: We hereby resubmit our manuscript, “Functional inhibition of acid sphingomyelinase disrupts infection by intracellular bacterial pathogens” (LSA-2018-00292-TR) for your consideration for publication in Life Science Alliance.

    Article Title: Protective mechanisms of CA074-me (other than cathepsin-B inhibition) against programmed necrosis induced by global cerebral ischemia/reperfusion injury in rats.
    Article Snippet: Many studies have demonstrated the key role of lysosomes in ischemic cell death in the brain and have led to the “lysosomocentric” hypothesis.. In this hypothesis, the release of cathepsin-B due to a change of lysosomal membrane permeabilization (LMP) or rupture is critical, and this can be prevented by its inhibitors CA074 and CA074-me.. However, the role of CA074-me in neuronal death and its effect on the change of lysosomal membrane integrity after global cerebral ischemia/reperfusion (I/R) injury is not clear, so we investigated this here.

    Article Title: Lysophosphatidylcholine Induces NLRP3 Inflammasome-Mediated Foam Cell Formation and Pyroptosis in Human Monocytes and Endothelial Cells
    Article Snippet: Depending on the assay, the cells were also treated with pharmacological inhibitors: N -acetyl- l -cysteine (NAC), 5 mM (Sigma-Aldrich); Ac-YVAD-cho, 20 μM (Enzo Life Sciences); glyburide, 150 μM (Sigma-Aldrich); CA074-ME, 50 μM (Sigma-Aldrich); statin, 25 μM (Sigma-Aldrich); GW9662, 1 μM (Sigma-Aldrich); methyl-beta-cyclodextrin, 10 μM (Sigma-Aldrich); and PAb-hTLR2, 10 μg/ml (InvivoGen).

    Article Title: Functional inhibition of acid sphingomyelinase disrupts infection by intracellular bacterial pathogens
    Article Snippet: Ca074-Me (MilliporeSigma) should be CA-074 Me RESPONSE: Thank you for noting this error, which has now been corrected throughout.

    Software:

    Article Title:
    Article Snippet: CA074-Me CalBiochem Cat# 205531 E64 Sigma-Aldrich Cat# E3132 Pepstatin A Sigma-Aldrich Cat# P5318 RKLLW-NH2 Sigma-Aldrich Cat# SCP0110 Primers Sequence (5’ - 3’) reep5 (forward) GATACCCAGCCTACATCTCAATG reep5 (reverse) GCAATGCTGAACACACCATATAC ifnb (forward) ATGAGTGGTGGTTGCAGGC ifnb (reverse) TGACCTTTCAAATGCAGTAGATTCA cathepsin B (forward) TCCTTGATCCTTCTTTCTTGCC cathepsin B (reverse) ACAGTGCCACACAGCTTCTTC a3 serpins (forward) TTTCCAGCAACCTCTCAAGGC a3 serpins (reverse) CTGGGTGTGATTGCCCACATA serpina3a (forward) AGATGTCATCACAATAGCCCG serpina3a (reverse) TTTGTTAAAGGGTTGATAACC serpina3b (forward) GATGCAATCACAATAGTCGGATAC serpina3b (reverse) GGTTGATAACCTTGCCCATTAC serpina3c (forward) CTTAGTAGAAGAACCAGTCTG serpina3c (reverse) CTTAGGGTGAGTGATTTTGGC serpina3f (forward) ATCTCCAATGTTGTCAAGGTG serpina3f (reverse) TGAAACTTTTGCCATAAAGAG serpina3g (forward) ACAGGAATGGCAGGTGTCGG serpina3g (reverse) TGTAACTTTTGCCATAAAGA serpina3h (forward) ACAGGGGTCAAATTAATTC serpina3h (reverse) CTTGGGATTTGTAACTTTGGC serpina3i (forward) AGGAGTCAAAGTTAATCTACG serpina3i (reverse) CTTGGGATTTGTAACTTTGGC serpina3j (forward) CAAGAGACAAATATGACTTC serpina3j (reverse) GTGCAGGGTTGTTGATCTTGC serpina3k (forward) GGCCATTCCTGATTGTTATC serpina3k (reverse) TGAGAACTTGGTGAGCTTTA serpina3m (forward) GCTTTCGTTCTAGAAGATTAC serpina3m (reverse) CTTGGGGTTAGTGACTTTGGC serpina3n (forward) CAATGTCTGCGAAACTGTACC serpina3n (reverse) TTTGGGGTTGGCTATCTTGGC Primers for genotyping Sequence (5’ - 3’) oSB073 GGGCGGTGTAGGCCGCTGGACC oSB080 CCATCTGGGCATGTGGGATTGGGAC oSB085 CCAGAAAGTCAAAAACTGCACAACATCCG oSB086 CTGGAGCACATCCTTCCTGAGTTGG Antibodies Source Catalog number Monoclonal rat anti-CD3 BioLegend Cat# 100227, clone 17A2 Monoclonal rat antiCD11b BioLegend Cat# 101237, clone M1/70 Monoclonal rat antiCD19 BioLegend Cat# 115537, clone 6D5 Monoclonal mouse antiCD45.2 eBiosciences Cat# 56-0454-82, clone 104 3(3) Monoclonal rat antiLy6C BioLegend Cat# 128012, clone HK1.4 Monoclonal rat antiLy6G BD Biosciences Cat# 563979, clone 1A8 Monoclonal rat antiMHCII/I-A/I-E BD Biosciences Cat# 563415, clone M5/114.15.2 Monoclonal Armenian Hamster anti-TCRβ BioLegend Cat# 109230, clone H57-597 Purified rat antiCD16/CD32 block BD Biosciences Cat# 553142, clone 2.4G2 Equipment Source iQ5 Real-Time PCR Detection System Bio-Rad CFX384 Touch RealTime PCR Detection System Bio-Rad SPECTROstar BMG Labtech Varioskan Lux ThermoFisher Scientific TissueLyser II Qiagen Biopulverizer Biospec Products Homogenizer PT1200 E Polytron Flow cytometer LSRII BD Biosciences Software Source Prism 9 GraphPad Illustrator 2023 Adobe CFX Maestro Bio-Rad FlowJo, version 9.9.6 and v10.7.1 BD Biosciences FACSDiva, version 8.0 BD Biosciences

    Article Title: Treponema pallidum promotes macrophage polarization and activates the NLRP3 inflammasome pathway to induce interleukin-1β production.
    Article Snippet: Inhibitory effects of cathepsin B, ROS, K+, and caspase-1 and their impact on IL-1β expression M0 macrophages were preincubated for 30 min with various inhibitors, namely, 25 mM N-acetylcysteine (NAC) (a ROS inhibitor; Sigma-Aldrich, St. Louis, MO, USA), 30 mM CA074-Me (a cathepsin B inhibitor; Calbiochem, San Diego, CA, USA), 100 mM KCl (a potassium channel inhibitor; Sigma, St. Louis, MO, USA), or 2 μM N-benzyloxycarbonyl-Val-Ala-Asp(O-methyl)-fluoromethyl ketone (Z-VAD-FMK; a caspase-1 inhibitor; Invitrogen Inc., USA).

    Article Title: Fluid shear-induced cathepsin B release in the control of Mac1-dependent neutrophil adhesion
    Article Snippet: Experiments were conducted with cell populations treated with and without 30 μM E64 (cysteine protease inhibitor; Sigma-Aldrich), 50 μM CA074-me (ctsB inhibitor; EMD Millipore, Billerica, MA), or 5 μM AP (negative control inhibitor; Sigma-Aldrich) for 5 min before shear exposure, as reported [ 17 ].

    Article Title: Treponema pallidum promotes macrophage polarization and activates the NLRP3 inflammasome pathway to induce interleukin-1β production
    Article Snippet: M0 macrophages were preincubated for 30 min with various inhibitors, namely, 25 mM N-acetylcysteine (NAC) (a ROS inhibitor; Sigma-Aldrich, St. Louis, MO, USA), 30 mM CA074-Me (a cathepsin B inhibitor; Calbiochem, San Diego, CA, USA), 100 mM KCl (a potassium channel inhibitor; Sigma, St. Louis, MO, USA), or 2 μM N -benzyloxycarbonyl-Val-Ala-Asp( O -methyl)-fluoromethyl ketone (Z-VAD-FMK; a caspase-1 inhibitor; Invitrogen Inc., USA).

    Article Title: Functional inhibition of acid sphingomyelinase disrupts infection by intracellular bacterial pathogens
    Article Snippet: Language Please check spelling and correct notat ion part icularly of chemicals throughout the text , for example: Line 517f: Spelling mistakes: Hoeschst 33342 should be Hoechst amitrypt iline (MilliporeSigma) should be amitriptyline nortrypt iline (MilliporeSigma)should be nortriptyline Ca074-Me (MilliporeSigma) should be CA-074 Me Bodipy (e.g. figures 4D, E) should be consistent ly BODIPY 1st Authors' Response to Reviewers: March 5, 2019 March 5, 2019 RE: Response to reviewer comments for manuscript LSA-2018-00292-TR Dear Reviewers: We hereby resubmit our manuscript, “Functional inhibition of acid sphingomyelinase disrupts infection by intracellular bacterial pathogens” (LSA-2018-00292-TR) for your consideration for publication in Life Science Alliance.

    Article Title: Protective mechanisms of CA074-me (other than cathepsin-B inhibition) against programmed necrosis induced by global cerebral ischemia/reperfusion injury in rats.
    Article Snippet: Many studies have demonstrated the key role of lysosomes in ischemic cell death in the brain and have led to the “lysosomocentric” hypothesis.. In this hypothesis, the release of cathepsin-B due to a change of lysosomal membrane permeabilization (LMP) or rupture is critical, and this can be prevented by its inhibitors CA074 and CA074-me.. However, the role of CA074-me in neuronal death and its effect on the change of lysosomal membrane integrity after global cerebral ischemia/reperfusion (I/R) injury is not clear, so we investigated this here.

    Article Title: Lysophosphatidylcholine Induces NLRP3 Inflammasome-Mediated Foam Cell Formation and Pyroptosis in Human Monocytes and Endothelial Cells
    Article Snippet: Depending on the assay, the cells were also treated with pharmacological inhibitors: N -acetyl- l -cysteine (NAC), 5 mM (Sigma-Aldrich); Ac-YVAD-cho, 20 μM (Enzo Life Sciences); glyburide, 150 μM (Sigma-Aldrich); CA074-ME, 50 μM (Sigma-Aldrich); statin, 25 μM (Sigma-Aldrich); GW9662, 1 μM (Sigma-Aldrich); methyl-beta-cyclodextrin, 10 μM (Sigma-Aldrich); and PAb-hTLR2, 10 μg/ml (InvivoGen).

    Article Title: Functional inhibition of acid sphingomyelinase disrupts infection by intracellular bacterial pathogens
    Article Snippet: Ca074-Me (MilliporeSigma) should be CA-074 Me RESPONSE: Thank you for noting this error, which has now been corrected throughout.

    Functional Assay:

    Article Title:
    Article Snippet: CA074-Me CalBiochem Cat# 205531 E64 Sigma-Aldrich Cat# E3132 Pepstatin A Sigma-Aldrich Cat# P5318 RKLLW-NH2 Sigma-Aldrich Cat# SCP0110 Primers Sequence (5’ - 3’) reep5 (forward) GATACCCAGCCTACATCTCAATG reep5 (reverse) GCAATGCTGAACACACCATATAC ifnb (forward) ATGAGTGGTGGTTGCAGGC ifnb (reverse) TGACCTTTCAAATGCAGTAGATTCA cathepsin B (forward) TCCTTGATCCTTCTTTCTTGCC cathepsin B (reverse) ACAGTGCCACACAGCTTCTTC a3 serpins (forward) TTTCCAGCAACCTCTCAAGGC a3 serpins (reverse) CTGGGTGTGATTGCCCACATA serpina3a (forward) AGATGTCATCACAATAGCCCG serpina3a (reverse) TTTGTTAAAGGGTTGATAACC serpina3b (forward) GATGCAATCACAATAGTCGGATAC serpina3b (reverse) GGTTGATAACCTTGCCCATTAC serpina3c (forward) CTTAGTAGAAGAACCAGTCTG serpina3c (reverse) CTTAGGGTGAGTGATTTTGGC serpina3f (forward) ATCTCCAATGTTGTCAAGGTG serpina3f (reverse) TGAAACTTTTGCCATAAAGAG serpina3g (forward) ACAGGAATGGCAGGTGTCGG serpina3g (reverse) TGTAACTTTTGCCATAAAGA serpina3h (forward) ACAGGGGTCAAATTAATTC serpina3h (reverse) CTTGGGATTTGTAACTTTGGC serpina3i (forward) AGGAGTCAAAGTTAATCTACG serpina3i (reverse) CTTGGGATTTGTAACTTTGGC serpina3j (forward) CAAGAGACAAATATGACTTC serpina3j (reverse) GTGCAGGGTTGTTGATCTTGC serpina3k (forward) GGCCATTCCTGATTGTTATC serpina3k (reverse) TGAGAACTTGGTGAGCTTTA serpina3m (forward) GCTTTCGTTCTAGAAGATTAC serpina3m (reverse) CTTGGGGTTAGTGACTTTGGC serpina3n (forward) CAATGTCTGCGAAACTGTACC serpina3n (reverse) TTTGGGGTTGGCTATCTTGGC Primers for genotyping Sequence (5’ - 3’) oSB073 GGGCGGTGTAGGCCGCTGGACC oSB080 CCATCTGGGCATGTGGGATTGGGAC oSB085 CCAGAAAGTCAAAAACTGCACAACATCCG oSB086 CTGGAGCACATCCTTCCTGAGTTGG Antibodies Source Catalog number Monoclonal rat anti-CD3 BioLegend Cat# 100227, clone 17A2 Monoclonal rat antiCD11b BioLegend Cat# 101237, clone M1/70 Monoclonal rat antiCD19 BioLegend Cat# 115537, clone 6D5 Monoclonal mouse antiCD45.2 eBiosciences Cat# 56-0454-82, clone 104 3(3) Monoclonal rat antiLy6C BioLegend Cat# 128012, clone HK1.4 Monoclonal rat antiLy6G BD Biosciences Cat# 563979, clone 1A8 Monoclonal rat antiMHCII/I-A/I-E BD Biosciences Cat# 563415, clone M5/114.15.2 Monoclonal Armenian Hamster anti-TCRβ BioLegend Cat# 109230, clone H57-597 Purified rat antiCD16/CD32 block BD Biosciences Cat# 553142, clone 2.4G2 Equipment Source iQ5 Real-Time PCR Detection System Bio-Rad CFX384 Touch RealTime PCR Detection System Bio-Rad SPECTROstar BMG Labtech Varioskan Lux ThermoFisher Scientific TissueLyser II Qiagen Biopulverizer Biospec Products Homogenizer PT1200 E Polytron Flow cytometer LSRII BD Biosciences Software Source Prism 9 GraphPad Illustrator 2023 Adobe CFX Maestro Bio-Rad FlowJo, version 9.9.6 and v10.7.1 BD Biosciences FACSDiva, version 8.0 BD Biosciences

    Article Title: Treponema pallidum promotes macrophage polarization and activates the NLRP3 inflammasome pathway to induce interleukin-1β production.
    Article Snippet: Inhibitory effects of cathepsin B, ROS, K+, and caspase-1 and their impact on IL-1β expression M0 macrophages were preincubated for 30 min with various inhibitors, namely, 25 mM N-acetylcysteine (NAC) (a ROS inhibitor; Sigma-Aldrich, St. Louis, MO, USA), 30 mM CA074-Me (a cathepsin B inhibitor; Calbiochem, San Diego, CA, USA), 100 mM KCl (a potassium channel inhibitor; Sigma, St. Louis, MO, USA), or 2 μM N-benzyloxycarbonyl-Val-Ala-Asp(O-methyl)-fluoromethyl ketone (Z-VAD-FMK; a caspase-1 inhibitor; Invitrogen Inc., USA).

    Article Title: Fluid shear-induced cathepsin B release in the control of Mac1-dependent neutrophil adhesion
    Article Snippet: Experiments were conducted with cell populations treated with and without 30 μM E64 (cysteine protease inhibitor; Sigma-Aldrich), 50 μM CA074-me (ctsB inhibitor; EMD Millipore, Billerica, MA), or 5 μM AP (negative control inhibitor; Sigma-Aldrich) for 5 min before shear exposure, as reported [ 17 ].

    Article Title: Treponema pallidum promotes macrophage polarization and activates the NLRP3 inflammasome pathway to induce interleukin-1β production
    Article Snippet: M0 macrophages were preincubated for 30 min with various inhibitors, namely, 25 mM N-acetylcysteine (NAC) (a ROS inhibitor; Sigma-Aldrich, St. Louis, MO, USA), 30 mM CA074-Me (a cathepsin B inhibitor; Calbiochem, San Diego, CA, USA), 100 mM KCl (a potassium channel inhibitor; Sigma, St. Louis, MO, USA), or 2 μM N -benzyloxycarbonyl-Val-Ala-Asp( O -methyl)-fluoromethyl ketone (Z-VAD-FMK; a caspase-1 inhibitor; Invitrogen Inc., USA).

    Article Title: Functional inhibition of acid sphingomyelinase disrupts infection by intracellular bacterial pathogens
    Article Snippet: Language Please check spelling and correct notat ion part icularly of chemicals throughout the text , for example: Line 517f: Spelling mistakes: Hoeschst 33342 should be Hoechst amitrypt iline (MilliporeSigma) should be amitriptyline nortrypt iline (MilliporeSigma)should be nortriptyline Ca074-Me (MilliporeSigma) should be CA-074 Me Bodipy (e.g. figures 4D, E) should be consistent ly BODIPY 1st Authors' Response to Reviewers: March 5, 2019 March 5, 2019 RE: Response to reviewer comments for manuscript LSA-2018-00292-TR Dear Reviewers: We hereby resubmit our manuscript, “Functional inhibition of acid sphingomyelinase disrupts infection by intracellular bacterial pathogens” (LSA-2018-00292-TR) for your consideration for publication in Life Science Alliance.

    Article Title: Protective mechanisms of CA074-me (other than cathepsin-B inhibition) against programmed necrosis induced by global cerebral ischemia/reperfusion injury in rats.
    Article Snippet: Many studies have demonstrated the key role of lysosomes in ischemic cell death in the brain and have led to the “lysosomocentric” hypothesis.. In this hypothesis, the release of cathepsin-B due to a change of lysosomal membrane permeabilization (LMP) or rupture is critical, and this can be prevented by its inhibitors CA074 and CA074-me.. However, the role of CA074-me in neuronal death and its effect on the change of lysosomal membrane integrity after global cerebral ischemia/reperfusion (I/R) injury is not clear, so we investigated this here.

    Article Title: Lysophosphatidylcholine Induces NLRP3 Inflammasome-Mediated Foam Cell Formation and Pyroptosis in Human Monocytes and Endothelial Cells
    Article Snippet: Depending on the assay, the cells were also treated with pharmacological inhibitors: N -acetyl- l -cysteine (NAC), 5 mM (Sigma-Aldrich); Ac-YVAD-cho, 20 μM (Enzo Life Sciences); glyburide, 150 μM (Sigma-Aldrich); CA074-ME, 50 μM (Sigma-Aldrich); statin, 25 μM (Sigma-Aldrich); GW9662, 1 μM (Sigma-Aldrich); methyl-beta-cyclodextrin, 10 μM (Sigma-Aldrich); and PAb-hTLR2, 10 μg/ml (InvivoGen).

    Article Title: Functional inhibition of acid sphingomyelinase disrupts infection by intracellular bacterial pathogens
    Article Snippet: Ca074-Me (MilliporeSigma) should be CA-074 Me RESPONSE: Thank you for noting this error, which has now been corrected throughout.

    Inhibition:

    Article Title:
    Article Snippet: CA074-Me CalBiochem Cat# 205531 E64 Sigma-Aldrich Cat# E3132 Pepstatin A Sigma-Aldrich Cat# P5318 RKLLW-NH2 Sigma-Aldrich Cat# SCP0110 Primers Sequence (5’ - 3’) reep5 (forward) GATACCCAGCCTACATCTCAATG reep5 (reverse) GCAATGCTGAACACACCATATAC ifnb (forward) ATGAGTGGTGGTTGCAGGC ifnb (reverse) TGACCTTTCAAATGCAGTAGATTCA cathepsin B (forward) TCCTTGATCCTTCTTTCTTGCC cathepsin B (reverse) ACAGTGCCACACAGCTTCTTC a3 serpins (forward) TTTCCAGCAACCTCTCAAGGC a3 serpins (reverse) CTGGGTGTGATTGCCCACATA serpina3a (forward) AGATGTCATCACAATAGCCCG serpina3a (reverse) TTTGTTAAAGGGTTGATAACC serpina3b (forward) GATGCAATCACAATAGTCGGATAC serpina3b (reverse) GGTTGATAACCTTGCCCATTAC serpina3c (forward) CTTAGTAGAAGAACCAGTCTG serpina3c (reverse) CTTAGGGTGAGTGATTTTGGC serpina3f (forward) ATCTCCAATGTTGTCAAGGTG serpina3f (reverse) TGAAACTTTTGCCATAAAGAG serpina3g (forward) ACAGGAATGGCAGGTGTCGG serpina3g (reverse) TGTAACTTTTGCCATAAAGA serpina3h (forward) ACAGGGGTCAAATTAATTC serpina3h (reverse) CTTGGGATTTGTAACTTTGGC serpina3i (forward) AGGAGTCAAAGTTAATCTACG serpina3i (reverse) CTTGGGATTTGTAACTTTGGC serpina3j (forward) CAAGAGACAAATATGACTTC serpina3j (reverse) GTGCAGGGTTGTTGATCTTGC serpina3k (forward) GGCCATTCCTGATTGTTATC serpina3k (reverse) TGAGAACTTGGTGAGCTTTA serpina3m (forward) GCTTTCGTTCTAGAAGATTAC serpina3m (reverse) CTTGGGGTTAGTGACTTTGGC serpina3n (forward) CAATGTCTGCGAAACTGTACC serpina3n (reverse) TTTGGGGTTGGCTATCTTGGC Primers for genotyping Sequence (5’ - 3’) oSB073 GGGCGGTGTAGGCCGCTGGACC oSB080 CCATCTGGGCATGTGGGATTGGGAC oSB085 CCAGAAAGTCAAAAACTGCACAACATCCG oSB086 CTGGAGCACATCCTTCCTGAGTTGG Antibodies Source Catalog number Monoclonal rat anti-CD3 BioLegend Cat# 100227, clone 17A2 Monoclonal rat antiCD11b BioLegend Cat# 101237, clone M1/70 Monoclonal rat antiCD19 BioLegend Cat# 115537, clone 6D5 Monoclonal mouse antiCD45.2 eBiosciences Cat# 56-0454-82, clone 104 3(3) Monoclonal rat antiLy6C BioLegend Cat# 128012, clone HK1.4 Monoclonal rat antiLy6G BD Biosciences Cat# 563979, clone 1A8 Monoclonal rat antiMHCII/I-A/I-E BD Biosciences Cat# 563415, clone M5/114.15.2 Monoclonal Armenian Hamster anti-TCRβ BioLegend Cat# 109230, clone H57-597 Purified rat antiCD16/CD32 block BD Biosciences Cat# 553142, clone 2.4G2 Equipment Source iQ5 Real-Time PCR Detection System Bio-Rad CFX384 Touch RealTime PCR Detection System Bio-Rad SPECTROstar BMG Labtech Varioskan Lux ThermoFisher Scientific TissueLyser II Qiagen Biopulverizer Biospec Products Homogenizer PT1200 E Polytron Flow cytometer LSRII BD Biosciences Software Source Prism 9 GraphPad Illustrator 2023 Adobe CFX Maestro Bio-Rad FlowJo, version 9.9.6 and v10.7.1 BD Biosciences FACSDiva, version 8.0 BD Biosciences

    Article Title: Treponema pallidum promotes macrophage polarization and activates the NLRP3 inflammasome pathway to induce interleukin-1β production.
    Article Snippet: Inhibitory effects of cathepsin B, ROS, K+, and caspase-1 and their impact on IL-1β expression M0 macrophages were preincubated for 30 min with various inhibitors, namely, 25 mM N-acetylcysteine (NAC) (a ROS inhibitor; Sigma-Aldrich, St. Louis, MO, USA), 30 mM CA074-Me (a cathepsin B inhibitor; Calbiochem, San Diego, CA, USA), 100 mM KCl (a potassium channel inhibitor; Sigma, St. Louis, MO, USA), or 2 μM N-benzyloxycarbonyl-Val-Ala-Asp(O-methyl)-fluoromethyl ketone (Z-VAD-FMK; a caspase-1 inhibitor; Invitrogen Inc., USA).

    Article Title: Fluid shear-induced cathepsin B release in the control of Mac1-dependent neutrophil adhesion
    Article Snippet: Experiments were conducted with cell populations treated with and without 30 μM E64 (cysteine protease inhibitor; Sigma-Aldrich), 50 μM CA074-me (ctsB inhibitor; EMD Millipore, Billerica, MA), or 5 μM AP (negative control inhibitor; Sigma-Aldrich) for 5 min before shear exposure, as reported [ 17 ].

    Article Title: Treponema pallidum promotes macrophage polarization and activates the NLRP3 inflammasome pathway to induce interleukin-1β production
    Article Snippet: M0 macrophages were preincubated for 30 min with various inhibitors, namely, 25 mM N-acetylcysteine (NAC) (a ROS inhibitor; Sigma-Aldrich, St. Louis, MO, USA), 30 mM CA074-Me (a cathepsin B inhibitor; Calbiochem, San Diego, CA, USA), 100 mM KCl (a potassium channel inhibitor; Sigma, St. Louis, MO, USA), or 2 μM N -benzyloxycarbonyl-Val-Ala-Asp( O -methyl)-fluoromethyl ketone (Z-VAD-FMK; a caspase-1 inhibitor; Invitrogen Inc., USA).

    Article Title: Functional inhibition of acid sphingomyelinase disrupts infection by intracellular bacterial pathogens
    Article Snippet: Language Please check spelling and correct notat ion part icularly of chemicals throughout the text , for example: Line 517f: Spelling mistakes: Hoeschst 33342 should be Hoechst amitrypt iline (MilliporeSigma) should be amitriptyline nortrypt iline (MilliporeSigma)should be nortriptyline Ca074-Me (MilliporeSigma) should be CA-074 Me Bodipy (e.g. figures 4D, E) should be consistent ly BODIPY 1st Authors' Response to Reviewers: March 5, 2019 March 5, 2019 RE: Response to reviewer comments for manuscript LSA-2018-00292-TR Dear Reviewers: We hereby resubmit our manuscript, “Functional inhibition of acid sphingomyelinase disrupts infection by intracellular bacterial pathogens” (LSA-2018-00292-TR) for your consideration for publication in Life Science Alliance.

    Article Title: Protective mechanisms of CA074-me (other than cathepsin-B inhibition) against programmed necrosis induced by global cerebral ischemia/reperfusion injury in rats.
    Article Snippet: Many studies have demonstrated the key role of lysosomes in ischemic cell death in the brain and have led to the “lysosomocentric” hypothesis.. In this hypothesis, the release of cathepsin-B due to a change of lysosomal membrane permeabilization (LMP) or rupture is critical, and this can be prevented by its inhibitors CA074 and CA074-me.. However, the role of CA074-me in neuronal death and its effect on the change of lysosomal membrane integrity after global cerebral ischemia/reperfusion (I/R) injury is not clear, so we investigated this here.

    Article Title: Lysophosphatidylcholine Induces NLRP3 Inflammasome-Mediated Foam Cell Formation and Pyroptosis in Human Monocytes and Endothelial Cells
    Article Snippet: Depending on the assay, the cells were also treated with pharmacological inhibitors: N -acetyl- l -cysteine (NAC), 5 mM (Sigma-Aldrich); Ac-YVAD-cho, 20 μM (Enzo Life Sciences); glyburide, 150 μM (Sigma-Aldrich); CA074-ME, 50 μM (Sigma-Aldrich); statin, 25 μM (Sigma-Aldrich); GW9662, 1 μM (Sigma-Aldrich); methyl-beta-cyclodextrin, 10 μM (Sigma-Aldrich); and PAb-hTLR2, 10 μg/ml (InvivoGen).

    Article Title: Functional inhibition of acid sphingomyelinase disrupts infection by intracellular bacterial pathogens
    Article Snippet: Ca074-Me (MilliporeSigma) should be CA-074 Me RESPONSE: Thank you for noting this error, which has now been corrected throughout.

    Infection:

    Article Title:
    Article Snippet: CA074-Me CalBiochem Cat# 205531 E64 Sigma-Aldrich Cat# E3132 Pepstatin A Sigma-Aldrich Cat# P5318 RKLLW-NH2 Sigma-Aldrich Cat# SCP0110 Primers Sequence (5’ - 3’) reep5 (forward) GATACCCAGCCTACATCTCAATG reep5 (reverse) GCAATGCTGAACACACCATATAC ifnb (forward) ATGAGTGGTGGTTGCAGGC ifnb (reverse) TGACCTTTCAAATGCAGTAGATTCA cathepsin B (forward) TCCTTGATCCTTCTTTCTTGCC cathepsin B (reverse) ACAGTGCCACACAGCTTCTTC a3 serpins (forward) TTTCCAGCAACCTCTCAAGGC a3 serpins (reverse) CTGGGTGTGATTGCCCACATA serpina3a (forward) AGATGTCATCACAATAGCCCG serpina3a (reverse) TTTGTTAAAGGGTTGATAACC serpina3b (forward) GATGCAATCACAATAGTCGGATAC serpina3b (reverse) GGTTGATAACCTTGCCCATTAC serpina3c (forward) CTTAGTAGAAGAACCAGTCTG serpina3c (reverse) CTTAGGGTGAGTGATTTTGGC serpina3f (forward) ATCTCCAATGTTGTCAAGGTG serpina3f (reverse) TGAAACTTTTGCCATAAAGAG serpina3g (forward) ACAGGAATGGCAGGTGTCGG serpina3g (reverse) TGTAACTTTTGCCATAAAGA serpina3h (forward) ACAGGGGTCAAATTAATTC serpina3h (reverse) CTTGGGATTTGTAACTTTGGC serpina3i (forward) AGGAGTCAAAGTTAATCTACG serpina3i (reverse) CTTGGGATTTGTAACTTTGGC serpina3j (forward) CAAGAGACAAATATGACTTC serpina3j (reverse) GTGCAGGGTTGTTGATCTTGC serpina3k (forward) GGCCATTCCTGATTGTTATC serpina3k (reverse) TGAGAACTTGGTGAGCTTTA serpina3m (forward) GCTTTCGTTCTAGAAGATTAC serpina3m (reverse) CTTGGGGTTAGTGACTTTGGC serpina3n (forward) CAATGTCTGCGAAACTGTACC serpina3n (reverse) TTTGGGGTTGGCTATCTTGGC Primers for genotyping Sequence (5’ - 3’) oSB073 GGGCGGTGTAGGCCGCTGGACC oSB080 CCATCTGGGCATGTGGGATTGGGAC oSB085 CCAGAAAGTCAAAAACTGCACAACATCCG oSB086 CTGGAGCACATCCTTCCTGAGTTGG Antibodies Source Catalog number Monoclonal rat anti-CD3 BioLegend Cat# 100227, clone 17A2 Monoclonal rat antiCD11b BioLegend Cat# 101237, clone M1/70 Monoclonal rat antiCD19 BioLegend Cat# 115537, clone 6D5 Monoclonal mouse antiCD45.2 eBiosciences Cat# 56-0454-82, clone 104 3(3) Monoclonal rat antiLy6C BioLegend Cat# 128012, clone HK1.4 Monoclonal rat antiLy6G BD Biosciences Cat# 563979, clone 1A8 Monoclonal rat antiMHCII/I-A/I-E BD Biosciences Cat# 563415, clone M5/114.15.2 Monoclonal Armenian Hamster anti-TCRβ BioLegend Cat# 109230, clone H57-597 Purified rat antiCD16/CD32 block BD Biosciences Cat# 553142, clone 2.4G2 Equipment Source iQ5 Real-Time PCR Detection System Bio-Rad CFX384 Touch RealTime PCR Detection System Bio-Rad SPECTROstar BMG Labtech Varioskan Lux ThermoFisher Scientific TissueLyser II Qiagen Biopulverizer Biospec Products Homogenizer PT1200 E Polytron Flow cytometer LSRII BD Biosciences Software Source Prism 9 GraphPad Illustrator 2023 Adobe CFX Maestro Bio-Rad FlowJo, version 9.9.6 and v10.7.1 BD Biosciences FACSDiva, version 8.0 BD Biosciences

    Article Title: Treponema pallidum promotes macrophage polarization and activates the NLRP3 inflammasome pathway to induce interleukin-1β production.
    Article Snippet: Inhibitory effects of cathepsin B, ROS, K+, and caspase-1 and their impact on IL-1β expression M0 macrophages were preincubated for 30 min with various inhibitors, namely, 25 mM N-acetylcysteine (NAC) (a ROS inhibitor; Sigma-Aldrich, St. Louis, MO, USA), 30 mM CA074-Me (a cathepsin B inhibitor; Calbiochem, San Diego, CA, USA), 100 mM KCl (a potassium channel inhibitor; Sigma, St. Louis, MO, USA), or 2 μM N-benzyloxycarbonyl-Val-Ala-Asp(O-methyl)-fluoromethyl ketone (Z-VAD-FMK; a caspase-1 inhibitor; Invitrogen Inc., USA).

    Article Title: Fluid shear-induced cathepsin B release in the control of Mac1-dependent neutrophil adhesion
    Article Snippet: Experiments were conducted with cell populations treated with and without 30 μM E64 (cysteine protease inhibitor; Sigma-Aldrich), 50 μM CA074-me (ctsB inhibitor; EMD Millipore, Billerica, MA), or 5 μM AP (negative control inhibitor; Sigma-Aldrich) for 5 min before shear exposure, as reported [ 17 ].

    Article Title: Treponema pallidum promotes macrophage polarization and activates the NLRP3 inflammasome pathway to induce interleukin-1β production
    Article Snippet: M0 macrophages were preincubated for 30 min with various inhibitors, namely, 25 mM N-acetylcysteine (NAC) (a ROS inhibitor; Sigma-Aldrich, St. Louis, MO, USA), 30 mM CA074-Me (a cathepsin B inhibitor; Calbiochem, San Diego, CA, USA), 100 mM KCl (a potassium channel inhibitor; Sigma, St. Louis, MO, USA), or 2 μM N -benzyloxycarbonyl-Val-Ala-Asp( O -methyl)-fluoromethyl ketone (Z-VAD-FMK; a caspase-1 inhibitor; Invitrogen Inc., USA).

    Article Title: Functional inhibition of acid sphingomyelinase disrupts infection by intracellular bacterial pathogens
    Article Snippet: Language Please check spelling and correct notat ion part icularly of chemicals throughout the text , for example: Line 517f: Spelling mistakes: Hoeschst 33342 should be Hoechst amitrypt iline (MilliporeSigma) should be amitriptyline nortrypt iline (MilliporeSigma)should be nortriptyline Ca074-Me (MilliporeSigma) should be CA-074 Me Bodipy (e.g. figures 4D, E) should be consistent ly BODIPY 1st Authors' Response to Reviewers: March 5, 2019 March 5, 2019 RE: Response to reviewer comments for manuscript LSA-2018-00292-TR Dear Reviewers: We hereby resubmit our manuscript, “Functional inhibition of acid sphingomyelinase disrupts infection by intracellular bacterial pathogens” (LSA-2018-00292-TR) for your consideration for publication in Life Science Alliance.

    Article Title: Protective mechanisms of CA074-me (other than cathepsin-B inhibition) against programmed necrosis induced by global cerebral ischemia/reperfusion injury in rats.
    Article Snippet: Many studies have demonstrated the key role of lysosomes in ischemic cell death in the brain and have led to the “lysosomocentric” hypothesis.. In this hypothesis, the release of cathepsin-B due to a change of lysosomal membrane permeabilization (LMP) or rupture is critical, and this can be prevented by its inhibitors CA074 and CA074-me.. However, the role of CA074-me in neuronal death and its effect on the change of lysosomal membrane integrity after global cerebral ischemia/reperfusion (I/R) injury is not clear, so we investigated this here.

    Article Title: Lysophosphatidylcholine Induces NLRP3 Inflammasome-Mediated Foam Cell Formation and Pyroptosis in Human Monocytes and Endothelial Cells
    Article Snippet: Depending on the assay, the cells were also treated with pharmacological inhibitors: N -acetyl- l -cysteine (NAC), 5 mM (Sigma-Aldrich); Ac-YVAD-cho, 20 μM (Enzo Life Sciences); glyburide, 150 μM (Sigma-Aldrich); CA074-ME, 50 μM (Sigma-Aldrich); statin, 25 μM (Sigma-Aldrich); GW9662, 1 μM (Sigma-Aldrich); methyl-beta-cyclodextrin, 10 μM (Sigma-Aldrich); and PAb-hTLR2, 10 μg/ml (InvivoGen).

    Article Title: Functional inhibition of acid sphingomyelinase disrupts infection by intracellular bacterial pathogens
    Article Snippet: Ca074-Me (MilliporeSigma) should be CA-074 Me RESPONSE: Thank you for noting this error, which has now been corrected throughout.

    Protease Inhibitor:

    Article Title:
    Article Snippet: CA074-Me CalBiochem Cat# 205531 E64 Sigma-Aldrich Cat# E3132 Pepstatin A Sigma-Aldrich Cat# P5318 RKLLW-NH2 Sigma-Aldrich Cat# SCP0110 Primers Sequence (5’ - 3’) reep5 (forward) GATACCCAGCCTACATCTCAATG reep5 (reverse) GCAATGCTGAACACACCATATAC ifnb (forward) ATGAGTGGTGGTTGCAGGC ifnb (reverse) TGACCTTTCAAATGCAGTAGATTCA cathepsin B (forward) TCCTTGATCCTTCTTTCTTGCC cathepsin B (reverse) ACAGTGCCACACAGCTTCTTC a3 serpins (forward) TTTCCAGCAACCTCTCAAGGC a3 serpins (reverse) CTGGGTGTGATTGCCCACATA serpina3a (forward) AGATGTCATCACAATAGCCCG serpina3a (reverse) TTTGTTAAAGGGTTGATAACC serpina3b (forward) GATGCAATCACAATAGTCGGATAC serpina3b (reverse) GGTTGATAACCTTGCCCATTAC serpina3c (forward) CTTAGTAGAAGAACCAGTCTG serpina3c (reverse) CTTAGGGTGAGTGATTTTGGC serpina3f (forward) ATCTCCAATGTTGTCAAGGTG serpina3f (reverse) TGAAACTTTTGCCATAAAGAG serpina3g (forward) ACAGGAATGGCAGGTGTCGG serpina3g (reverse) TGTAACTTTTGCCATAAAGA serpina3h (forward) ACAGGGGTCAAATTAATTC serpina3h (reverse) CTTGGGATTTGTAACTTTGGC serpina3i (forward) AGGAGTCAAAGTTAATCTACG serpina3i (reverse) CTTGGGATTTGTAACTTTGGC serpina3j (forward) CAAGAGACAAATATGACTTC serpina3j (reverse) GTGCAGGGTTGTTGATCTTGC serpina3k (forward) GGCCATTCCTGATTGTTATC serpina3k (reverse) TGAGAACTTGGTGAGCTTTA serpina3m (forward) GCTTTCGTTCTAGAAGATTAC serpina3m (reverse) CTTGGGGTTAGTGACTTTGGC serpina3n (forward) CAATGTCTGCGAAACTGTACC serpina3n (reverse) TTTGGGGTTGGCTATCTTGGC Primers for genotyping Sequence (5’ - 3’) oSB073 GGGCGGTGTAGGCCGCTGGACC oSB080 CCATCTGGGCATGTGGGATTGGGAC oSB085 CCAGAAAGTCAAAAACTGCACAACATCCG oSB086 CTGGAGCACATCCTTCCTGAGTTGG Antibodies Source Catalog number Monoclonal rat anti-CD3 BioLegend Cat# 100227, clone 17A2 Monoclonal rat antiCD11b BioLegend Cat# 101237, clone M1/70 Monoclonal rat antiCD19 BioLegend Cat# 115537, clone 6D5 Monoclonal mouse antiCD45.2 eBiosciences Cat# 56-0454-82, clone 104 3(3) Monoclonal rat antiLy6C BioLegend Cat# 128012, clone HK1.4 Monoclonal rat antiLy6G BD Biosciences Cat# 563979, clone 1A8 Monoclonal rat antiMHCII/I-A/I-E BD Biosciences Cat# 563415, clone M5/114.15.2 Monoclonal Armenian Hamster anti-TCRβ BioLegend Cat# 109230, clone H57-597 Purified rat antiCD16/CD32 block BD Biosciences Cat# 553142, clone 2.4G2 Equipment Source iQ5 Real-Time PCR Detection System Bio-Rad CFX384 Touch RealTime PCR Detection System Bio-Rad SPECTROstar BMG Labtech Varioskan Lux ThermoFisher Scientific TissueLyser II Qiagen Biopulverizer Biospec Products Homogenizer PT1200 E Polytron Flow cytometer LSRII BD Biosciences Software Source Prism 9 GraphPad Illustrator 2023 Adobe CFX Maestro Bio-Rad FlowJo, version 9.9.6 and v10.7.1 BD Biosciences FACSDiva, version 8.0 BD Biosciences

    Article Title: Treponema pallidum promotes macrophage polarization and activates the NLRP3 inflammasome pathway to induce interleukin-1β production.
    Article Snippet: Inhibitory effects of cathepsin B, ROS, K+, and caspase-1 and their impact on IL-1β expression M0 macrophages were preincubated for 30 min with various inhibitors, namely, 25 mM N-acetylcysteine (NAC) (a ROS inhibitor; Sigma-Aldrich, St. Louis, MO, USA), 30 mM CA074-Me (a cathepsin B inhibitor; Calbiochem, San Diego, CA, USA), 100 mM KCl (a potassium channel inhibitor; Sigma, St. Louis, MO, USA), or 2 μM N-benzyloxycarbonyl-Val-Ala-Asp(O-methyl)-fluoromethyl ketone (Z-VAD-FMK; a caspase-1 inhibitor; Invitrogen Inc., USA).

    Article Title: Fluid shear-induced cathepsin B release in the control of Mac1-dependent neutrophil adhesion
    Article Snippet: Experiments were conducted with cell populations treated with and without 30 μM E64 (cysteine protease inhibitor; Sigma-Aldrich), 50 μM CA074-me (ctsB inhibitor; EMD Millipore, Billerica, MA), or 5 μM AP (negative control inhibitor; Sigma-Aldrich) for 5 min before shear exposure, as reported [ 17 ].

    Article Title: Treponema pallidum promotes macrophage polarization and activates the NLRP3 inflammasome pathway to induce interleukin-1β production
    Article Snippet: M0 macrophages were preincubated for 30 min with various inhibitors, namely, 25 mM N-acetylcysteine (NAC) (a ROS inhibitor; Sigma-Aldrich, St. Louis, MO, USA), 30 mM CA074-Me (a cathepsin B inhibitor; Calbiochem, San Diego, CA, USA), 100 mM KCl (a potassium channel inhibitor; Sigma, St. Louis, MO, USA), or 2 μM N -benzyloxycarbonyl-Val-Ala-Asp( O -methyl)-fluoromethyl ketone (Z-VAD-FMK; a caspase-1 inhibitor; Invitrogen Inc., USA).

    Article Title: Functional inhibition of acid sphingomyelinase disrupts infection by intracellular bacterial pathogens
    Article Snippet: Language Please check spelling and correct notat ion part icularly of chemicals throughout the text , for example: Line 517f: Spelling mistakes: Hoeschst 33342 should be Hoechst amitrypt iline (MilliporeSigma) should be amitriptyline nortrypt iline (MilliporeSigma)should be nortriptyline Ca074-Me (MilliporeSigma) should be CA-074 Me Bodipy (e.g. figures 4D, E) should be consistent ly BODIPY 1st Authors' Response to Reviewers: March 5, 2019 March 5, 2019 RE: Response to reviewer comments for manuscript LSA-2018-00292-TR Dear Reviewers: We hereby resubmit our manuscript, “Functional inhibition of acid sphingomyelinase disrupts infection by intracellular bacterial pathogens” (LSA-2018-00292-TR) for your consideration for publication in Life Science Alliance.

    Article Title: Protective mechanisms of CA074-me (other than cathepsin-B inhibition) against programmed necrosis induced by global cerebral ischemia/reperfusion injury in rats.
    Article Snippet: Many studies have demonstrated the key role of lysosomes in ischemic cell death in the brain and have led to the “lysosomocentric” hypothesis.. In this hypothesis, the release of cathepsin-B due to a change of lysosomal membrane permeabilization (LMP) or rupture is critical, and this can be prevented by its inhibitors CA074 and CA074-me.. However, the role of CA074-me in neuronal death and its effect on the change of lysosomal membrane integrity after global cerebral ischemia/reperfusion (I/R) injury is not clear, so we investigated this here.

    Article Title: Lysophosphatidylcholine Induces NLRP3 Inflammasome-Mediated Foam Cell Formation and Pyroptosis in Human Monocytes and Endothelial Cells
    Article Snippet: Depending on the assay, the cells were also treated with pharmacological inhibitors: N -acetyl- l -cysteine (NAC), 5 mM (Sigma-Aldrich); Ac-YVAD-cho, 20 μM (Enzo Life Sciences); glyburide, 150 μM (Sigma-Aldrich); CA074-ME, 50 μM (Sigma-Aldrich); statin, 25 μM (Sigma-Aldrich); GW9662, 1 μM (Sigma-Aldrich); methyl-beta-cyclodextrin, 10 μM (Sigma-Aldrich); and PAb-hTLR2, 10 μg/ml (InvivoGen).

    Article Title: Functional inhibition of acid sphingomyelinase disrupts infection by intracellular bacterial pathogens
    Article Snippet: Ca074-Me (MilliporeSigma) should be CA-074 Me RESPONSE: Thank you for noting this error, which has now been corrected throughout.

    Negative Control:

    Article Title:
    Article Snippet: CA074-Me CalBiochem Cat# 205531 E64 Sigma-Aldrich Cat# E3132 Pepstatin A Sigma-Aldrich Cat# P5318 RKLLW-NH2 Sigma-Aldrich Cat# SCP0110 Primers Sequence (5’ - 3’) reep5 (forward) GATACCCAGCCTACATCTCAATG reep5 (reverse) GCAATGCTGAACACACCATATAC ifnb (forward) ATGAGTGGTGGTTGCAGGC ifnb (reverse) TGACCTTTCAAATGCAGTAGATTCA cathepsin B (forward) TCCTTGATCCTTCTTTCTTGCC cathepsin B (reverse) ACAGTGCCACACAGCTTCTTC a3 serpins (forward) TTTCCAGCAACCTCTCAAGGC a3 serpins (reverse) CTGGGTGTGATTGCCCACATA serpina3a (forward) AGATGTCATCACAATAGCCCG serpina3a (reverse) TTTGTTAAAGGGTTGATAACC serpina3b (forward) GATGCAATCACAATAGTCGGATAC serpina3b (reverse) GGTTGATAACCTTGCCCATTAC serpina3c (forward) CTTAGTAGAAGAACCAGTCTG serpina3c (reverse) CTTAGGGTGAGTGATTTTGGC serpina3f (forward) ATCTCCAATGTTGTCAAGGTG serpina3f (reverse) TGAAACTTTTGCCATAAAGAG serpina3g (forward) ACAGGAATGGCAGGTGTCGG serpina3g (reverse) TGTAACTTTTGCCATAAAGA serpina3h (forward) ACAGGGGTCAAATTAATTC serpina3h (reverse) CTTGGGATTTGTAACTTTGGC serpina3i (forward) AGGAGTCAAAGTTAATCTACG serpina3i (reverse) CTTGGGATTTGTAACTTTGGC serpina3j (forward) CAAGAGACAAATATGACTTC serpina3j (reverse) GTGCAGGGTTGTTGATCTTGC serpina3k (forward) GGCCATTCCTGATTGTTATC serpina3k (reverse) TGAGAACTTGGTGAGCTTTA serpina3m (forward) GCTTTCGTTCTAGAAGATTAC serpina3m (reverse) CTTGGGGTTAGTGACTTTGGC serpina3n (forward) CAATGTCTGCGAAACTGTACC serpina3n (reverse) TTTGGGGTTGGCTATCTTGGC Primers for genotyping Sequence (5’ - 3’) oSB073 GGGCGGTGTAGGCCGCTGGACC oSB080 CCATCTGGGCATGTGGGATTGGGAC oSB085 CCAGAAAGTCAAAAACTGCACAACATCCG oSB086 CTGGAGCACATCCTTCCTGAGTTGG Antibodies Source Catalog number Monoclonal rat anti-CD3 BioLegend Cat# 100227, clone 17A2 Monoclonal rat antiCD11b BioLegend Cat# 101237, clone M1/70 Monoclonal rat antiCD19 BioLegend Cat# 115537, clone 6D5 Monoclonal mouse antiCD45.2 eBiosciences Cat# 56-0454-82, clone 104 3(3) Monoclonal rat antiLy6C BioLegend Cat# 128012, clone HK1.4 Monoclonal rat antiLy6G BD Biosciences Cat# 563979, clone 1A8 Monoclonal rat antiMHCII/I-A/I-E BD Biosciences Cat# 563415, clone M5/114.15.2 Monoclonal Armenian Hamster anti-TCRβ BioLegend Cat# 109230, clone H57-597 Purified rat antiCD16/CD32 block BD Biosciences Cat# 553142, clone 2.4G2 Equipment Source iQ5 Real-Time PCR Detection System Bio-Rad CFX384 Touch RealTime PCR Detection System Bio-Rad SPECTROstar BMG Labtech Varioskan Lux ThermoFisher Scientific TissueLyser II Qiagen Biopulverizer Biospec Products Homogenizer PT1200 E Polytron Flow cytometer LSRII BD Biosciences Software Source Prism 9 GraphPad Illustrator 2023 Adobe CFX Maestro Bio-Rad FlowJo, version 9.9.6 and v10.7.1 BD Biosciences FACSDiva, version 8.0 BD Biosciences

    Article Title: Treponema pallidum promotes macrophage polarization and activates the NLRP3 inflammasome pathway to induce interleukin-1β production.
    Article Snippet: Inhibitory effects of cathepsin B, ROS, K+, and caspase-1 and their impact on IL-1β expression M0 macrophages were preincubated for 30 min with various inhibitors, namely, 25 mM N-acetylcysteine (NAC) (a ROS inhibitor; Sigma-Aldrich, St. Louis, MO, USA), 30 mM CA074-Me (a cathepsin B inhibitor; Calbiochem, San Diego, CA, USA), 100 mM KCl (a potassium channel inhibitor; Sigma, St. Louis, MO, USA), or 2 μM N-benzyloxycarbonyl-Val-Ala-Asp(O-methyl)-fluoromethyl ketone (Z-VAD-FMK; a caspase-1 inhibitor; Invitrogen Inc., USA).

    Article Title: Fluid shear-induced cathepsin B release in the control of Mac1-dependent neutrophil adhesion
    Article Snippet: Experiments were conducted with cell populations treated with and without 30 μM E64 (cysteine protease inhibitor; Sigma-Aldrich), 50 μM CA074-me (ctsB inhibitor; EMD Millipore, Billerica, MA), or 5 μM AP (negative control inhibitor; Sigma-Aldrich) for 5 min before shear exposure, as reported [ 17 ].

    Article Title: Treponema pallidum promotes macrophage polarization and activates the NLRP3 inflammasome pathway to induce interleukin-1β production
    Article Snippet: M0 macrophages were preincubated for 30 min with various inhibitors, namely, 25 mM N-acetylcysteine (NAC) (a ROS inhibitor; Sigma-Aldrich, St. Louis, MO, USA), 30 mM CA074-Me (a cathepsin B inhibitor; Calbiochem, San Diego, CA, USA), 100 mM KCl (a potassium channel inhibitor; Sigma, St. Louis, MO, USA), or 2 μM N -benzyloxycarbonyl-Val-Ala-Asp( O -methyl)-fluoromethyl ketone (Z-VAD-FMK; a caspase-1 inhibitor; Invitrogen Inc., USA).

    Article Title: Functional inhibition of acid sphingomyelinase disrupts infection by intracellular bacterial pathogens
    Article Snippet: Language Please check spelling and correct notat ion part icularly of chemicals throughout the text , for example: Line 517f: Spelling mistakes: Hoeschst 33342 should be Hoechst amitrypt iline (MilliporeSigma) should be amitriptyline nortrypt iline (MilliporeSigma)should be nortriptyline Ca074-Me (MilliporeSigma) should be CA-074 Me Bodipy (e.g. figures 4D, E) should be consistent ly BODIPY 1st Authors' Response to Reviewers: March 5, 2019 March 5, 2019 RE: Response to reviewer comments for manuscript LSA-2018-00292-TR Dear Reviewers: We hereby resubmit our manuscript, “Functional inhibition of acid sphingomyelinase disrupts infection by intracellular bacterial pathogens” (LSA-2018-00292-TR) for your consideration for publication in Life Science Alliance.

    Article Title: Protective mechanisms of CA074-me (other than cathepsin-B inhibition) against programmed necrosis induced by global cerebral ischemia/reperfusion injury in rats.
    Article Snippet: Many studies have demonstrated the key role of lysosomes in ischemic cell death in the brain and have led to the “lysosomocentric” hypothesis.. In this hypothesis, the release of cathepsin-B due to a change of lysosomal membrane permeabilization (LMP) or rupture is critical, and this can be prevented by its inhibitors CA074 and CA074-me.. However, the role of CA074-me in neuronal death and its effect on the change of lysosomal membrane integrity after global cerebral ischemia/reperfusion (I/R) injury is not clear, so we investigated this here.

    Article Title: Lysophosphatidylcholine Induces NLRP3 Inflammasome-Mediated Foam Cell Formation and Pyroptosis in Human Monocytes and Endothelial Cells
    Article Snippet: Depending on the assay, the cells were also treated with pharmacological inhibitors: N -acetyl- l -cysteine (NAC), 5 mM (Sigma-Aldrich); Ac-YVAD-cho, 20 μM (Enzo Life Sciences); glyburide, 150 μM (Sigma-Aldrich); CA074-ME, 50 μM (Sigma-Aldrich); statin, 25 μM (Sigma-Aldrich); GW9662, 1 μM (Sigma-Aldrich); methyl-beta-cyclodextrin, 10 μM (Sigma-Aldrich); and PAb-hTLR2, 10 μg/ml (InvivoGen).

    Article Title: Functional inhibition of acid sphingomyelinase disrupts infection by intracellular bacterial pathogens
    Article Snippet: Ca074-Me (MilliporeSigma) should be CA-074 Me RESPONSE: Thank you for noting this error, which has now been corrected throughout.

    Expressing:

    Article Title:
    Article Snippet: CA074-Me CalBiochem Cat# 205531 E64 Sigma-Aldrich Cat# E3132 Pepstatin A Sigma-Aldrich Cat# P5318 RKLLW-NH2 Sigma-Aldrich Cat# SCP0110 Primers Sequence (5’ - 3’) reep5 (forward) GATACCCAGCCTACATCTCAATG reep5 (reverse) GCAATGCTGAACACACCATATAC ifnb (forward) ATGAGTGGTGGTTGCAGGC ifnb (reverse) TGACCTTTCAAATGCAGTAGATTCA cathepsin B (forward) TCCTTGATCCTTCTTTCTTGCC cathepsin B (reverse) ACAGTGCCACACAGCTTCTTC a3 serpins (forward) TTTCCAGCAACCTCTCAAGGC a3 serpins (reverse) CTGGGTGTGATTGCCCACATA serpina3a (forward) AGATGTCATCACAATAGCCCG serpina3a (reverse) TTTGTTAAAGGGTTGATAACC serpina3b (forward) GATGCAATCACAATAGTCGGATAC serpina3b (reverse) GGTTGATAACCTTGCCCATTAC serpina3c (forward) CTTAGTAGAAGAACCAGTCTG serpina3c (reverse) CTTAGGGTGAGTGATTTTGGC serpina3f (forward) ATCTCCAATGTTGTCAAGGTG serpina3f (reverse) TGAAACTTTTGCCATAAAGAG serpina3g (forward) ACAGGAATGGCAGGTGTCGG serpina3g (reverse) TGTAACTTTTGCCATAAAGA serpina3h (forward) ACAGGGGTCAAATTAATTC serpina3h (reverse) CTTGGGATTTGTAACTTTGGC serpina3i (forward) AGGAGTCAAAGTTAATCTACG serpina3i (reverse) CTTGGGATTTGTAACTTTGGC serpina3j (forward) CAAGAGACAAATATGACTTC serpina3j (reverse) GTGCAGGGTTGTTGATCTTGC serpina3k (forward) GGCCATTCCTGATTGTTATC serpina3k (reverse) TGAGAACTTGGTGAGCTTTA serpina3m (forward) GCTTTCGTTCTAGAAGATTAC serpina3m (reverse) CTTGGGGTTAGTGACTTTGGC serpina3n (forward) CAATGTCTGCGAAACTGTACC serpina3n (reverse) TTTGGGGTTGGCTATCTTGGC Primers for genotyping Sequence (5’ - 3’) oSB073 GGGCGGTGTAGGCCGCTGGACC oSB080 CCATCTGGGCATGTGGGATTGGGAC oSB085 CCAGAAAGTCAAAAACTGCACAACATCCG oSB086 CTGGAGCACATCCTTCCTGAGTTGG Antibodies Source Catalog number Monoclonal rat anti-CD3 BioLegend Cat# 100227, clone 17A2 Monoclonal rat antiCD11b BioLegend Cat# 101237, clone M1/70 Monoclonal rat antiCD19 BioLegend Cat# 115537, clone 6D5 Monoclonal mouse antiCD45.2 eBiosciences Cat# 56-0454-82, clone 104 3(3) Monoclonal rat antiLy6C BioLegend Cat# 128012, clone HK1.4 Monoclonal rat antiLy6G BD Biosciences Cat# 563979, clone 1A8 Monoclonal rat antiMHCII/I-A/I-E BD Biosciences Cat# 563415, clone M5/114.15.2 Monoclonal Armenian Hamster anti-TCRβ BioLegend Cat# 109230, clone H57-597 Purified rat antiCD16/CD32 block BD Biosciences Cat# 553142, clone 2.4G2 Equipment Source iQ5 Real-Time PCR Detection System Bio-Rad CFX384 Touch RealTime PCR Detection System Bio-Rad SPECTROstar BMG Labtech Varioskan Lux ThermoFisher Scientific TissueLyser II Qiagen Biopulverizer Biospec Products Homogenizer PT1200 E Polytron Flow cytometer LSRII BD Biosciences Software Source Prism 9 GraphPad Illustrator 2023 Adobe CFX Maestro Bio-Rad FlowJo, version 9.9.6 and v10.7.1 BD Biosciences FACSDiva, version 8.0 BD Biosciences

    Article Title: Treponema pallidum promotes macrophage polarization and activates the NLRP3 inflammasome pathway to induce interleukin-1β production.
    Article Snippet: Inhibitory effects of cathepsin B, ROS, K+, and caspase-1 and their impact on IL-1β expression M0 macrophages were preincubated for 30 min with various inhibitors, namely, 25 mM N-acetylcysteine (NAC) (a ROS inhibitor; Sigma-Aldrich, St. Louis, MO, USA), 30 mM CA074-Me (a cathepsin B inhibitor; Calbiochem, San Diego, CA, USA), 100 mM KCl (a potassium channel inhibitor; Sigma, St. Louis, MO, USA), or 2 μM N-benzyloxycarbonyl-Val-Ala-Asp(O-methyl)-fluoromethyl ketone (Z-VAD-FMK; a caspase-1 inhibitor; Invitrogen Inc., USA).

    Article Title: Fluid shear-induced cathepsin B release in the control of Mac1-dependent neutrophil adhesion
    Article Snippet: Experiments were conducted with cell populations treated with and without 30 μM E64 (cysteine protease inhibitor; Sigma-Aldrich), 50 μM CA074-me (ctsB inhibitor; EMD Millipore, Billerica, MA), or 5 μM AP (negative control inhibitor; Sigma-Aldrich) for 5 min before shear exposure, as reported [ 17 ].

    Article Title: Treponema pallidum promotes macrophage polarization and activates the NLRP3 inflammasome pathway to induce interleukin-1β production
    Article Snippet: M0 macrophages were preincubated for 30 min with various inhibitors, namely, 25 mM N-acetylcysteine (NAC) (a ROS inhibitor; Sigma-Aldrich, St. Louis, MO, USA), 30 mM CA074-Me (a cathepsin B inhibitor; Calbiochem, San Diego, CA, USA), 100 mM KCl (a potassium channel inhibitor; Sigma, St. Louis, MO, USA), or 2 μM N -benzyloxycarbonyl-Val-Ala-Asp( O -methyl)-fluoromethyl ketone (Z-VAD-FMK; a caspase-1 inhibitor; Invitrogen Inc., USA).

    Article Title: Functional inhibition of acid sphingomyelinase disrupts infection by intracellular bacterial pathogens
    Article Snippet: Language Please check spelling and correct notat ion part icularly of chemicals throughout the text , for example: Line 517f: Spelling mistakes: Hoeschst 33342 should be Hoechst amitrypt iline (MilliporeSigma) should be amitriptyline nortrypt iline (MilliporeSigma)should be nortriptyline Ca074-Me (MilliporeSigma) should be CA-074 Me Bodipy (e.g. figures 4D, E) should be consistent ly BODIPY 1st Authors' Response to Reviewers: March 5, 2019 March 5, 2019 RE: Response to reviewer comments for manuscript LSA-2018-00292-TR Dear Reviewers: We hereby resubmit our manuscript, “Functional inhibition of acid sphingomyelinase disrupts infection by intracellular bacterial pathogens” (LSA-2018-00292-TR) for your consideration for publication in Life Science Alliance.

    Article Title: Protective mechanisms of CA074-me (other than cathepsin-B inhibition) against programmed necrosis induced by global cerebral ischemia/reperfusion injury in rats.
    Article Snippet: Many studies have demonstrated the key role of lysosomes in ischemic cell death in the brain and have led to the “lysosomocentric” hypothesis.. In this hypothesis, the release of cathepsin-B due to a change of lysosomal membrane permeabilization (LMP) or rupture is critical, and this can be prevented by its inhibitors CA074 and CA074-me.. However, the role of CA074-me in neuronal death and its effect on the change of lysosomal membrane integrity after global cerebral ischemia/reperfusion (I/R) injury is not clear, so we investigated this here.

    Article Title: Lysophosphatidylcholine Induces NLRP3 Inflammasome-Mediated Foam Cell Formation and Pyroptosis in Human Monocytes and Endothelial Cells
    Article Snippet: Depending on the assay, the cells were also treated with pharmacological inhibitors: N -acetyl- l -cysteine (NAC), 5 mM (Sigma-Aldrich); Ac-YVAD-cho, 20 μM (Enzo Life Sciences); glyburide, 150 μM (Sigma-Aldrich); CA074-ME, 50 μM (Sigma-Aldrich); statin, 25 μM (Sigma-Aldrich); GW9662, 1 μM (Sigma-Aldrich); methyl-beta-cyclodextrin, 10 μM (Sigma-Aldrich); and PAb-hTLR2, 10 μg/ml (InvivoGen).

    Article Title: Functional inhibition of acid sphingomyelinase disrupts infection by intracellular bacterial pathogens
    Article Snippet: Ca074-Me (MilliporeSigma) should be CA-074 Me RESPONSE: Thank you for noting this error, which has now been corrected throughout.

    Staining:

    Article Title:
    Article Snippet: CA074-Me CalBiochem Cat# 205531 E64 Sigma-Aldrich Cat# E3132 Pepstatin A Sigma-Aldrich Cat# P5318 RKLLW-NH2 Sigma-Aldrich Cat# SCP0110 Primers Sequence (5’ - 3’) reep5 (forward) GATACCCAGCCTACATCTCAATG reep5 (reverse) GCAATGCTGAACACACCATATAC ifnb (forward) ATGAGTGGTGGTTGCAGGC ifnb (reverse) TGACCTTTCAAATGCAGTAGATTCA cathepsin B (forward) TCCTTGATCCTTCTTTCTTGCC cathepsin B (reverse) ACAGTGCCACACAGCTTCTTC a3 serpins (forward) TTTCCAGCAACCTCTCAAGGC a3 serpins (reverse) CTGGGTGTGATTGCCCACATA serpina3a (forward) AGATGTCATCACAATAGCCCG serpina3a (reverse) TTTGTTAAAGGGTTGATAACC serpina3b (forward) GATGCAATCACAATAGTCGGATAC serpina3b (reverse) GGTTGATAACCTTGCCCATTAC serpina3c (forward) CTTAGTAGAAGAACCAGTCTG serpina3c (reverse) CTTAGGGTGAGTGATTTTGGC serpina3f (forward) ATCTCCAATGTTGTCAAGGTG serpina3f (reverse) TGAAACTTTTGCCATAAAGAG serpina3g (forward) ACAGGAATGGCAGGTGTCGG serpina3g (reverse) TGTAACTTTTGCCATAAAGA serpina3h (forward) ACAGGGGTCAAATTAATTC serpina3h (reverse) CTTGGGATTTGTAACTTTGGC serpina3i (forward) AGGAGTCAAAGTTAATCTACG serpina3i (reverse) CTTGGGATTTGTAACTTTGGC serpina3j (forward) CAAGAGACAAATATGACTTC serpina3j (reverse) GTGCAGGGTTGTTGATCTTGC serpina3k (forward) GGCCATTCCTGATTGTTATC serpina3k (reverse) TGAGAACTTGGTGAGCTTTA serpina3m (forward) GCTTTCGTTCTAGAAGATTAC serpina3m (reverse) CTTGGGGTTAGTGACTTTGGC serpina3n (forward) CAATGTCTGCGAAACTGTACC serpina3n (reverse) TTTGGGGTTGGCTATCTTGGC Primers for genotyping Sequence (5’ - 3’) oSB073 GGGCGGTGTAGGCCGCTGGACC oSB080 CCATCTGGGCATGTGGGATTGGGAC oSB085 CCAGAAAGTCAAAAACTGCACAACATCCG oSB086 CTGGAGCACATCCTTCCTGAGTTGG Antibodies Source Catalog number Monoclonal rat anti-CD3 BioLegend Cat# 100227, clone 17A2 Monoclonal rat antiCD11b BioLegend Cat# 101237, clone M1/70 Monoclonal rat antiCD19 BioLegend Cat# 115537, clone 6D5 Monoclonal mouse antiCD45.2 eBiosciences Cat# 56-0454-82, clone 104 3(3) Monoclonal rat antiLy6C BioLegend Cat# 128012, clone HK1.4 Monoclonal rat antiLy6G BD Biosciences Cat# 563979, clone 1A8 Monoclonal rat antiMHCII/I-A/I-E BD Biosciences Cat# 563415, clone M5/114.15.2 Monoclonal Armenian Hamster anti-TCRβ BioLegend Cat# 109230, clone H57-597 Purified rat antiCD16/CD32 block BD Biosciences Cat# 553142, clone 2.4G2 Equipment Source iQ5 Real-Time PCR Detection System Bio-Rad CFX384 Touch RealTime PCR Detection System Bio-Rad SPECTROstar BMG Labtech Varioskan Lux ThermoFisher Scientific TissueLyser II Qiagen Biopulverizer Biospec Products Homogenizer PT1200 E Polytron Flow cytometer LSRII BD Biosciences Software Source Prism 9 GraphPad Illustrator 2023 Adobe CFX Maestro Bio-Rad FlowJo, version 9.9.6 and v10.7.1 BD Biosciences FACSDiva, version 8.0 BD Biosciences

    Article Title: Treponema pallidum promotes macrophage polarization and activates the NLRP3 inflammasome pathway to induce interleukin-1β production.
    Article Snippet: Inhibitory effects of cathepsin B, ROS, K+, and caspase-1 and their impact on IL-1β expression M0 macrophages were preincubated for 30 min with various inhibitors, namely, 25 mM N-acetylcysteine (NAC) (a ROS inhibitor; Sigma-Aldrich, St. Louis, MO, USA), 30 mM CA074-Me (a cathepsin B inhibitor; Calbiochem, San Diego, CA, USA), 100 mM KCl (a potassium channel inhibitor; Sigma, St. Louis, MO, USA), or 2 μM N-benzyloxycarbonyl-Val-Ala-Asp(O-methyl)-fluoromethyl ketone (Z-VAD-FMK; a caspase-1 inhibitor; Invitrogen Inc., USA).

    Article Title: Fluid shear-induced cathepsin B release in the control of Mac1-dependent neutrophil adhesion
    Article Snippet: Experiments were conducted with cell populations treated with and without 30 μM E64 (cysteine protease inhibitor; Sigma-Aldrich), 50 μM CA074-me (ctsB inhibitor; EMD Millipore, Billerica, MA), or 5 μM AP (negative control inhibitor; Sigma-Aldrich) for 5 min before shear exposure, as reported [ 17 ].

    Article Title: Treponema pallidum promotes macrophage polarization and activates the NLRP3 inflammasome pathway to induce interleukin-1β production
    Article Snippet: M0 macrophages were preincubated for 30 min with various inhibitors, namely, 25 mM N-acetylcysteine (NAC) (a ROS inhibitor; Sigma-Aldrich, St. Louis, MO, USA), 30 mM CA074-Me (a cathepsin B inhibitor; Calbiochem, San Diego, CA, USA), 100 mM KCl (a potassium channel inhibitor; Sigma, St. Louis, MO, USA), or 2 μM N -benzyloxycarbonyl-Val-Ala-Asp( O -methyl)-fluoromethyl ketone (Z-VAD-FMK; a caspase-1 inhibitor; Invitrogen Inc., USA).

    Article Title: Functional inhibition of acid sphingomyelinase disrupts infection by intracellular bacterial pathogens
    Article Snippet: Language Please check spelling and correct notat ion part icularly of chemicals throughout the text , for example: Line 517f: Spelling mistakes: Hoeschst 33342 should be Hoechst amitrypt iline (MilliporeSigma) should be amitriptyline nortrypt iline (MilliporeSigma)should be nortriptyline Ca074-Me (MilliporeSigma) should be CA-074 Me Bodipy (e.g. figures 4D, E) should be consistent ly BODIPY 1st Authors' Response to Reviewers: March 5, 2019 March 5, 2019 RE: Response to reviewer comments for manuscript LSA-2018-00292-TR Dear Reviewers: We hereby resubmit our manuscript, “Functional inhibition of acid sphingomyelinase disrupts infection by intracellular bacterial pathogens” (LSA-2018-00292-TR) for your consideration for publication in Life Science Alliance.

    Article Title: Protective mechanisms of CA074-me (other than cathepsin-B inhibition) against programmed necrosis induced by global cerebral ischemia/reperfusion injury in rats.
    Article Snippet: Many studies have demonstrated the key role of lysosomes in ischemic cell death in the brain and have led to the “lysosomocentric” hypothesis.. In this hypothesis, the release of cathepsin-B due to a change of lysosomal membrane permeabilization (LMP) or rupture is critical, and this can be prevented by its inhibitors CA074 and CA074-me.. However, the role of CA074-me in neuronal death and its effect on the change of lysosomal membrane integrity after global cerebral ischemia/reperfusion (I/R) injury is not clear, so we investigated this here.

    Article Title: Lysophosphatidylcholine Induces NLRP3 Inflammasome-Mediated Foam Cell Formation and Pyroptosis in Human Monocytes and Endothelial Cells
    Article Snippet: Depending on the assay, the cells were also treated with pharmacological inhibitors: N -acetyl- l -cysteine (NAC), 5 mM (Sigma-Aldrich); Ac-YVAD-cho, 20 μM (Enzo Life Sciences); glyburide, 150 μM (Sigma-Aldrich); CA074-ME, 50 μM (Sigma-Aldrich); statin, 25 μM (Sigma-Aldrich); GW9662, 1 μM (Sigma-Aldrich); methyl-beta-cyclodextrin, 10 μM (Sigma-Aldrich); and PAb-hTLR2, 10 μg/ml (InvivoGen).

    Article Title: Functional inhibition of acid sphingomyelinase disrupts infection by intracellular bacterial pathogens
    Article Snippet: Ca074-Me (MilliporeSigma) should be CA-074 Me RESPONSE: Thank you for noting this error, which has now been corrected throughout.

    Binding Assay:

    Article Title:
    Article Snippet: CA074-Me CalBiochem Cat# 205531 E64 Sigma-Aldrich Cat# E3132 Pepstatin A Sigma-Aldrich Cat# P5318 RKLLW-NH2 Sigma-Aldrich Cat# SCP0110 Primers Sequence (5’ - 3’) reep5 (forward) GATACCCAGCCTACATCTCAATG reep5 (reverse) GCAATGCTGAACACACCATATAC ifnb (forward) ATGAGTGGTGGTTGCAGGC ifnb (reverse) TGACCTTTCAAATGCAGTAGATTCA cathepsin B (forward) TCCTTGATCCTTCTTTCTTGCC cathepsin B (reverse) ACAGTGCCACACAGCTTCTTC a3 serpins (forward) TTTCCAGCAACCTCTCAAGGC a3 serpins (reverse) CTGGGTGTGATTGCCCACATA serpina3a (forward) AGATGTCATCACAATAGCCCG serpina3a (reverse) TTTGTTAAAGGGTTGATAACC serpina3b (forward) GATGCAATCACAATAGTCGGATAC serpina3b (reverse) GGTTGATAACCTTGCCCATTAC serpina3c (forward) CTTAGTAGAAGAACCAGTCTG serpina3c (reverse) CTTAGGGTGAGTGATTTTGGC serpina3f (forward) ATCTCCAATGTTGTCAAGGTG serpina3f (reverse) TGAAACTTTTGCCATAAAGAG serpina3g (forward) ACAGGAATGGCAGGTGTCGG serpina3g (reverse) TGTAACTTTTGCCATAAAGA serpina3h (forward) ACAGGGGTCAAATTAATTC serpina3h (reverse) CTTGGGATTTGTAACTTTGGC serpina3i (forward) AGGAGTCAAAGTTAATCTACG serpina3i (reverse) CTTGGGATTTGTAACTTTGGC serpina3j (forward) CAAGAGACAAATATGACTTC serpina3j (reverse) GTGCAGGGTTGTTGATCTTGC serpina3k (forward) GGCCATTCCTGATTGTTATC serpina3k (reverse) TGAGAACTTGGTGAGCTTTA serpina3m (forward) GCTTTCGTTCTAGAAGATTAC serpina3m (reverse) CTTGGGGTTAGTGACTTTGGC serpina3n (forward) CAATGTCTGCGAAACTGTACC serpina3n (reverse) TTTGGGGTTGGCTATCTTGGC Primers for genotyping Sequence (5’ - 3’) oSB073 GGGCGGTGTAGGCCGCTGGACC oSB080 CCATCTGGGCATGTGGGATTGGGAC oSB085 CCAGAAAGTCAAAAACTGCACAACATCCG oSB086 CTGGAGCACATCCTTCCTGAGTTGG Antibodies Source Catalog number Monoclonal rat anti-CD3 BioLegend Cat# 100227, clone 17A2 Monoclonal rat antiCD11b BioLegend Cat# 101237, clone M1/70 Monoclonal rat antiCD19 BioLegend Cat# 115537, clone 6D5 Monoclonal mouse antiCD45.2 eBiosciences Cat# 56-0454-82, clone 104 3(3) Monoclonal rat antiLy6C BioLegend Cat# 128012, clone HK1.4 Monoclonal rat antiLy6G BD Biosciences Cat# 563979, clone 1A8 Monoclonal rat antiMHCII/I-A/I-E BD Biosciences Cat# 563415, clone M5/114.15.2 Monoclonal Armenian Hamster anti-TCRβ BioLegend Cat# 109230, clone H57-597 Purified rat antiCD16/CD32 block BD Biosciences Cat# 553142, clone 2.4G2 Equipment Source iQ5 Real-Time PCR Detection System Bio-Rad CFX384 Touch RealTime PCR Detection System Bio-Rad SPECTROstar BMG Labtech Varioskan Lux ThermoFisher Scientific TissueLyser II Qiagen Biopulverizer Biospec Products Homogenizer PT1200 E Polytron Flow cytometer LSRII BD Biosciences Software Source Prism 9 GraphPad Illustrator 2023 Adobe CFX Maestro Bio-Rad FlowJo, version 9.9.6 and v10.7.1 BD Biosciences FACSDiva, version 8.0 BD Biosciences

    Article Title: Treponema pallidum promotes macrophage polarization and activates the NLRP3 inflammasome pathway to induce interleukin-1β production.
    Article Snippet: Inhibitory effects of cathepsin B, ROS, K+, and caspase-1 and their impact on IL-1β expression M0 macrophages were preincubated for 30 min with various inhibitors, namely, 25 mM N-acetylcysteine (NAC) (a ROS inhibitor; Sigma-Aldrich, St. Louis, MO, USA), 30 mM CA074-Me (a cathepsin B inhibitor; Calbiochem, San Diego, CA, USA), 100 mM KCl (a potassium channel inhibitor; Sigma, St. Louis, MO, USA), or 2 μM N-benzyloxycarbonyl-Val-Ala-Asp(O-methyl)-fluoromethyl ketone (Z-VAD-FMK; a caspase-1 inhibitor; Invitrogen Inc., USA).

    Article Title: Fluid shear-induced cathepsin B release in the control of Mac1-dependent neutrophil adhesion
    Article Snippet: Experiments were conducted with cell populations treated with and without 30 μM E64 (cysteine protease inhibitor; Sigma-Aldrich), 50 μM CA074-me (ctsB inhibitor; EMD Millipore, Billerica, MA), or 5 μM AP (negative control inhibitor; Sigma-Aldrich) for 5 min before shear exposure, as reported [ 17 ].

    Article Title: Treponema pallidum promotes macrophage polarization and activates the NLRP3 inflammasome pathway to induce interleukin-1β production
    Article Snippet: M0 macrophages were preincubated for 30 min with various inhibitors, namely, 25 mM N-acetylcysteine (NAC) (a ROS inhibitor; Sigma-Aldrich, St. Louis, MO, USA), 30 mM CA074-Me (a cathepsin B inhibitor; Calbiochem, San Diego, CA, USA), 100 mM KCl (a potassium channel inhibitor; Sigma, St. Louis, MO, USA), or 2 μM N -benzyloxycarbonyl-Val-Ala-Asp( O -methyl)-fluoromethyl ketone (Z-VAD-FMK; a caspase-1 inhibitor; Invitrogen Inc., USA).

    Article Title: Functional inhibition of acid sphingomyelinase disrupts infection by intracellular bacterial pathogens
    Article Snippet: Language Please check spelling and correct notat ion part icularly of chemicals throughout the text , for example: Line 517f: Spelling mistakes: Hoeschst 33342 should be Hoechst amitrypt iline (MilliporeSigma) should be amitriptyline nortrypt iline (MilliporeSigma)should be nortriptyline Ca074-Me (MilliporeSigma) should be CA-074 Me Bodipy (e.g. figures 4D, E) should be consistent ly BODIPY 1st Authors' Response to Reviewers: March 5, 2019 March 5, 2019 RE: Response to reviewer comments for manuscript LSA-2018-00292-TR Dear Reviewers: We hereby resubmit our manuscript, “Functional inhibition of acid sphingomyelinase disrupts infection by intracellular bacterial pathogens” (LSA-2018-00292-TR) for your consideration for publication in Life Science Alliance.

    Article Title: Protective mechanisms of CA074-me (other than cathepsin-B inhibition) against programmed necrosis induced by global cerebral ischemia/reperfusion injury in rats.
    Article Snippet: Many studies have demonstrated the key role of lysosomes in ischemic cell death in the brain and have led to the “lysosomocentric” hypothesis.. In this hypothesis, the release of cathepsin-B due to a change of lysosomal membrane permeabilization (LMP) or rupture is critical, and this can be prevented by its inhibitors CA074 and CA074-me.. However, the role of CA074-me in neuronal death and its effect on the change of lysosomal membrane integrity after global cerebral ischemia/reperfusion (I/R) injury is not clear, so we investigated this here.

    Article Title: Lysophosphatidylcholine Induces NLRP3 Inflammasome-Mediated Foam Cell Formation and Pyroptosis in Human Monocytes and Endothelial Cells
    Article Snippet: Depending on the assay, the cells were also treated with pharmacological inhibitors: N -acetyl- l -cysteine (NAC), 5 mM (Sigma-Aldrich); Ac-YVAD-cho, 20 μM (Enzo Life Sciences); glyburide, 150 μM (Sigma-Aldrich); CA074-ME, 50 μM (Sigma-Aldrich); statin, 25 μM (Sigma-Aldrich); GW9662, 1 μM (Sigma-Aldrich); methyl-beta-cyclodextrin, 10 μM (Sigma-Aldrich); and PAb-hTLR2, 10 μg/ml (InvivoGen).

    Article Title: Functional inhibition of acid sphingomyelinase disrupts infection by intracellular bacterial pathogens
    Article Snippet: Ca074-Me (MilliporeSigma) should be CA-074 Me RESPONSE: Thank you for noting this error, which has now been corrected throughout.

    Migration:

    Article Title:
    Article Snippet: CA074-Me CalBiochem Cat# 205531 E64 Sigma-Aldrich Cat# E3132 Pepstatin A Sigma-Aldrich Cat# P5318 RKLLW-NH2 Sigma-Aldrich Cat# SCP0110 Primers Sequence (5’ - 3’) reep5 (forward) GATACCCAGCCTACATCTCAATG reep5 (reverse) GCAATGCTGAACACACCATATAC ifnb (forward) ATGAGTGGTGGTTGCAGGC ifnb (reverse) TGACCTTTCAAATGCAGTAGATTCA cathepsin B (forward) TCCTTGATCCTTCTTTCTTGCC cathepsin B (reverse) ACAGTGCCACACAGCTTCTTC a3 serpins (forward) TTTCCAGCAACCTCTCAAGGC a3 serpins (reverse) CTGGGTGTGATTGCCCACATA serpina3a (forward) AGATGTCATCACAATAGCCCG serpina3a (reverse) TTTGTTAAAGGGTTGATAACC serpina3b (forward) GATGCAATCACAATAGTCGGATAC serpina3b (reverse) GGTTGATAACCTTGCCCATTAC serpina3c (forward) CTTAGTAGAAGAACCAGTCTG serpina3c (reverse) CTTAGGGTGAGTGATTTTGGC serpina3f (forward) ATCTCCAATGTTGTCAAGGTG serpina3f (reverse) TGAAACTTTTGCCATAAAGAG serpina3g (forward) ACAGGAATGGCAGGTGTCGG serpina3g (reverse) TGTAACTTTTGCCATAAAGA serpina3h (forward) ACAGGGGTCAAATTAATTC serpina3h (reverse) CTTGGGATTTGTAACTTTGGC serpina3i (forward) AGGAGTCAAAGTTAATCTACG serpina3i (reverse) CTTGGGATTTGTAACTTTGGC serpina3j (forward) CAAGAGACAAATATGACTTC serpina3j (reverse) GTGCAGGGTTGTTGATCTTGC serpina3k (forward) GGCCATTCCTGATTGTTATC serpina3k (reverse) TGAGAACTTGGTGAGCTTTA serpina3m (forward) GCTTTCGTTCTAGAAGATTAC serpina3m (reverse) CTTGGGGTTAGTGACTTTGGC serpina3n (forward) CAATGTCTGCGAAACTGTACC serpina3n (reverse) TTTGGGGTTGGCTATCTTGGC Primers for genotyping Sequence (5’ - 3’) oSB073 GGGCGGTGTAGGCCGCTGGACC oSB080 CCATCTGGGCATGTGGGATTGGGAC oSB085 CCAGAAAGTCAAAAACTGCACAACATCCG oSB086 CTGGAGCACATCCTTCCTGAGTTGG Antibodies Source Catalog number Monoclonal rat anti-CD3 BioLegend Cat# 100227, clone 17A2 Monoclonal rat antiCD11b BioLegend Cat# 101237, clone M1/70 Monoclonal rat antiCD19 BioLegend Cat# 115537, clone 6D5 Monoclonal mouse antiCD45.2 eBiosciences Cat# 56-0454-82, clone 104 3(3) Monoclonal rat antiLy6C BioLegend Cat# 128012, clone HK1.4 Monoclonal rat antiLy6G BD Biosciences Cat# 563979, clone 1A8 Monoclonal rat antiMHCII/I-A/I-E BD Biosciences Cat# 563415, clone M5/114.15.2 Monoclonal Armenian Hamster anti-TCRβ BioLegend Cat# 109230, clone H57-597 Purified rat antiCD16/CD32 block BD Biosciences Cat# 553142, clone 2.4G2 Equipment Source iQ5 Real-Time PCR Detection System Bio-Rad CFX384 Touch RealTime PCR Detection System Bio-Rad SPECTROstar BMG Labtech Varioskan Lux ThermoFisher Scientific TissueLyser II Qiagen Biopulverizer Biospec Products Homogenizer PT1200 E Polytron Flow cytometer LSRII BD Biosciences Software Source Prism 9 GraphPad Illustrator 2023 Adobe CFX Maestro Bio-Rad FlowJo, version 9.9.6 and v10.7.1 BD Biosciences FACSDiva, version 8.0 BD Biosciences

    Article Title: Treponema pallidum promotes macrophage polarization and activates the NLRP3 inflammasome pathway to induce interleukin-1β production.
    Article Snippet: Inhibitory effects of cathepsin B, ROS, K+, and caspase-1 and their impact on IL-1β expression M0 macrophages were preincubated for 30 min with various inhibitors, namely, 25 mM N-acetylcysteine (NAC) (a ROS inhibitor; Sigma-Aldrich, St. Louis, MO, USA), 30 mM CA074-Me (a cathepsin B inhibitor; Calbiochem, San Diego, CA, USA), 100 mM KCl (a potassium channel inhibitor; Sigma, St. Louis, MO, USA), or 2 μM N-benzyloxycarbonyl-Val-Ala-Asp(O-methyl)-fluoromethyl ketone (Z-VAD-FMK; a caspase-1 inhibitor; Invitrogen Inc., USA).

    Article Title: Fluid shear-induced cathepsin B release in the control of Mac1-dependent neutrophil adhesion
    Article Snippet: Experiments were conducted with cell populations treated with and without 30 μM E64 (cysteine protease inhibitor; Sigma-Aldrich), 50 μM CA074-me (ctsB inhibitor; EMD Millipore, Billerica, MA), or 5 μM AP (negative control inhibitor; Sigma-Aldrich) for 5 min before shear exposure, as reported [ 17 ].

    Article Title: Treponema pallidum promotes macrophage polarization and activates the NLRP3 inflammasome pathway to induce interleukin-1β production
    Article Snippet: M0 macrophages were preincubated for 30 min with various inhibitors, namely, 25 mM N-acetylcysteine (NAC) (a ROS inhibitor; Sigma-Aldrich, St. Louis, MO, USA), 30 mM CA074-Me (a cathepsin B inhibitor; Calbiochem, San Diego, CA, USA), 100 mM KCl (a potassium channel inhibitor; Sigma, St. Louis, MO, USA), or 2 μM N -benzyloxycarbonyl-Val-Ala-Asp( O -methyl)-fluoromethyl ketone (Z-VAD-FMK; a caspase-1 inhibitor; Invitrogen Inc., USA).

    Article Title: Functional inhibition of acid sphingomyelinase disrupts infection by intracellular bacterial pathogens
    Article Snippet: Language Please check spelling and correct notat ion part icularly of chemicals throughout the text , for example: Line 517f: Spelling mistakes: Hoeschst 33342 should be Hoechst amitrypt iline (MilliporeSigma) should be amitriptyline nortrypt iline (MilliporeSigma)should be nortriptyline Ca074-Me (MilliporeSigma) should be CA-074 Me Bodipy (e.g. figures 4D, E) should be consistent ly BODIPY 1st Authors' Response to Reviewers: March 5, 2019 March 5, 2019 RE: Response to reviewer comments for manuscript LSA-2018-00292-TR Dear Reviewers: We hereby resubmit our manuscript, “Functional inhibition of acid sphingomyelinase disrupts infection by intracellular bacterial pathogens” (LSA-2018-00292-TR) for your consideration for publication in Life Science Alliance.

    Article Title: Protective mechanisms of CA074-me (other than cathepsin-B inhibition) against programmed necrosis induced by global cerebral ischemia/reperfusion injury in rats.
    Article Snippet: Many studies have demonstrated the key role of lysosomes in ischemic cell death in the brain and have led to the “lysosomocentric” hypothesis.. In this hypothesis, the release of cathepsin-B due to a change of lysosomal membrane permeabilization (LMP) or rupture is critical, and this can be prevented by its inhibitors CA074 and CA074-me.. However, the role of CA074-me in neuronal death and its effect on the change of lysosomal membrane integrity after global cerebral ischemia/reperfusion (I/R) injury is not clear, so we investigated this here.

    Article Title: Lysophosphatidylcholine Induces NLRP3 Inflammasome-Mediated Foam Cell Formation and Pyroptosis in Human Monocytes and Endothelial Cells
    Article Snippet: Depending on the assay, the cells were also treated with pharmacological inhibitors: N -acetyl- l -cysteine (NAC), 5 mM (Sigma-Aldrich); Ac-YVAD-cho, 20 μM (Enzo Life Sciences); glyburide, 150 μM (Sigma-Aldrich); CA074-ME, 50 μM (Sigma-Aldrich); statin, 25 μM (Sigma-Aldrich); GW9662, 1 μM (Sigma-Aldrich); methyl-beta-cyclodextrin, 10 μM (Sigma-Aldrich); and PAb-hTLR2, 10 μg/ml (InvivoGen).

    Article Title: Functional inhibition of acid sphingomyelinase disrupts infection by intracellular bacterial pathogens
    Article Snippet: Ca074-Me (MilliporeSigma) should be CA-074 Me RESPONSE: Thank you for noting this error, which has now been corrected throughout.

    Activity Assay:

    Article Title:
    Article Snippet: CA074-Me CalBiochem Cat# 205531 E64 Sigma-Aldrich Cat# E3132 Pepstatin A Sigma-Aldrich Cat# P5318 RKLLW-NH2 Sigma-Aldrich Cat# SCP0110 Primers Sequence (5’ - 3’) reep5 (forward) GATACCCAGCCTACATCTCAATG reep5 (reverse) GCAATGCTGAACACACCATATAC ifnb (forward) ATGAGTGGTGGTTGCAGGC ifnb (reverse) TGACCTTTCAAATGCAGTAGATTCA cathepsin B (forward) TCCTTGATCCTTCTTTCTTGCC cathepsin B (reverse) ACAGTGCCACACAGCTTCTTC a3 serpins (forward) TTTCCAGCAACCTCTCAAGGC a3 serpins (reverse) CTGGGTGTGATTGCCCACATA serpina3a (forward) AGATGTCATCACAATAGCCCG serpina3a (reverse) TTTGTTAAAGGGTTGATAACC serpina3b (forward) GATGCAATCACAATAGTCGGATAC serpina3b (reverse) GGTTGATAACCTTGCCCATTAC serpina3c (forward) CTTAGTAGAAGAACCAGTCTG serpina3c (reverse) CTTAGGGTGAGTGATTTTGGC serpina3f (forward) ATCTCCAATGTTGTCAAGGTG serpina3f (reverse) TGAAACTTTTGCCATAAAGAG serpina3g (forward) ACAGGAATGGCAGGTGTCGG serpina3g (reverse) TGTAACTTTTGCCATAAAGA serpina3h (forward) ACAGGGGTCAAATTAATTC serpina3h (reverse) CTTGGGATTTGTAACTTTGGC serpina3i (forward) AGGAGTCAAAGTTAATCTACG serpina3i (reverse) CTTGGGATTTGTAACTTTGGC serpina3j (forward) CAAGAGACAAATATGACTTC serpina3j (reverse) GTGCAGGGTTGTTGATCTTGC serpina3k (forward) GGCCATTCCTGATTGTTATC serpina3k (reverse) TGAGAACTTGGTGAGCTTTA serpina3m (forward) GCTTTCGTTCTAGAAGATTAC serpina3m (reverse) CTTGGGGTTAGTGACTTTGGC serpina3n (forward) CAATGTCTGCGAAACTGTACC serpina3n (reverse) TTTGGGGTTGGCTATCTTGGC Primers for genotyping Sequence (5’ - 3’) oSB073 GGGCGGTGTAGGCCGCTGGACC oSB080 CCATCTGGGCATGTGGGATTGGGAC oSB085 CCAGAAAGTCAAAAACTGCACAACATCCG oSB086 CTGGAGCACATCCTTCCTGAGTTGG Antibodies Source Catalog number Monoclonal rat anti-CD3 BioLegend Cat# 100227, clone 17A2 Monoclonal rat antiCD11b BioLegend Cat# 101237, clone M1/70 Monoclonal rat antiCD19 BioLegend Cat# 115537, clone 6D5 Monoclonal mouse antiCD45.2 eBiosciences Cat# 56-0454-82, clone 104 3(3) Monoclonal rat antiLy6C BioLegend Cat# 128012, clone HK1.4 Monoclonal rat antiLy6G BD Biosciences Cat# 563979, clone 1A8 Monoclonal rat antiMHCII/I-A/I-E BD Biosciences Cat# 563415, clone M5/114.15.2 Monoclonal Armenian Hamster anti-TCRβ BioLegend Cat# 109230, clone H57-597 Purified rat antiCD16/CD32 block BD Biosciences Cat# 553142, clone 2.4G2 Equipment Source iQ5 Real-Time PCR Detection System Bio-Rad CFX384 Touch RealTime PCR Detection System Bio-Rad SPECTROstar BMG Labtech Varioskan Lux ThermoFisher Scientific TissueLyser II Qiagen Biopulverizer Biospec Products Homogenizer PT1200 E Polytron Flow cytometer LSRII BD Biosciences Software Source Prism 9 GraphPad Illustrator 2023 Adobe CFX Maestro Bio-Rad FlowJo, version 9.9.6 and v10.7.1 BD Biosciences FACSDiva, version 8.0 BD Biosciences

    Article Title: Treponema pallidum promotes macrophage polarization and activates the NLRP3 inflammasome pathway to induce interleukin-1β production.
    Article Snippet: Inhibitory effects of cathepsin B, ROS, K+, and caspase-1 and their impact on IL-1β expression M0 macrophages were preincubated for 30 min with various inhibitors, namely, 25 mM N-acetylcysteine (NAC) (a ROS inhibitor; Sigma-Aldrich, St. Louis, MO, USA), 30 mM CA074-Me (a cathepsin B inhibitor; Calbiochem, San Diego, CA, USA), 100 mM KCl (a potassium channel inhibitor; Sigma, St. Louis, MO, USA), or 2 μM N-benzyloxycarbonyl-Val-Ala-Asp(O-methyl)-fluoromethyl ketone (Z-VAD-FMK; a caspase-1 inhibitor; Invitrogen Inc., USA).

    Article Title: Fluid shear-induced cathepsin B release in the control of Mac1-dependent neutrophil adhesion
    Article Snippet: Experiments were conducted with cell populations treated with and without 30 μM E64 (cysteine protease inhibitor; Sigma-Aldrich), 50 μM CA074-me (ctsB inhibitor; EMD Millipore, Billerica, MA), or 5 μM AP (negative control inhibitor; Sigma-Aldrich) for 5 min before shear exposure, as reported [ 17 ].

    Article Title: Treponema pallidum promotes macrophage polarization and activates the NLRP3 inflammasome pathway to induce interleukin-1β production
    Article Snippet: M0 macrophages were preincubated for 30 min with various inhibitors, namely, 25 mM N-acetylcysteine (NAC) (a ROS inhibitor; Sigma-Aldrich, St. Louis, MO, USA), 30 mM CA074-Me (a cathepsin B inhibitor; Calbiochem, San Diego, CA, USA), 100 mM KCl (a potassium channel inhibitor; Sigma, St. Louis, MO, USA), or 2 μM N -benzyloxycarbonyl-Val-Ala-Asp( O -methyl)-fluoromethyl ketone (Z-VAD-FMK; a caspase-1 inhibitor; Invitrogen Inc., USA).

    Article Title: Functional inhibition of acid sphingomyelinase disrupts infection by intracellular bacterial pathogens
    Article Snippet: Language Please check spelling and correct notat ion part icularly of chemicals throughout the text , for example: Line 517f: Spelling mistakes: Hoeschst 33342 should be Hoechst amitrypt iline (MilliporeSigma) should be amitriptyline nortrypt iline (MilliporeSigma)should be nortriptyline Ca074-Me (MilliporeSigma) should be CA-074 Me Bodipy (e.g. figures 4D, E) should be consistent ly BODIPY 1st Authors' Response to Reviewers: March 5, 2019 March 5, 2019 RE: Response to reviewer comments for manuscript LSA-2018-00292-TR Dear Reviewers: We hereby resubmit our manuscript, “Functional inhibition of acid sphingomyelinase disrupts infection by intracellular bacterial pathogens” (LSA-2018-00292-TR) for your consideration for publication in Life Science Alliance.

    Article Title: Protective mechanisms of CA074-me (other than cathepsin-B inhibition) against programmed necrosis induced by global cerebral ischemia/reperfusion injury in rats.
    Article Snippet: Many studies have demonstrated the key role of lysosomes in ischemic cell death in the brain and have led to the “lysosomocentric” hypothesis.. In this hypothesis, the release of cathepsin-B due to a change of lysosomal membrane permeabilization (LMP) or rupture is critical, and this can be prevented by its inhibitors CA074 and CA074-me.. However, the role of CA074-me in neuronal death and its effect on the change of lysosomal membrane integrity after global cerebral ischemia/reperfusion (I/R) injury is not clear, so we investigated this here.

    Article Title: Lysophosphatidylcholine Induces NLRP3 Inflammasome-Mediated Foam Cell Formation and Pyroptosis in Human Monocytes and Endothelial Cells
    Article Snippet: Depending on the assay, the cells were also treated with pharmacological inhibitors: N -acetyl- l -cysteine (NAC), 5 mM (Sigma-Aldrich); Ac-YVAD-cho, 20 μM (Enzo Life Sciences); glyburide, 150 μM (Sigma-Aldrich); CA074-ME, 50 μM (Sigma-Aldrich); statin, 25 μM (Sigma-Aldrich); GW9662, 1 μM (Sigma-Aldrich); methyl-beta-cyclodextrin, 10 μM (Sigma-Aldrich); and PAb-hTLR2, 10 μg/ml (InvivoGen).

    Article Title: Functional inhibition of acid sphingomyelinase disrupts infection by intracellular bacterial pathogens
    Article Snippet: Ca074-Me (MilliporeSigma) should be CA-074 Me RESPONSE: Thank you for noting this error, which has now been corrected throughout.

    Transfection:

    Article Title:
    Article Snippet: CA074-Me CalBiochem Cat# 205531 E64 Sigma-Aldrich Cat# E3132 Pepstatin A Sigma-Aldrich Cat# P5318 RKLLW-NH2 Sigma-Aldrich Cat# SCP0110 Primers Sequence (5’ - 3’) reep5 (forward) GATACCCAGCCTACATCTCAATG reep5 (reverse) GCAATGCTGAACACACCATATAC ifnb (forward) ATGAGTGGTGGTTGCAGGC ifnb (reverse) TGACCTTTCAAATGCAGTAGATTCA cathepsin B (forward) TCCTTGATCCTTCTTTCTTGCC cathepsin B (reverse) ACAGTGCCACACAGCTTCTTC a3 serpins (forward) TTTCCAGCAACCTCTCAAGGC a3 serpins (reverse) CTGGGTGTGATTGCCCACATA serpina3a (forward) AGATGTCATCACAATAGCCCG serpina3a (reverse) TTTGTTAAAGGGTTGATAACC serpina3b (forward) GATGCAATCACAATAGTCGGATAC serpina3b (reverse) GGTTGATAACCTTGCCCATTAC serpina3c (forward) CTTAGTAGAAGAACCAGTCTG serpina3c (reverse) CTTAGGGTGAGTGATTTTGGC serpina3f (forward) ATCTCCAATGTTGTCAAGGTG serpina3f (reverse) TGAAACTTTTGCCATAAAGAG serpina3g (forward) ACAGGAATGGCAGGTGTCGG serpina3g (reverse) TGTAACTTTTGCCATAAAGA serpina3h (forward) ACAGGGGTCAAATTAATTC serpina3h (reverse) CTTGGGATTTGTAACTTTGGC serpina3i (forward) AGGAGTCAAAGTTAATCTACG serpina3i (reverse) CTTGGGATTTGTAACTTTGGC serpina3j (forward) CAAGAGACAAATATGACTTC serpina3j (reverse) GTGCAGGGTTGTTGATCTTGC serpina3k (forward) GGCCATTCCTGATTGTTATC serpina3k (reverse) TGAGAACTTGGTGAGCTTTA serpina3m (forward) GCTTTCGTTCTAGAAGATTAC serpina3m (reverse) CTTGGGGTTAGTGACTTTGGC serpina3n (forward) CAATGTCTGCGAAACTGTACC serpina3n (reverse) TTTGGGGTTGGCTATCTTGGC Primers for genotyping Sequence (5’ - 3’) oSB073 GGGCGGTGTAGGCCGCTGGACC oSB080 CCATCTGGGCATGTGGGATTGGGAC oSB085 CCAGAAAGTCAAAAACTGCACAACATCCG oSB086 CTGGAGCACATCCTTCCTGAGTTGG Antibodies Source Catalog number Monoclonal rat anti-CD3 BioLegend Cat# 100227, clone 17A2 Monoclonal rat antiCD11b BioLegend Cat# 101237, clone M1/70 Monoclonal rat antiCD19 BioLegend Cat# 115537, clone 6D5 Monoclonal mouse antiCD45.2 eBiosciences Cat# 56-0454-82, clone 104 3(3) Monoclonal rat antiLy6C BioLegend Cat# 128012, clone HK1.4 Monoclonal rat antiLy6G BD Biosciences Cat# 563979, clone 1A8 Monoclonal rat antiMHCII/I-A/I-E BD Biosciences Cat# 563415, clone M5/114.15.2 Monoclonal Armenian Hamster anti-TCRβ BioLegend Cat# 109230, clone H57-597 Purified rat antiCD16/CD32 block BD Biosciences Cat# 553142, clone 2.4G2 Equipment Source iQ5 Real-Time PCR Detection System Bio-Rad CFX384 Touch RealTime PCR Detection System Bio-Rad SPECTROstar BMG Labtech Varioskan Lux ThermoFisher Scientific TissueLyser II Qiagen Biopulverizer Biospec Products Homogenizer PT1200 E Polytron Flow cytometer LSRII BD Biosciences Software Source Prism 9 GraphPad Illustrator 2023 Adobe CFX Maestro Bio-Rad FlowJo, version 9.9.6 and v10.7.1 BD Biosciences FACSDiva, version 8.0 BD Biosciences

    Article Title: Treponema pallidum promotes macrophage polarization and activates the NLRP3 inflammasome pathway to induce interleukin-1β production.
    Article Snippet: Inhibitory effects of cathepsin B, ROS, K+, and caspase-1 and their impact on IL-1β expression M0 macrophages were preincubated for 30 min with various inhibitors, namely, 25 mM N-acetylcysteine (NAC) (a ROS inhibitor; Sigma-Aldrich, St. Louis, MO, USA), 30 mM CA074-Me (a cathepsin B inhibitor; Calbiochem, San Diego, CA, USA), 100 mM KCl (a potassium channel inhibitor; Sigma, St. Louis, MO, USA), or 2 μM N-benzyloxycarbonyl-Val-Ala-Asp(O-methyl)-fluoromethyl ketone (Z-VAD-FMK; a caspase-1 inhibitor; Invitrogen Inc., USA).

    Article Title: Fluid shear-induced cathepsin B release in the control of Mac1-dependent neutrophil adhesion
    Article Snippet: Experiments were conducted with cell populations treated with and without 30 μM E64 (cysteine protease inhibitor; Sigma-Aldrich), 50 μM CA074-me (ctsB inhibitor; EMD Millipore, Billerica, MA), or 5 μM AP (negative control inhibitor; Sigma-Aldrich) for 5 min before shear exposure, as reported [ 17 ].

    Article Title: Treponema pallidum promotes macrophage polarization and activates the NLRP3 inflammasome pathway to induce interleukin-1β production
    Article Snippet: M0 macrophages were preincubated for 30 min with various inhibitors, namely, 25 mM N-acetylcysteine (NAC) (a ROS inhibitor; Sigma-Aldrich, St. Louis, MO, USA), 30 mM CA074-Me (a cathepsin B inhibitor; Calbiochem, San Diego, CA, USA), 100 mM KCl (a potassium channel inhibitor; Sigma, St. Louis, MO, USA), or 2 μM N -benzyloxycarbonyl-Val-Ala-Asp( O -methyl)-fluoromethyl ketone (Z-VAD-FMK; a caspase-1 inhibitor; Invitrogen Inc., USA).

    Article Title: Functional inhibition of acid sphingomyelinase disrupts infection by intracellular bacterial pathogens
    Article Snippet: Language Please check spelling and correct notat ion part icularly of chemicals throughout the text , for example: Line 517f: Spelling mistakes: Hoeschst 33342 should be Hoechst amitrypt iline (MilliporeSigma) should be amitriptyline nortrypt iline (MilliporeSigma)should be nortriptyline Ca074-Me (MilliporeSigma) should be CA-074 Me Bodipy (e.g. figures 4D, E) should be consistent ly BODIPY 1st Authors' Response to Reviewers: March 5, 2019 March 5, 2019 RE: Response to reviewer comments for manuscript LSA-2018-00292-TR Dear Reviewers: We hereby resubmit our manuscript, “Functional inhibition of acid sphingomyelinase disrupts infection by intracellular bacterial pathogens” (LSA-2018-00292-TR) for your consideration for publication in Life Science Alliance.

    Article Title: Protective mechanisms of CA074-me (other than cathepsin-B inhibition) against programmed necrosis induced by global cerebral ischemia/reperfusion injury in rats.
    Article Snippet: Many studies have demonstrated the key role of lysosomes in ischemic cell death in the brain and have led to the “lysosomocentric” hypothesis.. In this hypothesis, the release of cathepsin-B due to a change of lysosomal membrane permeabilization (LMP) or rupture is critical, and this can be prevented by its inhibitors CA074 and CA074-me.. However, the role of CA074-me in neuronal death and its effect on the change of lysosomal membrane integrity after global cerebral ischemia/reperfusion (I/R) injury is not clear, so we investigated this here.

    Article Title: Lysophosphatidylcholine Induces NLRP3 Inflammasome-Mediated Foam Cell Formation and Pyroptosis in Human Monocytes and Endothelial Cells
    Article Snippet: Depending on the assay, the cells were also treated with pharmacological inhibitors: N -acetyl- l -cysteine (NAC), 5 mM (Sigma-Aldrich); Ac-YVAD-cho, 20 μM (Enzo Life Sciences); glyburide, 150 μM (Sigma-Aldrich); CA074-ME, 50 μM (Sigma-Aldrich); statin, 25 μM (Sigma-Aldrich); GW9662, 1 μM (Sigma-Aldrich); methyl-beta-cyclodextrin, 10 μM (Sigma-Aldrich); and PAb-hTLR2, 10 μg/ml (InvivoGen).

    Article Title: Functional inhibition of acid sphingomyelinase disrupts infection by intracellular bacterial pathogens
    Article Snippet: Ca074-Me (MilliporeSigma) should be CA-074 Me RESPONSE: Thank you for noting this error, which has now been corrected throughout.

    Electroporation:

    Article Title:
    Article Snippet: CA074-Me CalBiochem Cat# 205531 E64 Sigma-Aldrich Cat# E3132 Pepstatin A Sigma-Aldrich Cat# P5318 RKLLW-NH2 Sigma-Aldrich Cat# SCP0110 Primers Sequence (5’ - 3’) reep5 (forward) GATACCCAGCCTACATCTCAATG reep5 (reverse) GCAATGCTGAACACACCATATAC ifnb (forward) ATGAGTGGTGGTTGCAGGC ifnb (reverse) TGACCTTTCAAATGCAGTAGATTCA cathepsin B (forward) TCCTTGATCCTTCTTTCTTGCC cathepsin B (reverse) ACAGTGCCACACAGCTTCTTC a3 serpins (forward) TTTCCAGCAACCTCTCAAGGC a3 serpins (reverse) CTGGGTGTGATTGCCCACATA serpina3a (forward) AGATGTCATCACAATAGCCCG serpina3a (reverse) TTTGTTAAAGGGTTGATAACC serpina3b (forward) GATGCAATCACAATAGTCGGATAC serpina3b (reverse) GGTTGATAACCTTGCCCATTAC serpina3c (forward) CTTAGTAGAAGAACCAGTCTG serpina3c (reverse) CTTAGGGTGAGTGATTTTGGC serpina3f (forward) ATCTCCAATGTTGTCAAGGTG serpina3f (reverse) TGAAACTTTTGCCATAAAGAG serpina3g (forward) ACAGGAATGGCAGGTGTCGG serpina3g (reverse) TGTAACTTTTGCCATAAAGA serpina3h (forward) ACAGGGGTCAAATTAATTC serpina3h (reverse) CTTGGGATTTGTAACTTTGGC serpina3i (forward) AGGAGTCAAAGTTAATCTACG serpina3i (reverse) CTTGGGATTTGTAACTTTGGC serpina3j (forward) CAAGAGACAAATATGACTTC serpina3j (reverse) GTGCAGGGTTGTTGATCTTGC serpina3k (forward) GGCCATTCCTGATTGTTATC serpina3k (reverse) TGAGAACTTGGTGAGCTTTA serpina3m (forward) GCTTTCGTTCTAGAAGATTAC serpina3m (reverse) CTTGGGGTTAGTGACTTTGGC serpina3n (forward) CAATGTCTGCGAAACTGTACC serpina3n (reverse) TTTGGGGTTGGCTATCTTGGC Primers for genotyping Sequence (5’ - 3’) oSB073 GGGCGGTGTAGGCCGCTGGACC oSB080 CCATCTGGGCATGTGGGATTGGGAC oSB085 CCAGAAAGTCAAAAACTGCACAACATCCG oSB086 CTGGAGCACATCCTTCCTGAGTTGG Antibodies Source Catalog number Monoclonal rat anti-CD3 BioLegend Cat# 100227, clone 17A2 Monoclonal rat antiCD11b BioLegend Cat# 101237, clone M1/70 Monoclonal rat antiCD19 BioLegend Cat# 115537, clone 6D5 Monoclonal mouse antiCD45.2 eBiosciences Cat# 56-0454-82, clone 104 3(3) Monoclonal rat antiLy6C BioLegend Cat# 128012, clone HK1.4 Monoclonal rat antiLy6G BD Biosciences Cat# 563979, clone 1A8 Monoclonal rat antiMHCII/I-A/I-E BD Biosciences Cat# 563415, clone M5/114.15.2 Monoclonal Armenian Hamster anti-TCRβ BioLegend Cat# 109230, clone H57-597 Purified rat antiCD16/CD32 block BD Biosciences Cat# 553142, clone 2.4G2 Equipment Source iQ5 Real-Time PCR Detection System Bio-Rad CFX384 Touch RealTime PCR Detection System Bio-Rad SPECTROstar BMG Labtech Varioskan Lux ThermoFisher Scientific TissueLyser II Qiagen Biopulverizer Biospec Products Homogenizer PT1200 E Polytron Flow cytometer LSRII BD Biosciences Software Source Prism 9 GraphPad Illustrator 2023 Adobe CFX Maestro Bio-Rad FlowJo, version 9.9.6 and v10.7.1 BD Biosciences FACSDiva, version 8.0 BD Biosciences

    Article Title: Treponema pallidum promotes macrophage polarization and activates the NLRP3 inflammasome pathway to induce interleukin-1β production.
    Article Snippet: Inhibitory effects of cathepsin B, ROS, K+, and caspase-1 and their impact on IL-1β expression M0 macrophages were preincubated for 30 min with various inhibitors, namely, 25 mM N-acetylcysteine (NAC) (a ROS inhibitor; Sigma-Aldrich, St. Louis, MO, USA), 30 mM CA074-Me (a cathepsin B inhibitor; Calbiochem, San Diego, CA, USA), 100 mM KCl (a potassium channel inhibitor; Sigma, St. Louis, MO, USA), or 2 μM N-benzyloxycarbonyl-Val-Ala-Asp(O-methyl)-fluoromethyl ketone (Z-VAD-FMK; a caspase-1 inhibitor; Invitrogen Inc., USA).

    Article Title: Fluid shear-induced cathepsin B release in the control of Mac1-dependent neutrophil adhesion
    Article Snippet: Experiments were conducted with cell populations treated with and without 30 μM E64 (cysteine protease inhibitor; Sigma-Aldrich), 50 μM CA074-me (ctsB inhibitor; EMD Millipore, Billerica, MA), or 5 μM AP (negative control inhibitor; Sigma-Aldrich) for 5 min before shear exposure, as reported [ 17 ].

    Article Title: Treponema pallidum promotes macrophage polarization and activates the NLRP3 inflammasome pathway to induce interleukin-1β production
    Article Snippet: M0 macrophages were preincubated for 30 min with various inhibitors, namely, 25 mM N-acetylcysteine (NAC) (a ROS inhibitor; Sigma-Aldrich, St. Louis, MO, USA), 30 mM CA074-Me (a cathepsin B inhibitor; Calbiochem, San Diego, CA, USA), 100 mM KCl (a potassium channel inhibitor; Sigma, St. Louis, MO, USA), or 2 μM N -benzyloxycarbonyl-Val-Ala-Asp( O -methyl)-fluoromethyl ketone (Z-VAD-FMK; a caspase-1 inhibitor; Invitrogen Inc., USA).

    Article Title: Functional inhibition of acid sphingomyelinase disrupts infection by intracellular bacterial pathogens
    Article Snippet: Language Please check spelling and correct notat ion part icularly of chemicals throughout the text , for example: Line 517f: Spelling mistakes: Hoeschst 33342 should be Hoechst amitrypt iline (MilliporeSigma) should be amitriptyline nortrypt iline (MilliporeSigma)should be nortriptyline Ca074-Me (MilliporeSigma) should be CA-074 Me Bodipy (e.g. figures 4D, E) should be consistent ly BODIPY 1st Authors' Response to Reviewers: March 5, 2019 March 5, 2019 RE: Response to reviewer comments for manuscript LSA-2018-00292-TR Dear Reviewers: We hereby resubmit our manuscript, “Functional inhibition of acid sphingomyelinase disrupts infection by intracellular bacterial pathogens” (LSA-2018-00292-TR) for your consideration for publication in Life Science Alliance.

    Article Title: Protective mechanisms of CA074-me (other than cathepsin-B inhibition) against programmed necrosis induced by global cerebral ischemia/reperfusion injury in rats.
    Article Snippet: Many studies have demonstrated the key role of lysosomes in ischemic cell death in the brain and have led to the “lysosomocentric” hypothesis.. In this hypothesis, the release of cathepsin-B due to a change of lysosomal membrane permeabilization (LMP) or rupture is critical, and this can be prevented by its inhibitors CA074 and CA074-me.. However, the role of CA074-me in neuronal death and its effect on the change of lysosomal membrane integrity after global cerebral ischemia/reperfusion (I/R) injury is not clear, so we investigated this here.

    Article Title: Lysophosphatidylcholine Induces NLRP3 Inflammasome-Mediated Foam Cell Formation and Pyroptosis in Human Monocytes and Endothelial Cells
    Article Snippet: Depending on the assay, the cells were also treated with pharmacological inhibitors: N -acetyl- l -cysteine (NAC), 5 mM (Sigma-Aldrich); Ac-YVAD-cho, 20 μM (Enzo Life Sciences); glyburide, 150 μM (Sigma-Aldrich); CA074-ME, 50 μM (Sigma-Aldrich); statin, 25 μM (Sigma-Aldrich); GW9662, 1 μM (Sigma-Aldrich); methyl-beta-cyclodextrin, 10 μM (Sigma-Aldrich); and PAb-hTLR2, 10 μg/ml (InvivoGen).

    Article Title: Functional inhibition of acid sphingomyelinase disrupts infection by intracellular bacterial pathogens
    Article Snippet: Ca074-Me (MilliporeSigma) should be CA-074 Me RESPONSE: Thank you for noting this error, which has now been corrected throughout.

    Plasmid Preparation:

    Article Title:
    Article Snippet: CA074-Me CalBiochem Cat# 205531 E64 Sigma-Aldrich Cat# E3132 Pepstatin A Sigma-Aldrich Cat# P5318 RKLLW-NH2 Sigma-Aldrich Cat# SCP0110 Primers Sequence (5’ - 3’) reep5 (forward) GATACCCAGCCTACATCTCAATG reep5 (reverse) GCAATGCTGAACACACCATATAC ifnb (forward) ATGAGTGGTGGTTGCAGGC ifnb (reverse) TGACCTTTCAAATGCAGTAGATTCA cathepsin B (forward) TCCTTGATCCTTCTTTCTTGCC cathepsin B (reverse) ACAGTGCCACACAGCTTCTTC a3 serpins (forward) TTTCCAGCAACCTCTCAAGGC a3 serpins (reverse) CTGGGTGTGATTGCCCACATA serpina3a (forward) AGATGTCATCACAATAGCCCG serpina3a (reverse) TTTGTTAAAGGGTTGATAACC serpina3b (forward) GATGCAATCACAATAGTCGGATAC serpina3b (reverse) GGTTGATAACCTTGCCCATTAC serpina3c (forward) CTTAGTAGAAGAACCAGTCTG serpina3c (reverse) CTTAGGGTGAGTGATTTTGGC serpina3f (forward) ATCTCCAATGTTGTCAAGGTG serpina3f (reverse) TGAAACTTTTGCCATAAAGAG serpina3g (forward) ACAGGAATGGCAGGTGTCGG serpina3g (reverse) TGTAACTTTTGCCATAAAGA serpina3h (forward) ACAGGGGTCAAATTAATTC serpina3h (reverse) CTTGGGATTTGTAACTTTGGC serpina3i (forward) AGGAGTCAAAGTTAATCTACG serpina3i (reverse) CTTGGGATTTGTAACTTTGGC serpina3j (forward) CAAGAGACAAATATGACTTC serpina3j (reverse) GTGCAGGGTTGTTGATCTTGC serpina3k (forward) GGCCATTCCTGATTGTTATC serpina3k (reverse) TGAGAACTTGGTGAGCTTTA serpina3m (forward) GCTTTCGTTCTAGAAGATTAC serpina3m (reverse) CTTGGGGTTAGTGACTTTGGC serpina3n (forward) CAATGTCTGCGAAACTGTACC serpina3n (reverse) TTTGGGGTTGGCTATCTTGGC Primers for genotyping Sequence (5’ - 3’) oSB073 GGGCGGTGTAGGCCGCTGGACC oSB080 CCATCTGGGCATGTGGGATTGGGAC oSB085 CCAGAAAGTCAAAAACTGCACAACATCCG oSB086 CTGGAGCACATCCTTCCTGAGTTGG Antibodies Source Catalog number Monoclonal rat anti-CD3 BioLegend Cat# 100227, clone 17A2 Monoclonal rat antiCD11b BioLegend Cat# 101237, clone M1/70 Monoclonal rat antiCD19 BioLegend Cat# 115537, clone 6D5 Monoclonal mouse antiCD45.2 eBiosciences Cat# 56-0454-82, clone 104 3(3) Monoclonal rat antiLy6C BioLegend Cat# 128012, clone HK1.4 Monoclonal rat antiLy6G BD Biosciences Cat# 563979, clone 1A8 Monoclonal rat antiMHCII/I-A/I-E BD Biosciences Cat# 563415, clone M5/114.15.2 Monoclonal Armenian Hamster anti-TCRβ BioLegend Cat# 109230, clone H57-597 Purified rat antiCD16/CD32 block BD Biosciences Cat# 553142, clone 2.4G2 Equipment Source iQ5 Real-Time PCR Detection System Bio-Rad CFX384 Touch RealTime PCR Detection System Bio-Rad SPECTROstar BMG Labtech Varioskan Lux ThermoFisher Scientific TissueLyser II Qiagen Biopulverizer Biospec Products Homogenizer PT1200 E Polytron Flow cytometer LSRII BD Biosciences Software Source Prism 9 GraphPad Illustrator 2023 Adobe CFX Maestro Bio-Rad FlowJo, version 9.9.6 and v10.7.1 BD Biosciences FACSDiva, version 8.0 BD Biosciences

    Article Title: Treponema pallidum promotes macrophage polarization and activates the NLRP3 inflammasome pathway to induce interleukin-1β production.
    Article Snippet: Inhibitory effects of cathepsin B, ROS, K+, and caspase-1 and their impact on IL-1β expression M0 macrophages were preincubated for 30 min with various inhibitors, namely, 25 mM N-acetylcysteine (NAC) (a ROS inhibitor; Sigma-Aldrich, St. Louis, MO, USA), 30 mM CA074-Me (a cathepsin B inhibitor; Calbiochem, San Diego, CA, USA), 100 mM KCl (a potassium channel inhibitor; Sigma, St. Louis, MO, USA), or 2 μM N-benzyloxycarbonyl-Val-Ala-Asp(O-methyl)-fluoromethyl ketone (Z-VAD-FMK; a caspase-1 inhibitor; Invitrogen Inc., USA).

    Article Title: Fluid shear-induced cathepsin B release in the control of Mac1-dependent neutrophil adhesion
    Article Snippet: Experiments were conducted with cell populations treated with and without 30 μM E64 (cysteine protease inhibitor; Sigma-Aldrich), 50 μM CA074-me (ctsB inhibitor; EMD Millipore, Billerica, MA), or 5 μM AP (negative control inhibitor; Sigma-Aldrich) for 5 min before shear exposure, as reported [ 17 ].

    Article Title: Treponema pallidum promotes macrophage polarization and activates the NLRP3 inflammasome pathway to induce interleukin-1β production
    Article Snippet: M0 macrophages were preincubated for 30 min with various inhibitors, namely, 25 mM N-acetylcysteine (NAC) (a ROS inhibitor; Sigma-Aldrich, St. Louis, MO, USA), 30 mM CA074-Me (a cathepsin B inhibitor; Calbiochem, San Diego, CA, USA), 100 mM KCl (a potassium channel inhibitor; Sigma, St. Louis, MO, USA), or 2 μM N -benzyloxycarbonyl-Val-Ala-Asp( O -methyl)-fluoromethyl ketone (Z-VAD-FMK; a caspase-1 inhibitor; Invitrogen Inc., USA).

    Article Title: Functional inhibition of acid sphingomyelinase disrupts infection by intracellular bacterial pathogens
    Article Snippet: Language Please check spelling and correct notat ion part icularly of chemicals throughout the text , for example: Line 517f: Spelling mistakes: Hoeschst 33342 should be Hoechst amitrypt iline (MilliporeSigma) should be amitriptyline nortrypt iline (MilliporeSigma)should be nortriptyline Ca074-Me (MilliporeSigma) should be CA-074 Me Bodipy (e.g. figures 4D, E) should be consistent ly BODIPY 1st Authors' Response to Reviewers: March 5, 2019 March 5, 2019 RE: Response to reviewer comments for manuscript LSA-2018-00292-TR Dear Reviewers: We hereby resubmit our manuscript, “Functional inhibition of acid sphingomyelinase disrupts infection by intracellular bacterial pathogens” (LSA-2018-00292-TR) for your consideration for publication in Life Science Alliance.

    Article Title: Protective mechanisms of CA074-me (other than cathepsin-B inhibition) against programmed necrosis induced by global cerebral ischemia/reperfusion injury in rats.
    Article Snippet: Many studies have demonstrated the key role of lysosomes in ischemic cell death in the brain and have led to the “lysosomocentric” hypothesis.. In this hypothesis, the release of cathepsin-B due to a change of lysosomal membrane permeabilization (LMP) or rupture is critical, and this can be prevented by its inhibitors CA074 and CA074-me.. However, the role of CA074-me in neuronal death and its effect on the change of lysosomal membrane integrity after global cerebral ischemia/reperfusion (I/R) injury is not clear, so we investigated this here.

    Article Title: Lysophosphatidylcholine Induces NLRP3 Inflammasome-Mediated Foam Cell Formation and Pyroptosis in Human Monocytes and Endothelial Cells
    Article Snippet: Depending on the assay, the cells were also treated with pharmacological inhibitors: N -acetyl- l -cysteine (NAC), 5 mM (Sigma-Aldrich); Ac-YVAD-cho, 20 μM (Enzo Life Sciences); glyburide, 150 μM (Sigma-Aldrich); CA074-ME, 50 μM (Sigma-Aldrich); statin, 25 μM (Sigma-Aldrich); GW9662, 1 μM (Sigma-Aldrich); methyl-beta-cyclodextrin, 10 μM (Sigma-Aldrich); and PAb-hTLR2, 10 μg/ml (InvivoGen).

    Article Title: Functional inhibition of acid sphingomyelinase disrupts infection by intracellular bacterial pathogens
    Article Snippet: Ca074-Me (MilliporeSigma) should be CA-074 Me RESPONSE: Thank you for noting this error, which has now been corrected throughout.

    In Vivo:

    Article Title:
    Article Snippet: CA074-Me CalBiochem Cat# 205531 E64 Sigma-Aldrich Cat# E3132 Pepstatin A Sigma-Aldrich Cat# P5318 RKLLW-NH2 Sigma-Aldrich Cat# SCP0110 Primers Sequence (5’ - 3’) reep5 (forward) GATACCCAGCCTACATCTCAATG reep5 (reverse) GCAATGCTGAACACACCATATAC ifnb (forward) ATGAGTGGTGGTTGCAGGC ifnb (reverse) TGACCTTTCAAATGCAGTAGATTCA cathepsin B (forward) TCCTTGATCCTTCTTTCTTGCC cathepsin B (reverse) ACAGTGCCACACAGCTTCTTC a3 serpins (forward) TTTCCAGCAACCTCTCAAGGC a3 serpins (reverse) CTGGGTGTGATTGCCCACATA serpina3a (forward) AGATGTCATCACAATAGCCCG serpina3a (reverse) TTTGTTAAAGGGTTGATAACC serpina3b (forward) GATGCAATCACAATAGTCGGATAC serpina3b (reverse) GGTTGATAACCTTGCCCATTAC serpina3c (forward) CTTAGTAGAAGAACCAGTCTG serpina3c (reverse) CTTAGGGTGAGTGATTTTGGC serpina3f (forward) ATCTCCAATGTTGTCAAGGTG serpina3f (reverse) TGAAACTTTTGCCATAAAGAG serpina3g (forward) ACAGGAATGGCAGGTGTCGG serpina3g (reverse) TGTAACTTTTGCCATAAAGA serpina3h (forward) ACAGGGGTCAAATTAATTC serpina3h (reverse) CTTGGGATTTGTAACTTTGGC serpina3i (forward) AGGAGTCAAAGTTAATCTACG serpina3i (reverse) CTTGGGATTTGTAACTTTGGC serpina3j (forward) CAAGAGACAAATATGACTTC serpina3j (reverse) GTGCAGGGTTGTTGATCTTGC serpina3k (forward) GGCCATTCCTGATTGTTATC serpina3k (reverse) TGAGAACTTGGTGAGCTTTA serpina3m (forward) GCTTTCGTTCTAGAAGATTAC serpina3m (reverse) CTTGGGGTTAGTGACTTTGGC serpina3n (forward) CAATGTCTGCGAAACTGTACC serpina3n (reverse) TTTGGGGTTGGCTATCTTGGC Primers for genotyping Sequence (5’ - 3’) oSB073 GGGCGGTGTAGGCCGCTGGACC oSB080 CCATCTGGGCATGTGGGATTGGGAC oSB085 CCAGAAAGTCAAAAACTGCACAACATCCG oSB086 CTGGAGCACATCCTTCCTGAGTTGG Antibodies Source Catalog number Monoclonal rat anti-CD3 BioLegend Cat# 100227, clone 17A2 Monoclonal rat antiCD11b BioLegend Cat# 101237, clone M1/70 Monoclonal rat antiCD19 BioLegend Cat# 115537, clone 6D5 Monoclonal mouse antiCD45.2 eBiosciences Cat# 56-0454-82, clone 104 3(3) Monoclonal rat antiLy6C BioLegend Cat# 128012, clone HK1.4 Monoclonal rat antiLy6G BD Biosciences Cat# 563979, clone 1A8 Monoclonal rat antiMHCII/I-A/I-E BD Biosciences Cat# 563415, clone M5/114.15.2 Monoclonal Armenian Hamster anti-TCRβ BioLegend Cat# 109230, clone H57-597 Purified rat antiCD16/CD32 block BD Biosciences Cat# 553142, clone 2.4G2 Equipment Source iQ5 Real-Time PCR Detection System Bio-Rad CFX384 Touch RealTime PCR Detection System Bio-Rad SPECTROstar BMG Labtech Varioskan Lux ThermoFisher Scientific TissueLyser II Qiagen Biopulverizer Biospec Products Homogenizer PT1200 E Polytron Flow cytometer LSRII BD Biosciences Software Source Prism 9 GraphPad Illustrator 2023 Adobe CFX Maestro Bio-Rad FlowJo, version 9.9.6 and v10.7.1 BD Biosciences FACSDiva, version 8.0 BD Biosciences

    Article Title: Treponema pallidum promotes macrophage polarization and activates the NLRP3 inflammasome pathway to induce interleukin-1β production.
    Article Snippet: Inhibitory effects of cathepsin B, ROS, K+, and caspase-1 and their impact on IL-1β expression M0 macrophages were preincubated for 30 min with various inhibitors, namely, 25 mM N-acetylcysteine (NAC) (a ROS inhibitor; Sigma-Aldrich, St. Louis, MO, USA), 30 mM CA074-Me (a cathepsin B inhibitor; Calbiochem, San Diego, CA, USA), 100 mM KCl (a potassium channel inhibitor; Sigma, St. Louis, MO, USA), or 2 μM N-benzyloxycarbonyl-Val-Ala-Asp(O-methyl)-fluoromethyl ketone (Z-VAD-FMK; a caspase-1 inhibitor; Invitrogen Inc., USA).

    Article Title: Fluid shear-induced cathepsin B release in the control of Mac1-dependent neutrophil adhesion
    Article Snippet: Experiments were conducted with cell populations treated with and without 30 μM E64 (cysteine protease inhibitor; Sigma-Aldrich), 50 μM CA074-me (ctsB inhibitor; EMD Millipore, Billerica, MA), or 5 μM AP (negative control inhibitor; Sigma-Aldrich) for 5 min before shear exposure, as reported [ 17 ].

    Article Title: Treponema pallidum promotes macrophage polarization and activates the NLRP3 inflammasome pathway to induce interleukin-1β production
    Article Snippet: M0 macrophages were preincubated for 30 min with various inhibitors, namely, 25 mM N-acetylcysteine (NAC) (a ROS inhibitor; Sigma-Aldrich, St. Louis, MO, USA), 30 mM CA074-Me (a cathepsin B inhibitor; Calbiochem, San Diego, CA, USA), 100 mM KCl (a potassium channel inhibitor; Sigma, St. Louis, MO, USA), or 2 μM N -benzyloxycarbonyl-Val-Ala-Asp( O -methyl)-fluoromethyl ketone (Z-VAD-FMK; a caspase-1 inhibitor; Invitrogen Inc., USA).

    Article Title: Functional inhibition of acid sphingomyelinase disrupts infection by intracellular bacterial pathogens
    Article Snippet: Language Please check spelling and correct notat ion part icularly of chemicals throughout the text , for example: Line 517f: Spelling mistakes: Hoeschst 33342 should be Hoechst amitrypt iline (MilliporeSigma) should be amitriptyline nortrypt iline (MilliporeSigma)should be nortriptyline Ca074-Me (MilliporeSigma) should be CA-074 Me Bodipy (e.g. figures 4D, E) should be consistent ly BODIPY 1st Authors' Response to Reviewers: March 5, 2019 March 5, 2019 RE: Response to reviewer comments for manuscript LSA-2018-00292-TR Dear Reviewers: We hereby resubmit our manuscript, “Functional inhibition of acid sphingomyelinase disrupts infection by intracellular bacterial pathogens” (LSA-2018-00292-TR) for your consideration for publication in Life Science Alliance.

    Article Title: Protective mechanisms of CA074-me (other than cathepsin-B inhibition) against programmed necrosis induced by global cerebral ischemia/reperfusion injury in rats.
    Article Snippet: Many studies have demonstrated the key role of lysosomes in ischemic cell death in the brain and have led to the “lysosomocentric” hypothesis.. In this hypothesis, the release of cathepsin-B due to a change of lysosomal membrane permeabilization (LMP) or rupture is critical, and this can be prevented by its inhibitors CA074 and CA074-me.. However, the role of CA074-me in neuronal death and its effect on the change of lysosomal membrane integrity after global cerebral ischemia/reperfusion (I/R) injury is not clear, so we investigated this here.

    Article Title: Lysophosphatidylcholine Induces NLRP3 Inflammasome-Mediated Foam Cell Formation and Pyroptosis in Human Monocytes and Endothelial Cells
    Article Snippet: Depending on the assay, the cells were also treated with pharmacological inhibitors: N -acetyl- l -cysteine (NAC), 5 mM (Sigma-Aldrich); Ac-YVAD-cho, 20 μM (Enzo Life Sciences); glyburide, 150 μM (Sigma-Aldrich); CA074-ME, 50 μM (Sigma-Aldrich); statin, 25 μM (Sigma-Aldrich); GW9662, 1 μM (Sigma-Aldrich); methyl-beta-cyclodextrin, 10 μM (Sigma-Aldrich); and PAb-hTLR2, 10 μg/ml (InvivoGen).

    Article Title: Functional inhibition of acid sphingomyelinase disrupts infection by intracellular bacterial pathogens
    Article Snippet: Ca074-Me (MilliporeSigma) should be CA-074 Me RESPONSE: Thank you for noting this error, which has now been corrected throughout.

    Confocal Microscopy:

    Article Title:
    Article Snippet: CA074-Me CalBiochem Cat# 205531 E64 Sigma-Aldrich Cat# E3132 Pepstatin A Sigma-Aldrich Cat# P5318 RKLLW-NH2 Sigma-Aldrich Cat# SCP0110 Primers Sequence (5’ - 3’) reep5 (forward) GATACCCAGCCTACATCTCAATG reep5 (reverse) GCAATGCTGAACACACCATATAC ifnb (forward) ATGAGTGGTGGTTGCAGGC ifnb (reverse) TGACCTTTCAAATGCAGTAGATTCA cathepsin B (forward) TCCTTGATCCTTCTTTCTTGCC cathepsin B (reverse) ACAGTGCCACACAGCTTCTTC a3 serpins (forward) TTTCCAGCAACCTCTCAAGGC a3 serpins (reverse) CTGGGTGTGATTGCCCACATA serpina3a (forward) AGATGTCATCACAATAGCCCG serpina3a (reverse) TTTGTTAAAGGGTTGATAACC serpina3b (forward) GATGCAATCACAATAGTCGGATAC serpina3b (reverse) GGTTGATAACCTTGCCCATTAC serpina3c (forward) CTTAGTAGAAGAACCAGTCTG serpina3c (reverse) CTTAGGGTGAGTGATTTTGGC serpina3f (forward) ATCTCCAATGTTGTCAAGGTG serpina3f (reverse) TGAAACTTTTGCCATAAAGAG serpina3g (forward) ACAGGAATGGCAGGTGTCGG serpina3g (reverse) TGTAACTTTTGCCATAAAGA serpina3h (forward) ACAGGGGTCAAATTAATTC serpina3h (reverse) CTTGGGATTTGTAACTTTGGC serpina3i (forward) AGGAGTCAAAGTTAATCTACG serpina3i (reverse) CTTGGGATTTGTAACTTTGGC serpina3j (forward) CAAGAGACAAATATGACTTC serpina3j (reverse) GTGCAGGGTTGTTGATCTTGC serpina3k (forward) GGCCATTCCTGATTGTTATC serpina3k (reverse) TGAGAACTTGGTGAGCTTTA serpina3m (forward) GCTTTCGTTCTAGAAGATTAC serpina3m (reverse) CTTGGGGTTAGTGACTTTGGC serpina3n (forward) CAATGTCTGCGAAACTGTACC serpina3n (reverse) TTTGGGGTTGGCTATCTTGGC Primers for genotyping Sequence (5’ - 3’) oSB073 GGGCGGTGTAGGCCGCTGGACC oSB080 CCATCTGGGCATGTGGGATTGGGAC oSB085 CCAGAAAGTCAAAAACTGCACAACATCCG oSB086 CTGGAGCACATCCTTCCTGAGTTGG Antibodies Source Catalog number Monoclonal rat anti-CD3 BioLegend Cat# 100227, clone 17A2 Monoclonal rat antiCD11b BioLegend Cat# 101237, clone M1/70 Monoclonal rat antiCD19 BioLegend Cat# 115537, clone 6D5 Monoclonal mouse antiCD45.2 eBiosciences Cat# 56-0454-82, clone 104 3(3) Monoclonal rat antiLy6C BioLegend Cat# 128012, clone HK1.4 Monoclonal rat antiLy6G BD Biosciences Cat# 563979, clone 1A8 Monoclonal rat antiMHCII/I-A/I-E BD Biosciences Cat# 563415, clone M5/114.15.2 Monoclonal Armenian Hamster anti-TCRβ BioLegend Cat# 109230, clone H57-597 Purified rat antiCD16/CD32 block BD Biosciences Cat# 553142, clone 2.4G2 Equipment Source iQ5 Real-Time PCR Detection System Bio-Rad CFX384 Touch RealTime PCR Detection System Bio-Rad SPECTROstar BMG Labtech Varioskan Lux ThermoFisher Scientific TissueLyser II Qiagen Biopulverizer Biospec Products Homogenizer PT1200 E Polytron Flow cytometer LSRII BD Biosciences Software Source Prism 9 GraphPad Illustrator 2023 Adobe CFX Maestro Bio-Rad FlowJo, version 9.9.6 and v10.7.1 BD Biosciences FACSDiva, version 8.0 BD Biosciences

    Article Title: Treponema pallidum promotes macrophage polarization and activates the NLRP3 inflammasome pathway to induce interleukin-1β production.
    Article Snippet: Inhibitory effects of cathepsin B, ROS, K+, and caspase-1 and their impact on IL-1β expression M0 macrophages were preincubated for 30 min with various inhibitors, namely, 25 mM N-acetylcysteine (NAC) (a ROS inhibitor; Sigma-Aldrich, St. Louis, MO, USA), 30 mM CA074-Me (a cathepsin B inhibitor; Calbiochem, San Diego, CA, USA), 100 mM KCl (a potassium channel inhibitor; Sigma, St. Louis, MO, USA), or 2 μM N-benzyloxycarbonyl-Val-Ala-Asp(O-methyl)-fluoromethyl ketone (Z-VAD-FMK; a caspase-1 inhibitor; Invitrogen Inc., USA).

    Article Title: Fluid shear-induced cathepsin B release in the control of Mac1-dependent neutrophil adhesion
    Article Snippet: Experiments were conducted with cell populations treated with and without 30 μM E64 (cysteine protease inhibitor; Sigma-Aldrich), 50 μM CA074-me (ctsB inhibitor; EMD Millipore, Billerica, MA), or 5 μM AP (negative control inhibitor; Sigma-Aldrich) for 5 min before shear exposure, as reported [ 17 ].

    Article Title: Treponema pallidum promotes macrophage polarization and activates the NLRP3 inflammasome pathway to induce interleukin-1β production
    Article Snippet: M0 macrophages were preincubated for 30 min with various inhibitors, namely, 25 mM N-acetylcysteine (NAC) (a ROS inhibitor; Sigma-Aldrich, St. Louis, MO, USA), 30 mM CA074-Me (a cathepsin B inhibitor; Calbiochem, San Diego, CA, USA), 100 mM KCl (a potassium channel inhibitor; Sigma, St. Louis, MO, USA), or 2 μM N -benzyloxycarbonyl-Val-Ala-Asp( O -methyl)-fluoromethyl ketone (Z-VAD-FMK; a caspase-1 inhibitor; Invitrogen Inc., USA).

    Article Title: Functional inhibition of acid sphingomyelinase disrupts infection by intracellular bacterial pathogens
    Article Snippet: Language Please check spelling and correct notat ion part icularly of chemicals throughout the text , for example: Line 517f: Spelling mistakes: Hoeschst 33342 should be Hoechst amitrypt iline (MilliporeSigma) should be amitriptyline nortrypt iline (MilliporeSigma)should be nortriptyline Ca074-Me (MilliporeSigma) should be CA-074 Me Bodipy (e.g. figures 4D, E) should be consistent ly BODIPY 1st Authors' Response to Reviewers: March 5, 2019 March 5, 2019 RE: Response to reviewer comments for manuscript LSA-2018-00292-TR Dear Reviewers: We hereby resubmit our manuscript, “Functional inhibition of acid sphingomyelinase disrupts infection by intracellular bacterial pathogens” (LSA-2018-00292-TR) for your consideration for publication in Life Science Alliance.

    Article Title: Protective mechanisms of CA074-me (other than cathepsin-B inhibition) against programmed necrosis induced by global cerebral ischemia/reperfusion injury in rats.
    Article Snippet: Many studies have demonstrated the key role of lysosomes in ischemic cell death in the brain and have led to the “lysosomocentric” hypothesis.. In this hypothesis, the release of cathepsin-B due to a change of lysosomal membrane permeabilization (LMP) or rupture is critical, and this can be prevented by its inhibitors CA074 and CA074-me.. However, the role of CA074-me in neuronal death and its effect on the change of lysosomal membrane integrity after global cerebral ischemia/reperfusion (I/R) injury is not clear, so we investigated this here.

    Article Title: Lysophosphatidylcholine Induces NLRP3 Inflammasome-Mediated Foam Cell Formation and Pyroptosis in Human Monocytes and Endothelial Cells
    Article Snippet: Depending on the assay, the cells were also treated with pharmacological inhibitors: N -acetyl- l -cysteine (NAC), 5 mM (Sigma-Aldrich); Ac-YVAD-cho, 20 μM (Enzo Life Sciences); glyburide, 150 μM (Sigma-Aldrich); CA074-ME, 50 μM (Sigma-Aldrich); statin, 25 μM (Sigma-Aldrich); GW9662, 1 μM (Sigma-Aldrich); methyl-beta-cyclodextrin, 10 μM (Sigma-Aldrich); and PAb-hTLR2, 10 μg/ml (InvivoGen).

    Article Title: Functional inhibition of acid sphingomyelinase disrupts infection by intracellular bacterial pathogens
    Article Snippet: Ca074-Me (MilliporeSigma) should be CA-074 Me RESPONSE: Thank you for noting this error, which has now been corrected throughout.



    Similar Products

    ca074-me  (Millipore)
    90
    Millipore ca074-me
    Ca074 Me, supplied by Millipore, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/ca074-me/ca+074/pmc11389378__mbio__00384___24___s0007-4-0-1
    Average 90 stars, based on 1 article reviews
    ca074-me - by Bioz Stars, 2026-10
    90/100 stars
    		  Buy from Supplier
    ca074 me  (MedChemExpress)
    95
    MedChemExpress ca074 me
    Ca074 Me, supplied by MedChemExpress, used in various techniques. Bioz Stars score: 95/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/ca074-me/CA-074+methyl+ester/pmc11570319-33-0-2
    Average 95 stars, based on 1 article reviews
    ca074 me - by Bioz Stars, 2026-10
    95/100 stars
    		  Buy from Supplier
    ca074-me  (Selleck Chemicals)
    90
    Selleck Chemicals ca074-me
    Ca074 Me, supplied by Selleck Chemicals, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/ca074-me/ca+074me/pm38295720-61-29-34
    Average 90 stars, based on 1 article reviews
    ca074-me - by Bioz Stars, 2026-10
    90/100 stars
    		  Buy from Supplier
    ca074- me  (Selleck Chemicals)
    90
    Selleck Chemicals ca074- me
    Ca074 Me, supplied by Selleck Chemicals, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/ca074-me/ca+074me/pm37753942-56-2-14
    Average 90 stars, based on 1 article reviews
    ca074- me - by Bioz Stars, 2026-10
    90/100 stars
    		  Buy from Supplier
    ca074 me  (Selleck Chemicals)
    93
    Selleck Chemicals ca074 me
    Ca074 Me, supplied by Selleck Chemicals, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/ca074-me/CA-074+methyl+ester/pm37315523-266-14-16
    Average 93 stars, based on 1 article reviews
    ca074 me - by Bioz Stars, 2026-10
    93/100 stars
    		  Buy from Supplier
    ca074  (MedChemExpress)
    95
    MedChemExpress ca074
    Ca074, supplied by MedChemExpress, used in various techniques. Bioz Stars score: 95/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/ca074-me/CA-074/pm37154515-30-34-36
    Average 95 stars, based on 1 article reviews
    ca074 - by Bioz Stars, 2026-10
    95/100 stars
    		  Buy from Supplier
    ca074-me  (Enzo Biochem)
    90
    Enzo Biochem ca074-me
    To block lysosomal acidification we used bafilomycin A1 (BafA1). A, LN-308 or LNT-229 cells were co-treated with 10 nM BafA1 and 10 µM B10 under hypoxic conditions (1% O 2 ) for 48 h. Cell density was assessed by CV (n = 4, SD, *p<0.05). B, cell death was quantified by LDH-release after treating LN-308 or LNT-229 cells with BafA1 and B10 under hypoxic conditions (0.1% O 2 ) for 19 h (LN-308) or 27 h (LNT-229) (n = 4, SD, * = p<0.05). To inhibit cathepsin B we used the cathepsin inhibitor <t>CA074-Me.</t> C, LN-308 or LNT-229 cells were co-treated with 10 µM CA074-Me and 10 µM B10 under hypoxic conditions (1% O 2 ) for 48 h. Cell density was assessed by CV (n = 4, SD, *p<0.05). D, cell death was quantified by LDH release after treating LN-308 or LNT-229 cells with CA074-Me and B10 under hypoxic conditions (0.1% O 2 ) for 19 h (LN-308) or 25 h (LNT-229) (n = 4, SD, *p<0.05).
    Ca074 Me, supplied by Enzo Biochem, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/ca074-me/mitotempo/pmc03990545-36-0-4
    Average 90 stars, based on 1 article reviews
    ca074-me - by Bioz Stars, 2026-10
    90/100 stars
    		  Buy from Supplier
    ca074-me me (n-(l-3-trans-propylcarbonyl-oxirane-2-carbonyl)-l-isoleucyl-l-proline methyl ester)  (Enzo Biochem)
    90
    Enzo Biochem ca074-me me (n-(l-3-trans-propylcarbonyl-oxirane-2-carbonyl)-l-isoleucyl-l-proline methyl ester)
    To block lysosomal acidification we used bafilomycin A1 (BafA1). A, LN-308 or LNT-229 cells were co-treated with 10 nM BafA1 and 10 µM B10 under hypoxic conditions (1% O 2 ) for 48 h. Cell density was assessed by CV (n = 4, SD, *p<0.05). B, cell death was quantified by LDH-release after treating LN-308 or LNT-229 cells with BafA1 and B10 under hypoxic conditions (0.1% O 2 ) for 19 h (LN-308) or 27 h (LNT-229) (n = 4, SD, * = p<0.05). To inhibit cathepsin B we used the cathepsin inhibitor <t>CA074-Me.</t> C, LN-308 or LNT-229 cells were co-treated with 10 µM CA074-Me and 10 µM B10 under hypoxic conditions (1% O 2 ) for 48 h. Cell density was assessed by CV (n = 4, SD, *p<0.05). D, cell death was quantified by LDH release after treating LN-308 or LNT-229 cells with CA074-Me and B10 under hypoxic conditions (0.1% O 2 ) for 19 h (LN-308) or 25 h (LNT-229) (n = 4, SD, *p<0.05).
    Ca074 Me Me (N (L 3 Trans Propylcarbonyl Oxirane 2 Carbonyl) L Isoleucyl L Proline Methyl Ester), supplied by Enzo Biochem, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/ca074-me/mitotempo/pmc09731969-210-17-27
    Average 90 stars, based on 1 article reviews
    ca074-me me (n-(l-3-trans-propylcarbonyl-oxirane-2-carbonyl)-l-isoleucyl-l-proline methyl ester) - by Bioz Stars, 2026-10
    90/100 stars
    		  Buy from Supplier

    Image Search Results


    To block lysosomal acidification we used bafilomycin A1 (BafA1). A, LN-308 or LNT-229 cells were co-treated with 10 nM BafA1 and 10 µM B10 under hypoxic conditions (1% O 2 ) for 48 h. Cell density was assessed by CV (n = 4, SD, *p<0.05). B, cell death was quantified by LDH-release after treating LN-308 or LNT-229 cells with BafA1 and B10 under hypoxic conditions (0.1% O 2 ) for 19 h (LN-308) or 27 h (LNT-229) (n = 4, SD, * = p<0.05). To inhibit cathepsin B we used the cathepsin inhibitor CA074-Me. C, LN-308 or LNT-229 cells were co-treated with 10 µM CA074-Me and 10 µM B10 under hypoxic conditions (1% O 2 ) for 48 h. Cell density was assessed by CV (n = 4, SD, *p<0.05). D, cell death was quantified by LDH release after treating LN-308 or LNT-229 cells with CA074-Me and B10 under hypoxic conditions (0.1% O 2 ) for 19 h (LN-308) or 25 h (LNT-229) (n = 4, SD, *p<0.05).

    Journal: PLoS ONE

    Article Title: Hypoxia Enhances the Antiglioma Cytotoxicity of B10, a Glycosylated Derivative of Betulinic Acid

    doi: 10.1371/journal.pone.0094921

    Figure Lengend Snippet: To block lysosomal acidification we used bafilomycin A1 (BafA1). A, LN-308 or LNT-229 cells were co-treated with 10 nM BafA1 and 10 µM B10 under hypoxic conditions (1% O 2 ) for 48 h. Cell density was assessed by CV (n = 4, SD, *p<0.05). B, cell death was quantified by LDH-release after treating LN-308 or LNT-229 cells with BafA1 and B10 under hypoxic conditions (0.1% O 2 ) for 19 h (LN-308) or 27 h (LNT-229) (n = 4, SD, * = p<0.05). To inhibit cathepsin B we used the cathepsin inhibitor CA074-Me. C, LN-308 or LNT-229 cells were co-treated with 10 µM CA074-Me and 10 µM B10 under hypoxic conditions (1% O 2 ) for 48 h. Cell density was assessed by CV (n = 4, SD, *p<0.05). D, cell death was quantified by LDH release after treating LN-308 or LNT-229 cells with CA074-Me and B10 under hypoxic conditions (0.1% O 2 ) for 19 h (LN-308) or 25 h (LNT-229) (n = 4, SD, *p<0.05).

    Article Snippet: CA074-Me was purchased from Enzo Life Sciences (Lörrach, Germany).

    Techniques: Blocking Assay

    Using a pLKO.1-based lentivirus LN-308 cathepsin B (CTSB) knockdown cells and control cells (non-targeting sequence, Scrsh) were generated. CTSB gene suppression was confirmed by qRT-PCR (A) and CTSB activity (B) (n = 3, SD, *p<0.05). The effect of the cathepsin inhibitor CA074-Me (10 µM) on cathepsin B activity in control cells (Scrsh) is shown in B. C, B10-mediated cytotoxicity under 0.1% O 2 in LN-308 control cells and CTSBsh cells was quantified by LDH-release assay (n = 4, SD, *p<0.05).

    Journal: PLoS ONE

    Article Title: Hypoxia Enhances the Antiglioma Cytotoxicity of B10, a Glycosylated Derivative of Betulinic Acid

    doi: 10.1371/journal.pone.0094921

    Figure Lengend Snippet: Using a pLKO.1-based lentivirus LN-308 cathepsin B (CTSB) knockdown cells and control cells (non-targeting sequence, Scrsh) were generated. CTSB gene suppression was confirmed by qRT-PCR (A) and CTSB activity (B) (n = 3, SD, *p<0.05). The effect of the cathepsin inhibitor CA074-Me (10 µM) on cathepsin B activity in control cells (Scrsh) is shown in B. C, B10-mediated cytotoxicity under 0.1% O 2 in LN-308 control cells and CTSBsh cells was quantified by LDH-release assay (n = 4, SD, *p<0.05).

    Article Snippet: CA074-Me was purchased from Enzo Life Sciences (Lörrach, Germany).

    Techniques: Sequencing, Generated, Quantitative RT-PCR, Activity Assay, Lactate Dehydrogenase Assay