Journal: Journal of Thoracic Disease

Article Title: Bioinformatics analysis and single-cell RNA sequencing: elucidating the ubiquitination pathways and key enzymes in lung adenocarcinoma

doi: 10.21037/jtd-23-795

Figure Lengend Snippet: Identification of ubiquitination modification molecules associated with prognosis. (A) The intersection of prognostic molecules in TCGA-LUAD, GSE3141, GSE31210, GSE11969, GSE30219, and GSE50081 datasets were visualized using UpSet plots. The red-boxed genes represent molecules with prognostic differences in at least 3 datasets. (B) The 53 genes in the intersection were arranged based on their intersection numbers, with the specific gene symbols arranged from left to right in descending order of intersection number: 6, 5, 4, and 3. (C) Three genes were identified as intersections in 4 datasets, namely FGR , PSMD14 , and ZBTB16 . (D) The expression differences of FGR, PSMD14 , and ZBTB16 genes in the GSE11969, GSE31210, GSE32863, and GSE118370 datasets. (E-H) The cellular localization of FGR , PSMD14 , and ZBTB16 gene expressions in GSE117570, GSE123902, GSE131907 and GSE149655. (I) Differences in the expression of FGR, PSMD14 , and ZBTB16 genes between malignant cells and normal epithelial cells in GSE117570, GSE123902, GSE131907 and GSE149655. *, P<0.05; **, P<0.01; ***, P<0.001. TCGA-LUAD, The Cancer Genome Atlas-lung adenocarcinoma; tSNE, t-distributed stochastic neighbor embedding.

Article Snippet: Plasmids expressing HA- PSMD14 , Myc- AGR2 , or His-Ub were procured from GeneChem.

Techniques: Ubiquitin Proteomics, Modification, Expressing

Journal: Journal of Thoracic Disease

Article Title: Bioinformatics analysis and single-cell RNA sequencing: elucidating the ubiquitination pathways and key enzymes in lung adenocarcinoma

doi: 10.21037/jtd-23-795

Figure Lengend Snippet: PSMD14 as a novel biomarker for survival prediction. (A) Differential expression of PSMD14 in tumor and normal tissues within TCGA-LUAD. (B-D) Kaplan-Meier curves were used to compare OS (B), PFS (C), and DSS (D) between patients with high and low expression of PSMD14 . (E) A prognostic nomogram encompassing variables such as age, sex, pathological stage, ethnicity, and PSMD14 expression was formulated as a clinical prediction model for evaluating patient outcomes. (F) Calibration curves representing clinical prediction models were constructed for the assessment of prognostic estimates, with 1-, 3-, and 5-year intervals included. RSEM, RNA-Seq by Expectation-Maximization; TCGA-LUAD, The Cancer Genome Atlas-lung adenocarcinoma; FDR, false discovery rate; OS, overall survival; PFS, progression-free survival; DSS, disease-specific survival.

Article Snippet: Plasmids expressing HA- PSMD14 , Myc- AGR2 , or His-Ub were procured from GeneChem.

Techniques: Biomarker Discovery, Quantitative Proteomics, Expressing, Construct, RNA Sequencing

Journal: Journal of Thoracic Disease

Article Title: Bioinformatics analysis and single-cell RNA sequencing: elucidating the ubiquitination pathways and key enzymes in lung adenocarcinoma

doi: 10.21037/jtd-23-795

Figure Lengend Snippet: Univariate and multivariate Cox analysis based on TCGA-LUAD

Article Snippet: Plasmids expressing HA- PSMD14 , Myc- AGR2 , or His-Ub were procured from GeneChem.

Techniques: Expressing

Journal: Journal of Thoracic Disease

Article Title: Bioinformatics analysis and single-cell RNA sequencing: elucidating the ubiquitination pathways and key enzymes in lung adenocarcinoma

doi: 10.21037/jtd-23-795

Figure Lengend Snippet: Elevated PSMD14 expression enhances the progression of lung adenocarcinoma. (A) RT-qPCR analysis revealed that the expression of PSMD14 was significantly elevated in LUAD tissues and cells compared to normal tissues and cells. (B) Western blot revealed an increase in the expression of PSMD14 protein in A549, H1299, and H358 compared to BEAS-2B. (C) Western blot revealed the expression of PSMD14 protein in LUAD tissues was significantly higher than that in paracancer tissues. (D) RT-qPCR indicated a knockdown efficiency greater than 50% in A549 and H1299 cells. (E) Western blot revealed the knockdown efficiency of PSMD14 in A549 and H1299 cells. (F) The CCK-8 assay showed the cell viability of both the PSMD14 knockdown and control groups, with results indicating a significant decrease in cell viability within the knockdown group. (G) Colony formation assay revealed a significant decrease in cell proliferation within the PSMD14 knockdown group according to crystal violet staining. (H,I) The cell scratch assay demonstrated a significant decrease in cell migration ability in the PSMD14 knockdown group compared to the control group in A549 (H) and H1299 (I) cells. Scale bar =200 µm. (J) Transwell invasion assay showed a significant decrease in cell invasion ability in the PSMD14 knockdown group compared to the control group according to crystal violet staining. Scale bar =200 µm. (K) Transwell migration assay showed a significant decrease in cell invasion ability in the PSMD14 knockdown group compared to the control group according to crystal violet staining. Scale bar =200 µm. (L) In vivo experiments revealed a significant reduction in tumor volume, growth rate, and weight within the PSMD14 group compared to the control group. *, P<0.05; **, P<0.01; ***, P<0.001. RT-qPCR, reverse-transcription quantitative polymerase chain reaction; LUAD, lung adenocarcinoma; CCK-8, Cell Counting Kit-8.

Article Snippet: Plasmids expressing HA- PSMD14 , Myc- AGR2 , or His-Ub were procured from GeneChem.

Techniques: Expressing, Quantitative RT-PCR, Western Blot, Knockdown, CCK-8 Assay, Control, Colony Assay, Staining, Wound Healing Assay, Migration, Transwell Invasion Assay, Transwell Migration Assay, In Vivo, Reverse Transcription, Real-time Polymerase Chain Reaction, Cell Counting

Journal: Journal of Thoracic Disease

Article Title: Bioinformatics analysis and single-cell RNA sequencing: elucidating the ubiquitination pathways and key enzymes in lung adenocarcinoma

doi: 10.21037/jtd-23-795

Figure Lengend Snippet: AGR2 protein stability is regulated by PSMD14 via deubiquitination. (A) The HA- PSMD14 and Myc- AGR2 plasmids were cotransfected into HEK-293T cells, followed by the immunoprecipitation of cell lysates using either anti-HA or anti-Myc antibodies. (B) Immunoprecipitation of A549 and H1299 cell lysates was performed using anti- PSMD14 and anti- AGR2 antibodies, followed by analysis via immunoblotting, with the IgG antibody serving as a control. (C) Western blot showed a significant decrease in the level of AGR2 protein following PSMD14 knockdown. (D) Western blot showed the level of AGR2 protein increased following PSMD14 overexpression. (E) Western blot revealed that treatment with MG132 resulted in the reversal of AGR2 protein level decrease caused by PSMD14 knockdown. (F) The left panel shows the Western blot result of AGR2 protein levels in PSMD14 knockdown and control cells at 0, 3, 6, and 12 hours after CHX treatment. The right panel shows the corresponding AGR2 protein degradation rates between the two groups. (G) The left panel shows the Western blot result of AGR2 protein levels in PSMD14 overexpression and control cells at 0, 3, 6, and 12 hours after CHX treatment. The right panel shows the corresponding AGR2 protein degradation rates between the two groups. (H) Western blotting showed that PSMD14 knockdown increased the ubiquitin level of AGR2 protein compared to the control group. (I) Western blotting showed that PSMD14 overexpression decreased the ubiquitin level of AGR2 protein compared to the control group. ***, P<0.001. HA, YPYDVPDYA; Myc, EQKLISEEDL; IP, immunoprecipitation; IgG, immunoglobulin G; CHX, cycloheximide.

Article Snippet: Plasmids expressing HA- PSMD14 , Myc- AGR2 , or His-Ub were procured from GeneChem.

Techniques: Immunoprecipitation, Western Blot, Control, Knockdown, Over Expression, Ubiquitin Proteomics

Journal: Journal of Thoracic Disease

Article Title: Bioinformatics analysis and single-cell RNA sequencing: elucidating the ubiquitination pathways and key enzymes in lung adenocarcinoma

doi: 10.21037/jtd-23-795

Figure Lengend Snippet: PSMD14 promotes the malignant behavior of LUAD cells through AGR2 . Cotransfection of PSMD14 plasmid and anti- AGR2 siRNA into A549 and H1299 cells resulted in the measurement of indicated proteins (A), cell viability (B), colony formation according to crystal violet staining. (C), cell migration (wound healing assay), scale bar =200 µm (D), invasion (transwell assay), staining with crystal violet, scale bar =200 µm (E), and cell migration (transwell assay), staining with crystal violet, scale bar =200 µm (F). *, P<0.05; **, P<0.01; ***, P<0.001; ****, P<0.0001. HA, YPYDVPDYA; Si-AGR2, CAAGACAAGCAACAAACCCTT; LUAD, lung adenocarcinoma.

Article Snippet: Plasmids expressing HA- PSMD14 , Myc- AGR2 , or His-Ub were procured from GeneChem.

Techniques: Cotransfection, Plasmid Preparation, Staining, Migration, Wound Healing Assay, Transwell Assay

Journal: BMC Cancer

Article Title: High expression of AGR2 in lung cancer is predictive of poor survival

doi: 10.1186/s12885-015-1658-2

Figure Lengend Snippet: Patient demographics and AGR2 expression by subgroups

Article Snippet: AGR2 expression was evaluated on the TMA with NB110-17780 rabbit polyclonal (Novus Biologicals) at 2 μg/ml concentration as described [ ].

Techniques: Expressing

Journal: BMC Cancer

Article Title: High expression of AGR2 in lung cancer is predictive of poor survival

doi: 10.1186/s12885-015-1658-2

Figure Lengend Snippet: AGR2 staining intensity of lung tissue. Staining is scored by integrated intensity values on the vertical axis for the tissue types listed on the horizontal axis. Normal bronchial epithelium shows the strongest staining for AGR2. The number of tissue examples scored is indicated by n

Article Snippet: AGR2 expression was evaluated on the TMA with NB110-17780 rabbit polyclonal (Novus Biologicals) at 2 μg/ml concentration as described [ ].

Techniques: Staining

Journal: BMC Cancer

Article Title: High expression of AGR2 in lung cancer is predictive of poor survival

doi: 10.1186/s12885-015-1658-2

Figure Lengend Snippet: AGR2 expression and tumor grade. The box plots show a decrease in integrated intensity values with increasing tumor grades (top panel). This correlation was not evident when separated by tumor types (middle panel for adenocarcinoma; bottom panel for squamous carcinoma). Adenocarcinoma grade 3 shows low staining intensity but squamous carcinoma shows higher staining intensity

Article Snippet: AGR2 expression was evaluated on the TMA with NB110-17780 rabbit polyclonal (Novus Biologicals) at 2 μg/ml concentration as described [ ].

Techniques: Expressing, Staining

Journal: BMC Cancer

Article Title: High expression of AGR2 in lung cancer is predictive of poor survival

doi: 10.1186/s12885-015-1658-2

Figure Lengend Snippet: AGR2 expression in primary vs . metastatic sites. No significant differences in AGR2 expression was seen in primary, lymph node metastasis, and distant metastasis. This applied to adenocarcinomas, squamous carcinomas and large cell carcinomas

Article Snippet: AGR2 expression was evaluated on the TMA with NB110-17780 rabbit polyclonal (Novus Biologicals) at 2 μg/ml concentration as described [ ].

Techniques: Expressing

Journal: BMC Cancer

Article Title: High expression of AGR2 in lung cancer is predictive of poor survival

doi: 10.1186/s12885-015-1658-2

Figure Lengend Snippet: AGR2 immunostaining of lung epithelial cells. Shown are examples of lung epithelial cells stained for AGR2: a , normal bronchiolar epithelium; b , bronchioloalveolar carcinoma, mucinous type; c , moderately differentiated adenocarcinoma; d , moderately differentiated squamous carcinoma; e , poorly differentiated adenocarcinoma; f , large cell carcinoma

Article Snippet: AGR2 expression was evaluated on the TMA with NB110-17780 rabbit polyclonal (Novus Biologicals) at 2 μg/ml concentration as described [ ].

Techniques: Immunostaining, Staining

Journal: BMC Cancer

Article Title: High expression of AGR2 in lung cancer is predictive of poor survival

doi: 10.1186/s12885-015-1658-2

Figure Lengend Snippet: High vs . low tumor AGR2 expression. The percentages of tissue cores showing low vs . high integrated intensity values for the different tumor grades in adenocarcinoma and squamous carcinoma are tabulated

Article Snippet: AGR2 expression was evaluated on the TMA with NB110-17780 rabbit polyclonal (Novus Biologicals) at 2 μg/ml concentration as described [ ].

Techniques: Expressing

Journal: BMC Cancer

Article Title: High expression of AGR2 in lung cancer is predictive of poor survival

doi: 10.1186/s12885-015-1658-2

Figure Lengend Snippet: High vs . low tumor AGR2 expression. The percentages of tissue cores showing low vs . high integrated intensity values for the different tumor grades in adenocarcinoma and squamous carcinoma are tabulated

Article Snippet: AGR2 expression was evaluated on the TMA with NB110-17780 rabbit polyclonal (Novus Biologicals) at 2 μg/ml concentration as described [ ].

Techniques: Expressing

Journal: BMC Cancer

Article Title: High expression of AGR2 in lung cancer is predictive of poor survival

doi: 10.1186/s12885-015-1658-2

Figure Lengend Snippet: AGR2 expression and smoking status. Non-smokers had on average slightly higher levels than smokers

Article Snippet: AGR2 expression was evaluated on the TMA with NB110-17780 rabbit polyclonal (Novus Biologicals) at 2 μg/ml concentration as described [ ].

Techniques: Expressing

Journal: BMC Cancer

Article Title: High expression of AGR2 in lung cancer is predictive of poor survival

doi: 10.1186/s12885-015-1658-2

Figure Lengend Snippet: Kaplan-Meier survival plot for AGR2 expression levels. For patients under 65, high tumor AGR2 expression is correlated with a poorer survival than low tumor AGR2 expression

Article Snippet: AGR2 expression was evaluated on the TMA with NB110-17780 rabbit polyclonal (Novus Biologicals) at 2 μg/ml concentration as described [ ].

Techniques: Expressing

Journal: BMC Cancer

Article Title: High expression of AGR2 in lung cancer is predictive of poor survival

doi: 10.1186/s12885-015-1658-2

Figure Lengend Snippet: Multivariate cox model for younger patients including AGR2, tumor stage, grade and patient age

Article Snippet: AGR2 expression was evaluated on the TMA with NB110-17780 rabbit polyclonal (Novus Biologicals) at 2 μg/ml concentration as described [ ].

Techniques: