Review




Structured Review

Benchling Inc benchling web based software
Benchling Web Based Software, supplied by Benchling Inc, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/web-based+software/based+design+dna+software+web/pmc12649315-88-32-36
Average 86 stars, based on 1 article reviews
benchling web based software - by Bioz Stars, 2026-10
86/100 stars

Images

Related Articles

Introduce:

Article Title: Evolutionary optimization of allosteric activation by Cl - and Cl - conduction in vesicular glutamate transporters
Article Snippet: .. We designed target-specific guidance RNAs with a web-based design tools. ( https://www.benchling.com/crispr/ ) : (1a) Top Strand Target (Exon 3 Target): 5’ACGGTCAGAGTCCAAGGTCC 3’ and (1b) Bottom Strand Target (Exon 3 Target): 5’GCTCTGAGTTCTCAACCACC 3’ (2a) Top Strand Target (Exon 4 Target): 5’CTACCTGCTGCTCATGGCTG 3’ and (2b) Bottom Strand Target (Exon 4 Target): 5’GCAGGTAGATGAAGATGAGT 3’ Cas9 nickase (Cas9n) was used to introduce nicks on both strands of the target DNA in Exon 3 and 4. ..

Cleavage Assay:

Article Title: DISC1-PML protein interaction for congenital CMV infection-induced cortical neural progenitor deficit: perturbance of host signaling via viral IE1
Article Snippet: .. We designed target sequences by using two different web-based tools ( http://chopchop.cbu.uib.no/ , https://www.benchling.com/crispr/ ) to minimize the off-target effect, and then confirmed the successful targeting by the genome cleavage assay in MCMV infected cells ( Figure S3C ). ..

Article Title: Cytomegalovirus-encoded immediate early 1 protein perturbs neural progenitor proliferation via interfering with host PML–DISC1 interaction
Article Snippet: .. We designed target sequences by using two different web-based tools ( http://chopchop.cbu.uib.no/ , https://www.benchling.com/crispr/ ) to minimize the off-target effect, and then confirmed the successful targeting by the genome cleavage assay in MCMV-infected cells ( ). ..

Infection:

Article Title: DISC1-PML protein interaction for congenital CMV infection-induced cortical neural progenitor deficit: perturbance of host signaling via viral IE1
Article Snippet: .. We designed target sequences by using two different web-based tools ( http://chopchop.cbu.uib.no/ , https://www.benchling.com/crispr/ ) to minimize the off-target effect, and then confirmed the successful targeting by the genome cleavage assay in MCMV infected cells ( Figure S3C ). ..

Recombinant:

Article Title: Development of Visual Detection of African Swine Fever Virus Using CRISPR/AapCas12b Lateral Flow Strip Based on Viral Major Capsid Protein Gene B646L
Article Snippet: .. A total of 14 ASFV genomes, including six genotype I, seven genotype II, and one I/II recombinant strain, were aligned using Geneious primer software (version 2025.2). sgRNA primers were designed using the Benchling web-based software ( https://www.benchling.com ). ..

Software:

Article Title: Development of Visual Detection of African Swine Fever Virus Using CRISPR/AapCas12b Lateral Flow Strip Based on Viral Major Capsid Protein Gene B646L
Article Snippet: .. A total of 14 ASFV genomes, including six genotype I, seven genotype II, and one I/II recombinant strain, were aligned using Geneious primer software (version 2025.2). sgRNA primers were designed using the Benchling web-based software ( https://www.benchling.com ). ..

Article Title: Investigation of ABCA4 Missense Variants and Potential Small Molecule Rescue in Retinal Organoids
Article Snippet: .. The design of the guide RNAs (gRNAs) was completed on ( https://www.benchling.com/ ), a web-based software enabling the design of optimal gRNAs ( ). ..

Article Title: Synthetische Biologie – die Synthese der Biologie
Article Snippet: Dieser Beitrag wurde nach Begutachtung und Überarbeitung sofort als "akzeptierter Artikel" (Accepted Article; AA) publiziert und kann unter Angabe der unten stehenden Digitalobjekt-Identifizierungsnummer (DOI) zitiert werden.. Die deutsche Übersetzung wird gemeinsam mit der endgültigen englischen Fassung erscheinen.. Die endgültige englische Fassung (Version of Record) wird ehestmöglich nach dem Redigieren und einem Korrekturgang als Early-View-Beitrag erscheinen und kann sich naturgemäß von der AA-Fassung unterscheiden.

Plasmid Preparation:

Article Title: Synthetische Biologie – die Synthese der Biologie
Article Snippet: Dieser Beitrag wurde nach Begutachtung und Überarbeitung sofort als "akzeptierter Artikel" (Accepted Article; AA) publiziert und kann unter Angabe der unten stehenden Digitalobjekt-Identifizierungsnummer (DOI) zitiert werden.. Die deutsche Übersetzung wird gemeinsam mit der endgültigen englischen Fassung erscheinen.. Die endgültige englische Fassung (Version of Record) wird ehestmöglich nach dem Redigieren und einem Korrekturgang als Early-View-Beitrag erscheinen und kann sich naturgemäß von der AA-Fassung unterscheiden.



Similar Products

86
Dexcom Inc web based cgm software accounts
Web Based Cgm Software Accounts, supplied by Dexcom Inc, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/web-based+software/accounts+based+cgm+software+web/pmc12672289-37-13-18
Average 86 stars, based on 1 article reviews
web based cgm software accounts - by Bioz Stars, 2026-10
86/100 stars
  Buy from Supplier

99
STATA Corporation redcap web based software platform
Redcap Web Based Software Platform, supplied by STATA Corporation, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/web-based+software/STATA+16%2E0/pm41267012-76-9-18
Average 99 stars, based on 1 article reviews
redcap web based software platform - by Bioz Stars, 2026-10
99/100 stars
  Buy from Supplier

86
Benchling Inc benchling web based software
Benchling Web Based Software, supplied by Benchling Inc, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/web-based+software/based+design+dna+software+web/pmc12649315-88-32-36
Average 86 stars, based on 1 article reviews
benchling web based software - by Bioz Stars, 2026-10
86/100 stars
  Buy from Supplier

86
Autodesk Inc web based software tinkercad
Web Based Software Tinkercad, supplied by Autodesk Inc, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/web-based+software/tinkercad/10__1091_slash_mbc__e24___12___0543-254-16-19
Average 86 stars, based on 1 article reviews
web based software tinkercad - by Bioz Stars, 2026-10
86/100 stars
  Buy from Supplier

86
Benchling Inc web based software
Web Based Software, supplied by Benchling Inc, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/web-based+software/based+design+dna+software+web/pmc12302050-13-14-11
Average 86 stars, based on 1 article reviews
web based software - by Bioz Stars, 2026-10
86/100 stars
  Buy from Supplier

90
GetData Pty Ltd web-based software getdata graph digitizer
Web Based Software Getdata Graph Digitizer, supplied by GetData Pty Ltd, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/web-based+software/getdata+graph+digitizer/pm40578159-70-6-8
Average 90 stars, based on 1 article reviews
web-based software getdata graph digitizer - by Bioz Stars, 2026-10
90/100 stars
  Buy from Supplier

90
Abbott Laboratories web-based software libreview
Web Based Software Libreview, supplied by Abbott Laboratories, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/web-based+software/libreview+software/pm40471662-212-8-11
Average 90 stars, based on 1 article reviews
web-based software libreview - by Bioz Stars, 2026-10
90/100 stars
  Buy from Supplier

Image Search Results