Review



agr2 expression  (Novus Biologicals)


Bioz Verified Symbol Novus Biologicals is a verified supplier
Bioz Manufacturer Symbol Novus Biologicals manufactures this product  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 90

    Structured Review

    Novus Biologicals agr2 expression
    Patient demographics and <t> AGR2 expression </t> by subgroups
    Agr2 Expression, supplied by Novus Biologicals, used in various techniques. Bioz Stars score: 90/100, based on 7 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/agr2+expression/AG-2%2FAGR2+Antibody+-+BSA+Free/pmc04596313-88-0-11
    Average 90 stars, based on 7 article reviews
    agr2 expression - by Bioz Stars, 2026-10
    90/100 stars

    Images

    1) Product Images from "High expression of AGR2 in lung cancer is predictive of poor survival"

    Article Title: High expression of AGR2 in lung cancer is predictive of poor survival

    Journal: BMC Cancer

    doi: 10.1186/s12885-015-1658-2

    Patient demographics and  AGR2 expression  by subgroups
    Figure Legend Snippet: Patient demographics and AGR2 expression by subgroups

    Techniques Used: Expressing

    AGR2 staining intensity of lung tissue. Staining is scored by integrated intensity values on the vertical axis for the tissue types listed on the horizontal axis. Normal bronchial epithelium shows the strongest staining for AGR2. The number of tissue examples scored is indicated by n
    Figure Legend Snippet: AGR2 staining intensity of lung tissue. Staining is scored by integrated intensity values on the vertical axis for the tissue types listed on the horizontal axis. Normal bronchial epithelium shows the strongest staining for AGR2. The number of tissue examples scored is indicated by n

    Techniques Used: Staining

    AGR2 expression and tumor grade. The box plots show a decrease in integrated intensity values with increasing tumor grades (top panel). This correlation was not evident when separated by tumor types (middle panel for adenocarcinoma; bottom panel for squamous carcinoma). Adenocarcinoma grade 3 shows low staining intensity but squamous carcinoma shows higher staining intensity
    Figure Legend Snippet: AGR2 expression and tumor grade. The box plots show a decrease in integrated intensity values with increasing tumor grades (top panel). This correlation was not evident when separated by tumor types (middle panel for adenocarcinoma; bottom panel for squamous carcinoma). Adenocarcinoma grade 3 shows low staining intensity but squamous carcinoma shows higher staining intensity

    Techniques Used: Expressing, Staining

    AGR2 expression in primary vs . metastatic sites. No significant differences in AGR2 expression was seen in primary, lymph node metastasis, and distant metastasis. This applied to adenocarcinomas, squamous carcinomas and large cell carcinomas
    Figure Legend Snippet: AGR2 expression in primary vs . metastatic sites. No significant differences in AGR2 expression was seen in primary, lymph node metastasis, and distant metastasis. This applied to adenocarcinomas, squamous carcinomas and large cell carcinomas

    Techniques Used: Expressing

    AGR2 immunostaining of lung epithelial cells. Shown are examples of lung epithelial cells stained for AGR2: a , normal bronchiolar epithelium; b , bronchioloalveolar carcinoma, mucinous type; c , moderately differentiated adenocarcinoma; d , moderately differentiated squamous carcinoma; e , poorly differentiated adenocarcinoma; f , large cell carcinoma
    Figure Legend Snippet: AGR2 immunostaining of lung epithelial cells. Shown are examples of lung epithelial cells stained for AGR2: a , normal bronchiolar epithelium; b , bronchioloalveolar carcinoma, mucinous type; c , moderately differentiated adenocarcinoma; d , moderately differentiated squamous carcinoma; e , poorly differentiated adenocarcinoma; f , large cell carcinoma

    Techniques Used: Immunostaining, Staining

    High vs . low tumor  AGR2 expression.  The percentages of tissue cores showing low vs . high integrated intensity values for the different tumor grades in adenocarcinoma and squamous carcinoma are tabulated
    Figure Legend Snippet: High vs . low tumor AGR2 expression. The percentages of tissue cores showing low vs . high integrated intensity values for the different tumor grades in adenocarcinoma and squamous carcinoma are tabulated

    Techniques Used: Expressing

    High vs . low tumor  AGR2 expression.  The percentages of tissue cores showing low vs . high integrated intensity values for the different tumor grades in adenocarcinoma and squamous carcinoma are tabulated
    Figure Legend Snippet: High vs . low tumor AGR2 expression. The percentages of tissue cores showing low vs . high integrated intensity values for the different tumor grades in adenocarcinoma and squamous carcinoma are tabulated

    Techniques Used: Expressing

    AGR2 expression and smoking status. Non-smokers had on average slightly higher levels than smokers
    Figure Legend Snippet: AGR2 expression and smoking status. Non-smokers had on average slightly higher levels than smokers

    Techniques Used: Expressing

    Kaplan-Meier survival plot for AGR2 expression levels. For patients under 65, high tumor AGR2 expression is correlated with a poorer survival than low tumor AGR2 expression
    Figure Legend Snippet: Kaplan-Meier survival plot for AGR2 expression levels. For patients under 65, high tumor AGR2 expression is correlated with a poorer survival than low tumor AGR2 expression

    Techniques Used: Expressing

    Multivariate cox model for younger patients including  AGR2,  tumor stage, grade and patient age
    Figure Legend Snippet: Multivariate cox model for younger patients including AGR2, tumor stage, grade and patient age

    Techniques Used:

    Related Articles

    Expressing:

    Article Title: High expression of AGR2 in lung cancer is predictive of poor survival
    Article Snippet: .. AGR2 expression was evaluated on the TMA with NB110-17780 rabbit polyclonal (Novus Biologicals) at 2 μg/ml concentration as described [ ]. .. Specific staining was detected by applying anti-rabbit horseradish peroxidase-conjugated secondary antibody and Vector ABC (Vector Laboratories, Burlingame, CA).

    Concentration Assay:

    Article Title: High expression of AGR2 in lung cancer is predictive of poor survival
    Article Snippet: .. AGR2 expression was evaluated on the TMA with NB110-17780 rabbit polyclonal (Novus Biologicals) at 2 μg/ml concentration as described [ ]. .. Specific staining was detected by applying anti-rabbit horseradish peroxidase-conjugated secondary antibody and Vector ABC (Vector Laboratories, Burlingame, CA).



    Similar Products

    90
    Bio-Techne corporation ag-2/agr2 antibody - bsa free
    Ag 2/Agr2 Antibody Bsa Free, supplied by Bio-Techne corporation, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/agr2+expression/AG-2%2FAGR2+Antibody+-+BSA+Free/bio-techne+corporation___nb110-17780
    Average 90 stars, based on 1 article reviews
    ag-2/agr2 antibody - bsa free - by Bioz Stars, 2026-10
    90/100 stars
      Buy from Supplier

    90
    OriGene details hanbio n a recombinant dna agr2wt expression vector origene technologies
    Details Hanbio N A Recombinant Dna Agr2wt Expression Vector Origene Technologies, supplied by OriGene, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/agr2+expression/AGR2+Human+shRNA+Plasmid+Kit/pmc11866503__mmc2-231-271-279
    Average 90 stars, based on 1 article reviews
    details hanbio n a recombinant dna agr2wt expression vector origene technologies - by Bioz Stars, 2026-10
    90/100 stars
      Buy from Supplier

    93
    OriGene human wild type agr2 expression vector
    Figure 1. Secreted <t>AGR2</t> promotes pancreatic carcinogenesis by activating CAFs (A) Representative immunohistochemical (IHC) images demonstrate AGR2-positive and -negative PDAC tumors (scale bars: 50 mm). (B) Survival curves of patients categorized by AGR2 expression in PDAC tumor samples via IHC (n = 99). (C) Survival curves of patients stratified according to median AGR2 levels, measured by ELISA, in serum from individuals with PDAC (n = 172). (D) Western blot analyses of AGR2 expression in human PDAC cell lines (Capan2 and Panc1) following CRISPR-Cas9-mediated AGR2 knockout (performed in triplicate). (E) Images and volumes of control versus AGR2-knockout subcutaneous xenografts derived from Capan2 and Panc1 cell lines in nude mice (n = 5 per group). (F) Subcutaneous xenografts from AGR2-knockout Capan2 and Panc1 cells (AGR2KO), following re-expression of wild-type AGR2 <t>(AGR2WT),</t> AGR2 lacking a nuclear localization signal (AGR2DNLS), and AGR2 lacking a signal peptide (AGR2DSP) (n = 4 per group).
    Human Wild Type Agr2 Expression Vector, supplied by OriGene, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/agr2+expression/AGR2+(NM_006408)+Human+Tagged+ORF+Clone/pm39914384-295-0-10
    Average 93 stars, based on 1 article reviews
    human wild type agr2 expression vector - by Bioz Stars, 2026-10
    93/100 stars
      Buy from Supplier

    90
    Genechem plasmids expressing myc- agr2
    Identification of ubiquitination modification molecules associated with prognosis. (A) The intersection of prognostic molecules in TCGA-LUAD, GSE3141, GSE31210, GSE11969, GSE30219, and GSE50081 datasets were visualized using UpSet plots. The red-boxed genes represent molecules with prognostic differences in at least 3 datasets. (B) The 53 genes in the intersection were arranged based on their intersection numbers, with the specific gene symbols arranged from left to right in descending order of intersection number: 6, 5, 4, and 3. (C) Three genes were identified as intersections in 4 datasets, namely FGR , <t>PSMD14</t> , and ZBTB16 . (D) The expression differences of FGR, PSMD14 , and ZBTB16 genes in the GSE11969, GSE31210, GSE32863, and GSE118370 datasets. (E-H) The cellular localization of FGR , PSMD14 , and ZBTB16 gene expressions in GSE117570, GSE123902, GSE131907 and GSE149655. (I) Differences in the expression of FGR, PSMD14 , and ZBTB16 genes between malignant cells and normal epithelial cells in GSE117570, GSE123902, GSE131907 and GSE149655. *, P<0.05; **, P<0.01; ***, P<0.001. TCGA-LUAD, The Cancer Genome Atlas-lung adenocarcinoma; tSNE, t-distributed stochastic neighbor embedding.
    Plasmids Expressing Myc Agr2, supplied by Genechem, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/agr2+expression/lentivirus+vectors+containing+sh+agr2/pmc10407523-126-2-13
    Average 90 stars, based on 1 article reviews
    plasmids expressing myc- agr2 - by Bioz Stars, 2026-10
    90/100 stars
      Buy from Supplier

    90
    Proteostasis Therapeutics cell lines with stable expression of agr2 wild-type
    Identification of ubiquitination modification molecules associated with prognosis. (A) The intersection of prognostic molecules in TCGA-LUAD, GSE3141, GSE31210, GSE11969, GSE30219, and GSE50081 datasets were visualized using UpSet plots. The red-boxed genes represent molecules with prognostic differences in at least 3 datasets. (B) The 53 genes in the intersection were arranged based on their intersection numbers, with the specific gene symbols arranged from left to right in descending order of intersection number: 6, 5, 4, and 3. (C) Three genes were identified as intersections in 4 datasets, namely FGR , <t>PSMD14</t> , and ZBTB16 . (D) The expression differences of FGR, PSMD14 , and ZBTB16 genes in the GSE11969, GSE31210, GSE32863, and GSE118370 datasets. (E-H) The cellular localization of FGR , PSMD14 , and ZBTB16 gene expressions in GSE117570, GSE123902, GSE131907 and GSE149655. (I) Differences in the expression of FGR, PSMD14 , and ZBTB16 genes between malignant cells and normal epithelial cells in GSE117570, GSE123902, GSE131907 and GSE149655. *, P<0.05; **, P<0.01; ***, P<0.001. TCGA-LUAD, The Cancer Genome Atlas-lung adenocarcinoma; tSNE, t-distributed stochastic neighbor embedding.
    Cell Lines With Stable Expression Of Agr2 Wild Type, supplied by Proteostasis Therapeutics, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/agr2+expression/cell+lines+with+stable+expression+of+agr2+wild+type/pm37175601-189-20-6
    Average 90 stars, based on 1 article reviews
    cell lines with stable expression of agr2 wild-type - by Bioz Stars, 2026-10
    90/100 stars
      Buy from Supplier

    93
    OriGene human wt agr2 expression vector
    Identification of ubiquitination modification molecules associated with prognosis. (A) The intersection of prognostic molecules in TCGA-LUAD, GSE3141, GSE31210, GSE11969, GSE30219, and GSE50081 datasets were visualized using UpSet plots. The red-boxed genes represent molecules with prognostic differences in at least 3 datasets. (B) The 53 genes in the intersection were arranged based on their intersection numbers, with the specific gene symbols arranged from left to right in descending order of intersection number: 6, 5, 4, and 3. (C) Three genes were identified as intersections in 4 datasets, namely FGR , <t>PSMD14</t> , and ZBTB16 . (D) The expression differences of FGR, PSMD14 , and ZBTB16 genes in the GSE11969, GSE31210, GSE32863, and GSE118370 datasets. (E-H) The cellular localization of FGR , PSMD14 , and ZBTB16 gene expressions in GSE117570, GSE123902, GSE131907 and GSE149655. (I) Differences in the expression of FGR, PSMD14 , and ZBTB16 genes between malignant cells and normal epithelial cells in GSE117570, GSE123902, GSE131907 and GSE149655. *, P<0.05; **, P<0.01; ***, P<0.001. TCGA-LUAD, The Cancer Genome Atlas-lung adenocarcinoma; tSNE, t-distributed stochastic neighbor embedding.
    Human Wt Agr2 Expression Vector, supplied by OriGene, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/agr2+expression/AGR2+(NM_006408)+Human+Tagged+ORF+Clone/pm34303658-399-0-14
    Average 93 stars, based on 1 article reviews
    human wt agr2 expression vector - by Bioz Stars, 2026-10
    93/100 stars
      Buy from Supplier

    90
    OriGene mouse wt agr2 expression vector
    Identification of ubiquitination modification molecules associated with prognosis. (A) The intersection of prognostic molecules in TCGA-LUAD, GSE3141, GSE31210, GSE11969, GSE30219, and GSE50081 datasets were visualized using UpSet plots. The red-boxed genes represent molecules with prognostic differences in at least 3 datasets. (B) The 53 genes in the intersection were arranged based on their intersection numbers, with the specific gene symbols arranged from left to right in descending order of intersection number: 6, 5, 4, and 3. (C) Three genes were identified as intersections in 4 datasets, namely FGR , <t>PSMD14</t> , and ZBTB16 . (D) The expression differences of FGR, PSMD14 , and ZBTB16 genes in the GSE11969, GSE31210, GSE32863, and GSE118370 datasets. (E-H) The cellular localization of FGR , PSMD14 , and ZBTB16 gene expressions in GSE117570, GSE123902, GSE131907 and GSE149655. (I) Differences in the expression of FGR, PSMD14 , and ZBTB16 genes between malignant cells and normal epithelial cells in GSE117570, GSE123902, GSE131907 and GSE149655. *, P<0.05; **, P<0.01; ***, P<0.001. TCGA-LUAD, The Cancer Genome Atlas-lung adenocarcinoma; tSNE, t-distributed stochastic neighbor embedding.
    Mouse Wt Agr2 Expression Vector, supplied by OriGene, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/agr2+expression/Agr2+(NM_011783)+Mouse+Tagged+ORF+Clone/pm34303658-409-0-14
    Average 90 stars, based on 1 article reviews
    mouse wt agr2 expression vector - by Bioz Stars, 2026-10
    90/100 stars
      Buy from Supplier

    90
    OriGene myc-ddk-tagged agr2 cdna cloned into pcmv6 expression vector
    Identification of ubiquitination modification molecules associated with prognosis. (A) The intersection of prognostic molecules in TCGA-LUAD, GSE3141, GSE31210, GSE11969, GSE30219, and GSE50081 datasets were visualized using UpSet plots. The red-boxed genes represent molecules with prognostic differences in at least 3 datasets. (B) The 53 genes in the intersection were arranged based on their intersection numbers, with the specific gene symbols arranged from left to right in descending order of intersection number: 6, 5, 4, and 3. (C) Three genes were identified as intersections in 4 datasets, namely FGR , <t>PSMD14</t> , and ZBTB16 . (D) The expression differences of FGR, PSMD14 , and ZBTB16 genes in the GSE11969, GSE31210, GSE32863, and GSE118370 datasets. (E-H) The cellular localization of FGR , PSMD14 , and ZBTB16 gene expressions in GSE117570, GSE123902, GSE131907 and GSE149655. (I) Differences in the expression of FGR, PSMD14 , and ZBTB16 genes between malignant cells and normal epithelial cells in GSE117570, GSE123902, GSE131907 and GSE149655. *, P<0.05; **, P<0.01; ***, P<0.001. TCGA-LUAD, The Cancer Genome Atlas-lung adenocarcinoma; tSNE, t-distributed stochastic neighbor embedding.
    Myc Ddk Tagged Agr2 Cdna Cloned Into Pcmv6 Expression Vector, supplied by OriGene, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/agr2+expression/CDK1+(NM_001170407)+Human+Tagged+ORF+Clone/pm30295739-83-0-11
    Average 90 stars, based on 1 article reviews
    myc-ddk-tagged agr2 cdna cloned into pcmv6 expression vector - by Bioz Stars, 2026-10
    90/100 stars
      Buy from Supplier

    90
    Novus Biologicals agr2 expression
    Patient demographics and <t> AGR2 expression </t> by subgroups
    Agr2 Expression, supplied by Novus Biologicals, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/agr2+expression/AG-2%2FAGR2+Antibody+-+BSA+Free/pmc04596313-88-0-11
    Average 90 stars, based on 1 article reviews
    agr2 expression - by Bioz Stars, 2026-10
    90/100 stars
      Buy from Supplier

    Image Search Results


    Figure 1. Secreted AGR2 promotes pancreatic carcinogenesis by activating CAFs (A) Representative immunohistochemical (IHC) images demonstrate AGR2-positive and -negative PDAC tumors (scale bars: 50 mm). (B) Survival curves of patients categorized by AGR2 expression in PDAC tumor samples via IHC (n = 99). (C) Survival curves of patients stratified according to median AGR2 levels, measured by ELISA, in serum from individuals with PDAC (n = 172). (D) Western blot analyses of AGR2 expression in human PDAC cell lines (Capan2 and Panc1) following CRISPR-Cas9-mediated AGR2 knockout (performed in triplicate). (E) Images and volumes of control versus AGR2-knockout subcutaneous xenografts derived from Capan2 and Panc1 cell lines in nude mice (n = 5 per group). (F) Subcutaneous xenografts from AGR2-knockout Capan2 and Panc1 cells (AGR2KO), following re-expression of wild-type AGR2 (AGR2WT), AGR2 lacking a nuclear localization signal (AGR2DNLS), and AGR2 lacking a signal peptide (AGR2DSP) (n = 4 per group).

    Journal: Cell reports. Medicine

    Article Title: Disrupting AGR2/IGF1 paracrine and reciprocal signaling for pancreatic cancer therapy.

    doi: 10.1016/j.xcrm.2024.101927

    Figure Lengend Snippet: Figure 1. Secreted AGR2 promotes pancreatic carcinogenesis by activating CAFs (A) Representative immunohistochemical (IHC) images demonstrate AGR2-positive and -negative PDAC tumors (scale bars: 50 mm). (B) Survival curves of patients categorized by AGR2 expression in PDAC tumor samples via IHC (n = 99). (C) Survival curves of patients stratified according to median AGR2 levels, measured by ELISA, in serum from individuals with PDAC (n = 172). (D) Western blot analyses of AGR2 expression in human PDAC cell lines (Capan2 and Panc1) following CRISPR-Cas9-mediated AGR2 knockout (performed in triplicate). (E) Images and volumes of control versus AGR2-knockout subcutaneous xenografts derived from Capan2 and Panc1 cell lines in nude mice (n = 5 per group). (F) Subcutaneous xenografts from AGR2-knockout Capan2 and Panc1 cells (AGR2KO), following re-expression of wild-type AGR2 (AGR2WT), AGR2 lacking a nuclear localization signal (AGR2DNLS), and AGR2 lacking a signal peptide (AGR2DSP) (n = 4 per group).

    Article Snippet: Human wild-type AGR2 expression vector (AGR2WT, RC202023) was purchased from OriGene Technologies (Beijing, China).

    Techniques: Immunohistochemical staining, Expressing, Enzyme-linked Immunosorbent Assay, Western Blot, CRISPR, Knock-Out, Control, Derivative Assay

    Identification of ubiquitination modification molecules associated with prognosis. (A) The intersection of prognostic molecules in TCGA-LUAD, GSE3141, GSE31210, GSE11969, GSE30219, and GSE50081 datasets were visualized using UpSet plots. The red-boxed genes represent molecules with prognostic differences in at least 3 datasets. (B) The 53 genes in the intersection were arranged based on their intersection numbers, with the specific gene symbols arranged from left to right in descending order of intersection number: 6, 5, 4, and 3. (C) Three genes were identified as intersections in 4 datasets, namely FGR , PSMD14 , and ZBTB16 . (D) The expression differences of FGR, PSMD14 , and ZBTB16 genes in the GSE11969, GSE31210, GSE32863, and GSE118370 datasets. (E-H) The cellular localization of FGR , PSMD14 , and ZBTB16 gene expressions in GSE117570, GSE123902, GSE131907 and GSE149655. (I) Differences in the expression of FGR, PSMD14 , and ZBTB16 genes between malignant cells and normal epithelial cells in GSE117570, GSE123902, GSE131907 and GSE149655. *, P<0.05; **, P<0.01; ***, P<0.001. TCGA-LUAD, The Cancer Genome Atlas-lung adenocarcinoma; tSNE, t-distributed stochastic neighbor embedding.

    Journal: Journal of Thoracic Disease

    Article Title: Bioinformatics analysis and single-cell RNA sequencing: elucidating the ubiquitination pathways and key enzymes in lung adenocarcinoma

    doi: 10.21037/jtd-23-795

    Figure Lengend Snippet: Identification of ubiquitination modification molecules associated with prognosis. (A) The intersection of prognostic molecules in TCGA-LUAD, GSE3141, GSE31210, GSE11969, GSE30219, and GSE50081 datasets were visualized using UpSet plots. The red-boxed genes represent molecules with prognostic differences in at least 3 datasets. (B) The 53 genes in the intersection were arranged based on their intersection numbers, with the specific gene symbols arranged from left to right in descending order of intersection number: 6, 5, 4, and 3. (C) Three genes were identified as intersections in 4 datasets, namely FGR , PSMD14 , and ZBTB16 . (D) The expression differences of FGR, PSMD14 , and ZBTB16 genes in the GSE11969, GSE31210, GSE32863, and GSE118370 datasets. (E-H) The cellular localization of FGR , PSMD14 , and ZBTB16 gene expressions in GSE117570, GSE123902, GSE131907 and GSE149655. (I) Differences in the expression of FGR, PSMD14 , and ZBTB16 genes between malignant cells and normal epithelial cells in GSE117570, GSE123902, GSE131907 and GSE149655. *, P<0.05; **, P<0.01; ***, P<0.001. TCGA-LUAD, The Cancer Genome Atlas-lung adenocarcinoma; tSNE, t-distributed stochastic neighbor embedding.

    Article Snippet: Plasmids expressing HA- PSMD14 , Myc- AGR2 , or His-Ub were procured from GeneChem.

    Techniques: Ubiquitin Proteomics, Modification, Expressing

    PSMD14 as a novel biomarker for survival prediction. (A) Differential expression of PSMD14 in tumor and normal tissues within TCGA-LUAD. (B-D) Kaplan-Meier curves were used to compare OS (B), PFS (C), and DSS (D) between patients with high and low expression of PSMD14 . (E) A prognostic nomogram encompassing variables such as age, sex, pathological stage, ethnicity, and PSMD14 expression was formulated as a clinical prediction model for evaluating patient outcomes. (F) Calibration curves representing clinical prediction models were constructed for the assessment of prognostic estimates, with 1-, 3-, and 5-year intervals included. RSEM, RNA-Seq by Expectation-Maximization; TCGA-LUAD, The Cancer Genome Atlas-lung adenocarcinoma; FDR, false discovery rate; OS, overall survival; PFS, progression-free survival; DSS, disease-specific survival.

    Journal: Journal of Thoracic Disease

    Article Title: Bioinformatics analysis and single-cell RNA sequencing: elucidating the ubiquitination pathways and key enzymes in lung adenocarcinoma

    doi: 10.21037/jtd-23-795

    Figure Lengend Snippet: PSMD14 as a novel biomarker for survival prediction. (A) Differential expression of PSMD14 in tumor and normal tissues within TCGA-LUAD. (B-D) Kaplan-Meier curves were used to compare OS (B), PFS (C), and DSS (D) between patients with high and low expression of PSMD14 . (E) A prognostic nomogram encompassing variables such as age, sex, pathological stage, ethnicity, and PSMD14 expression was formulated as a clinical prediction model for evaluating patient outcomes. (F) Calibration curves representing clinical prediction models were constructed for the assessment of prognostic estimates, with 1-, 3-, and 5-year intervals included. RSEM, RNA-Seq by Expectation-Maximization; TCGA-LUAD, The Cancer Genome Atlas-lung adenocarcinoma; FDR, false discovery rate; OS, overall survival; PFS, progression-free survival; DSS, disease-specific survival.

    Article Snippet: Plasmids expressing HA- PSMD14 , Myc- AGR2 , or His-Ub were procured from GeneChem.

    Techniques: Biomarker Discovery, Quantitative Proteomics, Expressing, Construct, RNA Sequencing

    Univariate and multivariate Cox analysis based on TCGA-LUAD

    Journal: Journal of Thoracic Disease

    Article Title: Bioinformatics analysis and single-cell RNA sequencing: elucidating the ubiquitination pathways and key enzymes in lung adenocarcinoma

    doi: 10.21037/jtd-23-795

    Figure Lengend Snippet: Univariate and multivariate Cox analysis based on TCGA-LUAD

    Article Snippet: Plasmids expressing HA- PSMD14 , Myc- AGR2 , or His-Ub were procured from GeneChem.

    Techniques: Expressing

    Elevated PSMD14 expression enhances the progression of lung adenocarcinoma. (A) RT-qPCR analysis revealed that the expression of PSMD14 was significantly elevated in LUAD tissues and cells compared to normal tissues and cells. (B) Western blot revealed an increase in the expression of PSMD14 protein in A549, H1299, and H358 compared to BEAS-2B. (C) Western blot revealed the expression of PSMD14 protein in LUAD tissues was significantly higher than that in paracancer tissues. (D) RT-qPCR indicated a knockdown efficiency greater than 50% in A549 and H1299 cells. (E) Western blot revealed the knockdown efficiency of PSMD14 in A549 and H1299 cells. (F) The CCK-8 assay showed the cell viability of both the PSMD14 knockdown and control groups, with results indicating a significant decrease in cell viability within the knockdown group. (G) Colony formation assay revealed a significant decrease in cell proliferation within the PSMD14 knockdown group according to crystal violet staining. (H,I) The cell scratch assay demonstrated a significant decrease in cell migration ability in the PSMD14 knockdown group compared to the control group in A549 (H) and H1299 (I) cells. Scale bar =200 µm. (J) Transwell invasion assay showed a significant decrease in cell invasion ability in the PSMD14 knockdown group compared to the control group according to crystal violet staining. Scale bar =200 µm. (K) Transwell migration assay showed a significant decrease in cell invasion ability in the PSMD14 knockdown group compared to the control group according to crystal violet staining. Scale bar =200 µm. (L) In vivo experiments revealed a significant reduction in tumor volume, growth rate, and weight within the PSMD14 group compared to the control group. *, P<0.05; **, P<0.01; ***, P<0.001. RT-qPCR, reverse-transcription quantitative polymerase chain reaction; LUAD, lung adenocarcinoma; CCK-8, Cell Counting Kit-8.

    Journal: Journal of Thoracic Disease

    Article Title: Bioinformatics analysis and single-cell RNA sequencing: elucidating the ubiquitination pathways and key enzymes in lung adenocarcinoma

    doi: 10.21037/jtd-23-795

    Figure Lengend Snippet: Elevated PSMD14 expression enhances the progression of lung adenocarcinoma. (A) RT-qPCR analysis revealed that the expression of PSMD14 was significantly elevated in LUAD tissues and cells compared to normal tissues and cells. (B) Western blot revealed an increase in the expression of PSMD14 protein in A549, H1299, and H358 compared to BEAS-2B. (C) Western blot revealed the expression of PSMD14 protein in LUAD tissues was significantly higher than that in paracancer tissues. (D) RT-qPCR indicated a knockdown efficiency greater than 50% in A549 and H1299 cells. (E) Western blot revealed the knockdown efficiency of PSMD14 in A549 and H1299 cells. (F) The CCK-8 assay showed the cell viability of both the PSMD14 knockdown and control groups, with results indicating a significant decrease in cell viability within the knockdown group. (G) Colony formation assay revealed a significant decrease in cell proliferation within the PSMD14 knockdown group according to crystal violet staining. (H,I) The cell scratch assay demonstrated a significant decrease in cell migration ability in the PSMD14 knockdown group compared to the control group in A549 (H) and H1299 (I) cells. Scale bar =200 µm. (J) Transwell invasion assay showed a significant decrease in cell invasion ability in the PSMD14 knockdown group compared to the control group according to crystal violet staining. Scale bar =200 µm. (K) Transwell migration assay showed a significant decrease in cell invasion ability in the PSMD14 knockdown group compared to the control group according to crystal violet staining. Scale bar =200 µm. (L) In vivo experiments revealed a significant reduction in tumor volume, growth rate, and weight within the PSMD14 group compared to the control group. *, P<0.05; **, P<0.01; ***, P<0.001. RT-qPCR, reverse-transcription quantitative polymerase chain reaction; LUAD, lung adenocarcinoma; CCK-8, Cell Counting Kit-8.

    Article Snippet: Plasmids expressing HA- PSMD14 , Myc- AGR2 , or His-Ub were procured from GeneChem.

    Techniques: Expressing, Quantitative RT-PCR, Western Blot, Knockdown, CCK-8 Assay, Control, Colony Assay, Staining, Wound Healing Assay, Migration, Transwell Invasion Assay, Transwell Migration Assay, In Vivo, Reverse Transcription, Real-time Polymerase Chain Reaction, Cell Counting

    AGR2 protein stability is regulated by PSMD14 via deubiquitination. (A) The HA- PSMD14 and Myc- AGR2 plasmids were cotransfected into HEK-293T cells, followed by the immunoprecipitation of cell lysates using either anti-HA or anti-Myc antibodies. (B) Immunoprecipitation of A549 and H1299 cell lysates was performed using anti- PSMD14 and anti- AGR2 antibodies, followed by analysis via immunoblotting, with the IgG antibody serving as a control. (C) Western blot showed a significant decrease in the level of AGR2 protein following PSMD14 knockdown. (D) Western blot showed the level of AGR2 protein increased following PSMD14 overexpression. (E) Western blot revealed that treatment with MG132 resulted in the reversal of AGR2 protein level decrease caused by PSMD14 knockdown. (F) The left panel shows the Western blot result of AGR2 protein levels in PSMD14 knockdown and control cells at 0, 3, 6, and 12 hours after CHX treatment. The right panel shows the corresponding AGR2 protein degradation rates between the two groups. (G) The left panel shows the Western blot result of AGR2 protein levels in PSMD14 overexpression and control cells at 0, 3, 6, and 12 hours after CHX treatment. The right panel shows the corresponding AGR2 protein degradation rates between the two groups. (H) Western blotting showed that PSMD14 knockdown increased the ubiquitin level of AGR2 protein compared to the control group. (I) Western blotting showed that PSMD14 overexpression decreased the ubiquitin level of AGR2 protein compared to the control group. ***, P<0.001. HA, YPYDVPDYA; Myc, EQKLISEEDL; IP, immunoprecipitation; IgG, immunoglobulin G; CHX, cycloheximide.

    Journal: Journal of Thoracic Disease

    Article Title: Bioinformatics analysis and single-cell RNA sequencing: elucidating the ubiquitination pathways and key enzymes in lung adenocarcinoma

    doi: 10.21037/jtd-23-795

    Figure Lengend Snippet: AGR2 protein stability is regulated by PSMD14 via deubiquitination. (A) The HA- PSMD14 and Myc- AGR2 plasmids were cotransfected into HEK-293T cells, followed by the immunoprecipitation of cell lysates using either anti-HA or anti-Myc antibodies. (B) Immunoprecipitation of A549 and H1299 cell lysates was performed using anti- PSMD14 and anti- AGR2 antibodies, followed by analysis via immunoblotting, with the IgG antibody serving as a control. (C) Western blot showed a significant decrease in the level of AGR2 protein following PSMD14 knockdown. (D) Western blot showed the level of AGR2 protein increased following PSMD14 overexpression. (E) Western blot revealed that treatment with MG132 resulted in the reversal of AGR2 protein level decrease caused by PSMD14 knockdown. (F) The left panel shows the Western blot result of AGR2 protein levels in PSMD14 knockdown and control cells at 0, 3, 6, and 12 hours after CHX treatment. The right panel shows the corresponding AGR2 protein degradation rates between the two groups. (G) The left panel shows the Western blot result of AGR2 protein levels in PSMD14 overexpression and control cells at 0, 3, 6, and 12 hours after CHX treatment. The right panel shows the corresponding AGR2 protein degradation rates between the two groups. (H) Western blotting showed that PSMD14 knockdown increased the ubiquitin level of AGR2 protein compared to the control group. (I) Western blotting showed that PSMD14 overexpression decreased the ubiquitin level of AGR2 protein compared to the control group. ***, P<0.001. HA, YPYDVPDYA; Myc, EQKLISEEDL; IP, immunoprecipitation; IgG, immunoglobulin G; CHX, cycloheximide.

    Article Snippet: Plasmids expressing HA- PSMD14 , Myc- AGR2 , or His-Ub were procured from GeneChem.

    Techniques: Immunoprecipitation, Western Blot, Control, Knockdown, Over Expression, Ubiquitin Proteomics

    PSMD14 promotes the malignant behavior of LUAD cells through AGR2 . Cotransfection of PSMD14 plasmid and anti- AGR2 siRNA into A549 and H1299 cells resulted in the measurement of indicated proteins (A), cell viability (B), colony formation according to crystal violet staining. (C), cell migration (wound healing assay), scale bar =200 µm (D), invasion (transwell assay), staining with crystal violet, scale bar =200 µm (E), and cell migration (transwell assay), staining with crystal violet, scale bar =200 µm (F). *, P<0.05; **, P<0.01; ***, P<0.001; ****, P<0.0001. HA, YPYDVPDYA; Si-AGR2, CAAGACAAGCAACAAACCCTT; LUAD, lung adenocarcinoma.

    Journal: Journal of Thoracic Disease

    Article Title: Bioinformatics analysis and single-cell RNA sequencing: elucidating the ubiquitination pathways and key enzymes in lung adenocarcinoma

    doi: 10.21037/jtd-23-795

    Figure Lengend Snippet: PSMD14 promotes the malignant behavior of LUAD cells through AGR2 . Cotransfection of PSMD14 plasmid and anti- AGR2 siRNA into A549 and H1299 cells resulted in the measurement of indicated proteins (A), cell viability (B), colony formation according to crystal violet staining. (C), cell migration (wound healing assay), scale bar =200 µm (D), invasion (transwell assay), staining with crystal violet, scale bar =200 µm (E), and cell migration (transwell assay), staining with crystal violet, scale bar =200 µm (F). *, P<0.05; **, P<0.01; ***, P<0.001; ****, P<0.0001. HA, YPYDVPDYA; Si-AGR2, CAAGACAAGCAACAAACCCTT; LUAD, lung adenocarcinoma.

    Article Snippet: Plasmids expressing HA- PSMD14 , Myc- AGR2 , or His-Ub were procured from GeneChem.

    Techniques: Cotransfection, Plasmid Preparation, Staining, Migration, Wound Healing Assay, Transwell Assay

    Patient demographics and  AGR2 expression  by subgroups

    Journal: BMC Cancer

    Article Title: High expression of AGR2 in lung cancer is predictive of poor survival

    doi: 10.1186/s12885-015-1658-2

    Figure Lengend Snippet: Patient demographics and AGR2 expression by subgroups

    Article Snippet: AGR2 expression was evaluated on the TMA with NB110-17780 rabbit polyclonal (Novus Biologicals) at 2 μg/ml concentration as described [ ].

    Techniques: Expressing

    AGR2 staining intensity of lung tissue. Staining is scored by integrated intensity values on the vertical axis for the tissue types listed on the horizontal axis. Normal bronchial epithelium shows the strongest staining for AGR2. The number of tissue examples scored is indicated by n

    Journal: BMC Cancer

    Article Title: High expression of AGR2 in lung cancer is predictive of poor survival

    doi: 10.1186/s12885-015-1658-2

    Figure Lengend Snippet: AGR2 staining intensity of lung tissue. Staining is scored by integrated intensity values on the vertical axis for the tissue types listed on the horizontal axis. Normal bronchial epithelium shows the strongest staining for AGR2. The number of tissue examples scored is indicated by n

    Article Snippet: AGR2 expression was evaluated on the TMA with NB110-17780 rabbit polyclonal (Novus Biologicals) at 2 μg/ml concentration as described [ ].

    Techniques: Staining

    AGR2 expression and tumor grade. The box plots show a decrease in integrated intensity values with increasing tumor grades (top panel). This correlation was not evident when separated by tumor types (middle panel for adenocarcinoma; bottom panel for squamous carcinoma). Adenocarcinoma grade 3 shows low staining intensity but squamous carcinoma shows higher staining intensity

    Journal: BMC Cancer

    Article Title: High expression of AGR2 in lung cancer is predictive of poor survival

    doi: 10.1186/s12885-015-1658-2

    Figure Lengend Snippet: AGR2 expression and tumor grade. The box plots show a decrease in integrated intensity values with increasing tumor grades (top panel). This correlation was not evident when separated by tumor types (middle panel for adenocarcinoma; bottom panel for squamous carcinoma). Adenocarcinoma grade 3 shows low staining intensity but squamous carcinoma shows higher staining intensity

    Article Snippet: AGR2 expression was evaluated on the TMA with NB110-17780 rabbit polyclonal (Novus Biologicals) at 2 μg/ml concentration as described [ ].

    Techniques: Expressing, Staining

    AGR2 expression in primary vs . metastatic sites. No significant differences in AGR2 expression was seen in primary, lymph node metastasis, and distant metastasis. This applied to adenocarcinomas, squamous carcinomas and large cell carcinomas

    Journal: BMC Cancer

    Article Title: High expression of AGR2 in lung cancer is predictive of poor survival

    doi: 10.1186/s12885-015-1658-2

    Figure Lengend Snippet: AGR2 expression in primary vs . metastatic sites. No significant differences in AGR2 expression was seen in primary, lymph node metastasis, and distant metastasis. This applied to adenocarcinomas, squamous carcinomas and large cell carcinomas

    Article Snippet: AGR2 expression was evaluated on the TMA with NB110-17780 rabbit polyclonal (Novus Biologicals) at 2 μg/ml concentration as described [ ].

    Techniques: Expressing

    AGR2 immunostaining of lung epithelial cells. Shown are examples of lung epithelial cells stained for AGR2: a , normal bronchiolar epithelium; b , bronchioloalveolar carcinoma, mucinous type; c , moderately differentiated adenocarcinoma; d , moderately differentiated squamous carcinoma; e , poorly differentiated adenocarcinoma; f , large cell carcinoma

    Journal: BMC Cancer

    Article Title: High expression of AGR2 in lung cancer is predictive of poor survival

    doi: 10.1186/s12885-015-1658-2

    Figure Lengend Snippet: AGR2 immunostaining of lung epithelial cells. Shown are examples of lung epithelial cells stained for AGR2: a , normal bronchiolar epithelium; b , bronchioloalveolar carcinoma, mucinous type; c , moderately differentiated adenocarcinoma; d , moderately differentiated squamous carcinoma; e , poorly differentiated adenocarcinoma; f , large cell carcinoma

    Article Snippet: AGR2 expression was evaluated on the TMA with NB110-17780 rabbit polyclonal (Novus Biologicals) at 2 μg/ml concentration as described [ ].

    Techniques: Immunostaining, Staining

    High vs . low tumor  AGR2 expression.  The percentages of tissue cores showing low vs . high integrated intensity values for the different tumor grades in adenocarcinoma and squamous carcinoma are tabulated

    Journal: BMC Cancer

    Article Title: High expression of AGR2 in lung cancer is predictive of poor survival

    doi: 10.1186/s12885-015-1658-2

    Figure Lengend Snippet: High vs . low tumor AGR2 expression. The percentages of tissue cores showing low vs . high integrated intensity values for the different tumor grades in adenocarcinoma and squamous carcinoma are tabulated

    Article Snippet: AGR2 expression was evaluated on the TMA with NB110-17780 rabbit polyclonal (Novus Biologicals) at 2 μg/ml concentration as described [ ].

    Techniques: Expressing

    High vs . low tumor  AGR2 expression.  The percentages of tissue cores showing low vs . high integrated intensity values for the different tumor grades in adenocarcinoma and squamous carcinoma are tabulated

    Journal: BMC Cancer

    Article Title: High expression of AGR2 in lung cancer is predictive of poor survival

    doi: 10.1186/s12885-015-1658-2

    Figure Lengend Snippet: High vs . low tumor AGR2 expression. The percentages of tissue cores showing low vs . high integrated intensity values for the different tumor grades in adenocarcinoma and squamous carcinoma are tabulated

    Article Snippet: AGR2 expression was evaluated on the TMA with NB110-17780 rabbit polyclonal (Novus Biologicals) at 2 μg/ml concentration as described [ ].

    Techniques: Expressing

    AGR2 expression and smoking status. Non-smokers had on average slightly higher levels than smokers

    Journal: BMC Cancer

    Article Title: High expression of AGR2 in lung cancer is predictive of poor survival

    doi: 10.1186/s12885-015-1658-2

    Figure Lengend Snippet: AGR2 expression and smoking status. Non-smokers had on average slightly higher levels than smokers

    Article Snippet: AGR2 expression was evaluated on the TMA with NB110-17780 rabbit polyclonal (Novus Biologicals) at 2 μg/ml concentration as described [ ].

    Techniques: Expressing

    Kaplan-Meier survival plot for AGR2 expression levels. For patients under 65, high tumor AGR2 expression is correlated with a poorer survival than low tumor AGR2 expression

    Journal: BMC Cancer

    Article Title: High expression of AGR2 in lung cancer is predictive of poor survival

    doi: 10.1186/s12885-015-1658-2

    Figure Lengend Snippet: Kaplan-Meier survival plot for AGR2 expression levels. For patients under 65, high tumor AGR2 expression is correlated with a poorer survival than low tumor AGR2 expression

    Article Snippet: AGR2 expression was evaluated on the TMA with NB110-17780 rabbit polyclonal (Novus Biologicals) at 2 μg/ml concentration as described [ ].

    Techniques: Expressing

    Multivariate cox model for younger patients including  AGR2,  tumor stage, grade and patient age

    Journal: BMC Cancer

    Article Title: High expression of AGR2 in lung cancer is predictive of poor survival

    doi: 10.1186/s12885-015-1658-2

    Figure Lengend Snippet: Multivariate cox model for younger patients including AGR2, tumor stage, grade and patient age

    Article Snippet: AGR2 expression was evaluated on the TMA with NB110-17780 rabbit polyclonal (Novus Biologicals) at 2 μg/ml concentration as described [ ].

    Techniques: