Review



non invasive screening tool  (Twist Bioscience)


Bioz Verified Symbol Twist Bioscience is a verified supplier
Bioz Manufacturer Symbol Twist Bioscience manufactures this product  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
    • 95
      Buy from Supplier

    Structured Review

    Twist Bioscience non invasive screening tool
    Non Invasive Screening Tool, supplied by Twist Bioscience, used in various techniques. Bioz Stars score: 95/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/tool/Screening/pm42553143-91-24-54
    Average 95 stars, based on 1 article reviews
    non invasive screening tool - by Bioz Stars, 2026-09
    95/100 stars

    Images

    Related Articles

    Synthesized:

    Article Title: Synthetic mammalian signaling circuits for robust cell population control
    Article Snippet: PIN2, mGFP, and iaaM coding sequences (CDS) were codon optimized for expressing in mice and synthesized as dsDNA at Integrated DNA Technology together with all oligos for cloning. .. Coding sequences for screening indole-3-hydrolases were synthesized as cloning plasmid at Twist Bioscience. .. All constructs were cloned into the piggyBac plasmids (System Biosciences Inc.) driven by a synthetic version of human EF1A promoter.

    Article Title: Epigenetic CRISPR Screening of 9p21.3 Non-Coding Regions identifies Cis-Regulatory Elements of P16 INK4a and P15 INK4b Controlling Cellular Senescence
    Article Snippet: .. For the sgRNA libraries used in CRISPR screening, sgRNAs flanked by the sequences TATATATCTTGTGGAAAGGACGAAACACCG and GTTTAAGAGCTATGCTGGAAACAGC were synthesized by Twist Bioscience. sgRNA oligo library was amplified using NEBNext Q5 Hot Start HiFi PCR Master Mix with oligo-forward primer: GTAACTTGAAAGTATTTCGATTTCTTGGCTTTATATATCTTGTGGAAAGGACGAAACACC and oligo-reverse primer: ACTTTTTCAAGTTGATAACGGACTAG CCTTATTTTAACTTGCTATTTCTAGCTCTAAAAC. .. The amplified oligos were purified using DNA Clean & Concentrator Kit (Zymo) and cloned into lentiGuide-Puro (Addgene, 52963) backbone cleaved by FastDigest Esp3I (Thermo Fisher, FD0454) using NEBuilder HiFi DNA Assembly (NEB).

    Cloning:

    Article Title: Synthetic mammalian signaling circuits for robust cell population control
    Article Snippet: PIN2, mGFP, and iaaM coding sequences (CDS) were codon optimized for expressing in mice and synthesized as dsDNA at Integrated DNA Technology together with all oligos for cloning. .. Coding sequences for screening indole-3-hydrolases were synthesized as cloning plasmid at Twist Bioscience. .. All constructs were cloned into the piggyBac plasmids (System Biosciences Inc.) driven by a synthetic version of human EF1A promoter.

    Article Title: AI-enabled discovery and biochemical optimization of minibinders targeting cancer cell-surface proteins.
    Article Snippet: Plasmid DNA of input, as well as output phages from two panning rounds were used as template for NGS library generation (primers NGS_phages_fwd and NGS_phages_rev, followed by a second PCR using Illumina barcode primers) and sequencing using the Illumina MiSeq platform. .. Nature Communications | (2026) 17:8736 15 Library cloning for mammalian cell-surface display screening The oligo pool (Twist Biosciences) was PCR amplified (primers poolamplification_fwd, pool-amplification_rev) and cloned into the lentiviral target vector using Golden Gate assembly with the restriction enzyme Esp3I. .. The assembly was purified using a DNA Clean & Concentrator-5 column (Zymo) and was electroporated into 25 μL Endura electrocompetent E. coli (Biosearch Technologies) in 0.1-cm Bio-Rad cuvettes at 1800V, 10 μF, and 600Ω.

    Plasmid Preparation:

    Article Title: Synthetic mammalian signaling circuits for robust cell population control
    Article Snippet: PIN2, mGFP, and iaaM coding sequences (CDS) were codon optimized for expressing in mice and synthesized as dsDNA at Integrated DNA Technology together with all oligos for cloning. .. Coding sequences for screening indole-3-hydrolases were synthesized as cloning plasmid at Twist Bioscience. .. All constructs were cloned into the piggyBac plasmids (System Biosciences Inc.) driven by a synthetic version of human EF1A promoter.

    Polymerase Chain Reaction:

    Article Title: AI-enabled discovery and biochemical optimization of minibinders targeting cancer cell-surface proteins.
    Article Snippet: Plasmid DNA of input, as well as output phages from two panning rounds were used as template for NGS library generation (primers NGS_phages_fwd and NGS_phages_rev, followed by a second PCR using Illumina barcode primers) and sequencing using the Illumina MiSeq platform. .. Nature Communications | (2026) 17:8736 15 Library cloning for mammalian cell-surface display screening The oligo pool (Twist Biosciences) was PCR amplified (primers poolamplification_fwd, pool-amplification_rev) and cloned into the lentiviral target vector using Golden Gate assembly with the restriction enzyme Esp3I. .. The assembly was purified using a DNA Clean & Concentrator-5 column (Zymo) and was electroporated into 25 μL Endura electrocompetent E. coli (Biosearch Technologies) in 0.1-cm Bio-Rad cuvettes at 1800V, 10 μF, and 600Ω.

    Article Title: Epigenetic CRISPR Screening of 9p21.3 Non-Coding Regions identifies Cis-Regulatory Elements of P16 INK4a and P15 INK4b Controlling Cellular Senescence
    Article Snippet: .. For the sgRNA libraries used in CRISPR screening, sgRNAs flanked by the sequences TATATATCTTGTGGAAAGGACGAAACACCG and GTTTAAGAGCTATGCTGGAAACAGC were synthesized by Twist Bioscience. sgRNA oligo library was amplified using NEBNext Q5 Hot Start HiFi PCR Master Mix with oligo-forward primer: GTAACTTGAAAGTATTTCGATTTCTTGGCTTTATATATCTTGTGGAAAGGACGAAACACC and oligo-reverse primer: ACTTTTTCAAGTTGATAACGGACTAG CCTTATTTTAACTTGCTATTTCTAGCTCTAAAAC. .. The amplified oligos were purified using DNA Clean & Concentrator Kit (Zymo) and cloned into lentiGuide-Puro (Addgene, 52963) backbone cleaved by FastDigest Esp3I (Thermo Fisher, FD0454) using NEBuilder HiFi DNA Assembly (NEB).

    Amplification:

    Article Title: AI-enabled discovery and biochemical optimization of minibinders targeting cancer cell-surface proteins.
    Article Snippet: Plasmid DNA of input, as well as output phages from two panning rounds were used as template for NGS library generation (primers NGS_phages_fwd and NGS_phages_rev, followed by a second PCR using Illumina barcode primers) and sequencing using the Illumina MiSeq platform. .. Nature Communications | (2026) 17:8736 15 Library cloning for mammalian cell-surface display screening The oligo pool (Twist Biosciences) was PCR amplified (primers poolamplification_fwd, pool-amplification_rev) and cloned into the lentiviral target vector using Golden Gate assembly with the restriction enzyme Esp3I. .. The assembly was purified using a DNA Clean & Concentrator-5 column (Zymo) and was electroporated into 25 μL Endura electrocompetent E. coli (Biosearch Technologies) in 0.1-cm Bio-Rad cuvettes at 1800V, 10 μF, and 600Ω.

    Article Title: Epigenetic CRISPR Screening of 9p21.3 Non-Coding Regions identifies Cis-Regulatory Elements of P16 INK4a and P15 INK4b Controlling Cellular Senescence
    Article Snippet: .. For the sgRNA libraries used in CRISPR screening, sgRNAs flanked by the sequences TATATATCTTGTGGAAAGGACGAAACACCG and GTTTAAGAGCTATGCTGGAAACAGC were synthesized by Twist Bioscience. sgRNA oligo library was amplified using NEBNext Q5 Hot Start HiFi PCR Master Mix with oligo-forward primer: GTAACTTGAAAGTATTTCGATTTCTTGGCTTTATATATCTTGTGGAAAGGACGAAACACC and oligo-reverse primer: ACTTTTTCAAGTTGATAACGGACTAG CCTTATTTTAACTTGCTATTTCTAGCTCTAAAAC. .. The amplified oligos were purified using DNA Clean & Concentrator Kit (Zymo) and cloned into lentiGuide-Puro (Addgene, 52963) backbone cleaved by FastDigest Esp3I (Thermo Fisher, FD0454) using NEBuilder HiFi DNA Assembly (NEB).

    Clone Assay:

    Article Title: AI-enabled discovery and biochemical optimization of minibinders targeting cancer cell-surface proteins.
    Article Snippet: Plasmid DNA of input, as well as output phages from two panning rounds were used as template for NGS library generation (primers NGS_phages_fwd and NGS_phages_rev, followed by a second PCR using Illumina barcode primers) and sequencing using the Illumina MiSeq platform. .. Nature Communications | (2026) 17:8736 15 Library cloning for mammalian cell-surface display screening The oligo pool (Twist Biosciences) was PCR amplified (primers poolamplification_fwd, pool-amplification_rev) and cloned into the lentiviral target vector using Golden Gate assembly with the restriction enzyme Esp3I. .. The assembly was purified using a DNA Clean & Concentrator-5 column (Zymo) and was electroporated into 25 μL Endura electrocompetent E. coli (Biosearch Technologies) in 0.1-cm Bio-Rad cuvettes at 1800V, 10 μF, and 600Ω.

    CRISPR:

    Article Title: Epigenetic CRISPR Screening of 9p21.3 Non-Coding Regions identifies Cis-Regulatory Elements of P16 INK4a and P15 INK4b Controlling Cellular Senescence
    Article Snippet: .. For the sgRNA libraries used in CRISPR screening, sgRNAs flanked by the sequences TATATATCTTGTGGAAAGGACGAAACACCG and GTTTAAGAGCTATGCTGGAAACAGC were synthesized by Twist Bioscience. sgRNA oligo library was amplified using NEBNext Q5 Hot Start HiFi PCR Master Mix with oligo-forward primer: GTAACTTGAAAGTATTTCGATTTCTTGGCTTTATATATCTTGTGGAAAGGACGAAACACC and oligo-reverse primer: ACTTTTTCAAGTTGATAACGGACTAG CCTTATTTTAACTTGCTATTTCTAGCTCTAAAAC. .. The amplified oligos were purified using DNA Clean & Concentrator Kit (Zymo) and cloned into lentiGuide-Puro (Addgene, 52963) backbone cleaved by FastDigest Esp3I (Thermo Fisher, FD0454) using NEBuilder HiFi DNA Assembly (NEB).

    Magnetic Resonance Imaging:

    Article Title: Beyond the flow: the evolving role of magnetic resonance imaging in arteriovenous shunt evaluation.
    Article Snippet: .. Furthermore, it shows moderate-to-good intermodality agreement with DSA regarding the Spetzler–Martin grading of AVMs (weighted κ = 0.49–0.69), validating its utility as a rapid, non-invasive screening tool (Figure 9).47 Low-dose four-dimensional magnetic resonance imaging (iterative reconstruction-based time-resolved angiography with interleaved stochastic trajectories) A critical advancement in 4D-MRA is the application of iterative reconstruction to TWIST sequences (IT-TWIST).48 Conventional keyhole and view-sharing techniques, such as standard TWIST, improve temporal resolution by frequently acquiring the k-space center (which dictates image contrast) while dividing and sharing the undersampled pe- ripheral k-space data across multiple adjacent time frames. ..



    Similar Products

    skeletal muscle differentiation medium  (ATCC)
    94
    ATCC skeletal muscle differentiation medium
    RNA-seq profiling of human adipose-derived stem cells (hASCs) after 21 days of culture in myogenic <t>differentiation</t> <t>medium.</t> (a) Principal component analysis (PCA) based on transcriptome expression values (FPKM), showing clustering of biological replicates for Monolayer (2D), PCL, and Fibril conditions. (b) Venn diagram showing the overlap of detected genes among Monolayer, PCL, and Fibril groups (numbers indicate gene counts in each intersection). (c) Gene Ontology (GO) Biological Process (BP) over-representation analysis (ORA) for differentially expressed genes in 2D vs nFMBs (left) and PCL-mFiBs vs nFMBs (right); bars are plotted as −log10 (adjusted p value), with terms enriched among genes upregulated in the first condition shown to the right (red) and terms enriched among genes downregulated in nFMBs shown to the left (blue). (d) KEGG pathway enrichment analysis for differentially expressed genes between PCL-mFiBs and nFMBs groups; dot size represents the number of genes mapped to each pathway (Count), dot color indicates adjusted p value, and the x-axis denotes Gene Ratio. (e) Category network plot (CNP; category–gene network plot) for the PCL-mFiBs vs nFMBs comparison, visualizing representative enriched GO BP terms and their associated genes; gene nodes are colored by fold change and term nodes reflect enrichment significance. (f–i) Heatmaps of selected genes associated with representative GO terms: GO:0000280 (nuclear division), GO:0030198 (extracellular matrix organization), GO:0003012 <t>(muscle</t> system process), and GO:0007519 <t>(skeletal</t> muscle tissue development), respectively; expression patterns are shown across 2D, PCL-mFiBs, and nFMBs, with gene symbols listed alongside each heatmap.
    Skeletal Muscle Differentiation Medium, supplied by ATCC, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/tool/Skeletal+Muscle+Differentiation+Tool/pmc13091133-107-7-11
    Average 94 stars, based on 1 article reviews
    skeletal muscle differentiation medium - by Bioz Stars, 2026-09
    94/100 stars
    		  Buy from Supplier
    non invasive screening tool  (Twist Bioscience)
    95
    Twist Bioscience non invasive screening tool
    RNA-seq profiling of human adipose-derived stem cells (hASCs) after 21 days of culture in myogenic <t>differentiation</t> <t>medium.</t> (a) Principal component analysis (PCA) based on transcriptome expression values (FPKM), showing clustering of biological replicates for Monolayer (2D), PCL, and Fibril conditions. (b) Venn diagram showing the overlap of detected genes among Monolayer, PCL, and Fibril groups (numbers indicate gene counts in each intersection). (c) Gene Ontology (GO) Biological Process (BP) over-representation analysis (ORA) for differentially expressed genes in 2D vs nFMBs (left) and PCL-mFiBs vs nFMBs (right); bars are plotted as −log10 (adjusted p value), with terms enriched among genes upregulated in the first condition shown to the right (red) and terms enriched among genes downregulated in nFMBs shown to the left (blue). (d) KEGG pathway enrichment analysis for differentially expressed genes between PCL-mFiBs and nFMBs groups; dot size represents the number of genes mapped to each pathway (Count), dot color indicates adjusted p value, and the x-axis denotes Gene Ratio. (e) Category network plot (CNP; category–gene network plot) for the PCL-mFiBs vs nFMBs comparison, visualizing representative enriched GO BP terms and their associated genes; gene nodes are colored by fold change and term nodes reflect enrichment significance. (f–i) Heatmaps of selected genes associated with representative GO terms: GO:0000280 (nuclear division), GO:0030198 (extracellular matrix organization), GO:0003012 <t>(muscle</t> system process), and GO:0007519 <t>(skeletal</t> muscle tissue development), respectively; expression patterns are shown across 2D, PCL-mFiBs, and nFMBs, with gene symbols listed alongside each heatmap.
    Non Invasive Screening Tool, supplied by Twist Bioscience, used in various techniques. Bioz Stars score: 95/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/tool/Screening/pm42553143-91-24-54
    Average 95 stars, based on 1 article reviews
    non invasive screening tool - by Bioz Stars, 2026-09
    95/100 stars
    		  Buy from Supplier
    survey tool  (SoSci Survey GmbH)
    90
    SoSci Survey GmbH survey tool
    RNA-seq profiling of human adipose-derived stem cells (hASCs) after 21 days of culture in myogenic <t>differentiation</t> <t>medium.</t> (a) Principal component analysis (PCA) based on transcriptome expression values (FPKM), showing clustering of biological replicates for Monolayer (2D), PCL, and Fibril conditions. (b) Venn diagram showing the overlap of detected genes among Monolayer, PCL, and Fibril groups (numbers indicate gene counts in each intersection). (c) Gene Ontology (GO) Biological Process (BP) over-representation analysis (ORA) for differentially expressed genes in 2D vs nFMBs (left) and PCL-mFiBs vs nFMBs (right); bars are plotted as −log10 (adjusted p value), with terms enriched among genes upregulated in the first condition shown to the right (red) and terms enriched among genes downregulated in nFMBs shown to the left (blue). (d) KEGG pathway enrichment analysis for differentially expressed genes between PCL-mFiBs and nFMBs groups; dot size represents the number of genes mapped to each pathway (Count), dot color indicates adjusted p value, and the x-axis denotes Gene Ratio. (e) Category network plot (CNP; category–gene network plot) for the PCL-mFiBs vs nFMBs comparison, visualizing representative enriched GO BP terms and their associated genes; gene nodes are colored by fold change and term nodes reflect enrichment significance. (f–i) Heatmaps of selected genes associated with representative GO terms: GO:0000280 (nuclear division), GO:0030198 (extracellular matrix organization), GO:0003012 <t>(muscle</t> system process), and GO:0007519 <t>(skeletal</t> muscle tissue development), respectively; expression patterns are shown across 2D, PCL-mFiBs, and nFMBs, with gene symbols listed alongside each heatmap.
    Survey Tool, supplied by SoSci Survey GmbH, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/tool/sosci+survey+tool/nct06425692-34-15-15
    Average 90 stars, based on 1 article reviews
    survey tool - by Bioz Stars, 2026-09
    90/100 stars
    		  Buy from Supplier
    united states zero fluoroscopy tools electroanatomic mapping  (Protego Medical Pty Ltd)
    86
    Protego Medical Pty Ltd united states zero fluoroscopy tools electroanatomic mapping
    RNA-seq profiling of human adipose-derived stem cells (hASCs) after 21 days of culture in myogenic <t>differentiation</t> <t>medium.</t> (a) Principal component analysis (PCA) based on transcriptome expression values (FPKM), showing clustering of biological replicates for Monolayer (2D), PCL, and Fibril conditions. (b) Venn diagram showing the overlap of detected genes among Monolayer, PCL, and Fibril groups (numbers indicate gene counts in each intersection). (c) Gene Ontology (GO) Biological Process (BP) over-representation analysis (ORA) for differentially expressed genes in 2D vs nFMBs (left) and PCL-mFiBs vs nFMBs (right); bars are plotted as −log10 (adjusted p value), with terms enriched among genes upregulated in the first condition shown to the right (red) and terms enriched among genes downregulated in nFMBs shown to the left (blue). (d) KEGG pathway enrichment analysis for differentially expressed genes between PCL-mFiBs and nFMBs groups; dot size represents the number of genes mapped to each pathway (Count), dot color indicates adjusted p value, and the x-axis denotes Gene Ratio. (e) Category network plot (CNP; category–gene network plot) for the PCL-mFiBs vs nFMBs comparison, visualizing representative enriched GO BP terms and their associated genes; gene nodes are colored by fold change and term nodes reflect enrichment significance. (f–i) Heatmaps of selected genes associated with representative GO terms: GO:0000280 (nuclear division), GO:0030198 (extracellular matrix organization), GO:0003012 <t>(muscle</t> system process), and GO:0007519 <t>(skeletal</t> muscle tissue development), respectively; expression patterns are shown across 2D, PCL-mFiBs, and nFMBs, with gene symbols listed alongside each heatmap.
    United States Zero Fluoroscopy Tools Electroanatomic Mapping, supplied by Protego Medical Pty Ltd, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/tool/electroanatomic+fluoroscopy+mapping+states+tools+united+zero/pm41342823-142-86-76
    Average 86 stars, based on 1 article reviews
    united states zero fluoroscopy tools electroanatomic mapping - by Bioz Stars, 2026-09
    86/100 stars
    		  Buy from Supplier
    intelligence assisted tool  (Grammarly Inc)
    86
    Grammarly Inc intelligence assisted tool
    RNA-seq profiling of human adipose-derived stem cells (hASCs) after 21 days of culture in myogenic <t>differentiation</t> <t>medium.</t> (a) Principal component analysis (PCA) based on transcriptome expression values (FPKM), showing clustering of biological replicates for Monolayer (2D), PCL, and Fibril conditions. (b) Venn diagram showing the overlap of detected genes among Monolayer, PCL, and Fibril groups (numbers indicate gene counts in each intersection). (c) Gene Ontology (GO) Biological Process (BP) over-representation analysis (ORA) for differentially expressed genes in 2D vs nFMBs (left) and PCL-mFiBs vs nFMBs (right); bars are plotted as −log10 (adjusted p value), with terms enriched among genes upregulated in the first condition shown to the right (red) and terms enriched among genes downregulated in nFMBs shown to the left (blue). (d) KEGG pathway enrichment analysis for differentially expressed genes between PCL-mFiBs and nFMBs groups; dot size represents the number of genes mapped to each pathway (Count), dot color indicates adjusted p value, and the x-axis denotes Gene Ratio. (e) Category network plot (CNP; category–gene network plot) for the PCL-mFiBs vs nFMBs comparison, visualizing representative enriched GO BP terms and their associated genes; gene nodes are colored by fold change and term nodes reflect enrichment significance. (f–i) Heatmaps of selected genes associated with representative GO terms: GO:0000280 (nuclear division), GO:0030198 (extracellular matrix organization), GO:0003012 <t>(muscle</t> system process), and GO:0007519 <t>(skeletal</t> muscle tissue development), respectively; expression patterns are shown across 2D, PCL-mFiBs, and nFMBs, with gene symbols listed alongside each heatmap.
    Intelligence Assisted Tool, supplied by Grammarly Inc, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/tool/artificial+intelligence+tools/pmc13272577-190-2-4
    Average 86 stars, based on 1 article reviews
    intelligence assisted tool - by Bioz Stars, 2026-09
    86/100 stars
    		  Buy from Supplier
    flow tool physiologic waveform viewer  (Philips Healthcare)
    86
    Philips Healthcare flow tool physiologic waveform viewer
    RNA-seq profiling of human adipose-derived stem cells (hASCs) after 21 days of culture in myogenic <t>differentiation</t> <t>medium.</t> (a) Principal component analysis (PCA) based on transcriptome expression values (FPKM), showing clustering of biological replicates for Monolayer (2D), PCL, and Fibril conditions. (b) Venn diagram showing the overlap of detected genes among Monolayer, PCL, and Fibril groups (numbers indicate gene counts in each intersection). (c) Gene Ontology (GO) Biological Process (BP) over-representation analysis (ORA) for differentially expressed genes in 2D vs nFMBs (left) and PCL-mFiBs vs nFMBs (right); bars are plotted as −log10 (adjusted p value), with terms enriched among genes upregulated in the first condition shown to the right (red) and terms enriched among genes downregulated in nFMBs shown to the left (blue). (d) KEGG pathway enrichment analysis for differentially expressed genes between PCL-mFiBs and nFMBs groups; dot size represents the number of genes mapped to each pathway (Count), dot color indicates adjusted p value, and the x-axis denotes Gene Ratio. (e) Category network plot (CNP; category–gene network plot) for the PCL-mFiBs vs nFMBs comparison, visualizing representative enriched GO BP terms and their associated genes; gene nodes are colored by fold change and term nodes reflect enrichment significance. (f–i) Heatmaps of selected genes associated with representative GO terms: GO:0000280 (nuclear division), GO:0030198 (extracellular matrix organization), GO:0003012 <t>(muscle</t> system process), and GO:0007519 <t>(skeletal</t> muscle tissue development), respectively; expression patterns are shown across 2D, PCL-mFiBs, and nFMBs, with gene symbols listed alongside each heatmap.
    Flow Tool Physiologic Waveform Viewer, supplied by Philips Healthcare, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/tool/flow+physiologic+tool+viewer+waveform/pmc13266255-135-15-20
    Average 86 stars, based on 1 article reviews
    flow tool physiologic waveform viewer - by Bioz Stars, 2026-09
    86/100 stars
    		  Buy from Supplier
    ai based tools  (Grammarly Inc)
    86
    Grammarly Inc ai based tools
    RNA-seq profiling of human adipose-derived stem cells (hASCs) after 21 days of culture in myogenic <t>differentiation</t> <t>medium.</t> (a) Principal component analysis (PCA) based on transcriptome expression values (FPKM), showing clustering of biological replicates for Monolayer (2D), PCL, and Fibril conditions. (b) Venn diagram showing the overlap of detected genes among Monolayer, PCL, and Fibril groups (numbers indicate gene counts in each intersection). (c) Gene Ontology (GO) Biological Process (BP) over-representation analysis (ORA) for differentially expressed genes in 2D vs nFMBs (left) and PCL-mFiBs vs nFMBs (right); bars are plotted as −log10 (adjusted p value), with terms enriched among genes upregulated in the first condition shown to the right (red) and terms enriched among genes downregulated in nFMBs shown to the left (blue). (d) KEGG pathway enrichment analysis for differentially expressed genes between PCL-mFiBs and nFMBs groups; dot size represents the number of genes mapped to each pathway (Count), dot color indicates adjusted p value, and the x-axis denotes Gene Ratio. (e) Category network plot (CNP; category–gene network plot) for the PCL-mFiBs vs nFMBs comparison, visualizing representative enriched GO BP terms and their associated genes; gene nodes are colored by fold change and term nodes reflect enrichment significance. (f–i) Heatmaps of selected genes associated with representative GO terms: GO:0000280 (nuclear division), GO:0030198 (extracellular matrix organization), GO:0003012 <t>(muscle</t> system process), and GO:0007519 <t>(skeletal</t> muscle tissue development), respectively; expression patterns are shown across 2D, PCL-mFiBs, and nFMBs, with gene symbols listed alongside each heatmap.
    Ai Based Tools, supplied by Grammarly Inc, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/tool/ai+assisted+technologies/pm42264871-208-9-14
    Average 86 stars, based on 1 article reviews
    ai based tools - by Bioz Stars, 2026-09
    86/100 stars
    		  Buy from Supplier
    infraorbital tear trough grading tool  (Allergan)
    86
    Allergan infraorbital tear trough grading tool
    RNA-seq profiling of human adipose-derived stem cells (hASCs) after 21 days of culture in myogenic <t>differentiation</t> <t>medium.</t> (a) Principal component analysis (PCA) based on transcriptome expression values (FPKM), showing clustering of biological replicates for Monolayer (2D), PCL, and Fibril conditions. (b) Venn diagram showing the overlap of detected genes among Monolayer, PCL, and Fibril groups (numbers indicate gene counts in each intersection). (c) Gene Ontology (GO) Biological Process (BP) over-representation analysis (ORA) for differentially expressed genes in 2D vs nFMBs (left) and PCL-mFiBs vs nFMBs (right); bars are plotted as −log10 (adjusted p value), with terms enriched among genes upregulated in the first condition shown to the right (red) and terms enriched among genes downregulated in nFMBs shown to the left (blue). (d) KEGG pathway enrichment analysis for differentially expressed genes between PCL-mFiBs and nFMBs groups; dot size represents the number of genes mapped to each pathway (Count), dot color indicates adjusted p value, and the x-axis denotes Gene Ratio. (e) Category network plot (CNP; category–gene network plot) for the PCL-mFiBs vs nFMBs comparison, visualizing representative enriched GO BP terms and their associated genes; gene nodes are colored by fold change and term nodes reflect enrichment significance. (f–i) Heatmaps of selected genes associated with representative GO terms: GO:0000280 (nuclear division), GO:0030198 (extracellular matrix organization), GO:0003012 <t>(muscle</t> system process), and GO:0007519 <t>(skeletal</t> muscle tissue development), respectively; expression patterns are shown across 2D, PCL-mFiBs, and nFMBs, with gene symbols listed alongside each heatmap.
    Infraorbital Tear Trough Grading Tool, supplied by Allergan, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/tool/grading+infraorbital+tear+tool+trough/pmc13272556-9-21-24
    Average 86 stars, based on 1 article reviews
    infraorbital tear trough grading tool - by Bioz Stars, 2026-09
    86/100 stars
    		  Buy from Supplier
    crispr guide rna design tool  (Benchling Inc)
    86
    Benchling Inc crispr guide rna design tool
    RNA-seq profiling of human adipose-derived stem cells (hASCs) after 21 days of culture in myogenic <t>differentiation</t> <t>medium.</t> (a) Principal component analysis (PCA) based on transcriptome expression values (FPKM), showing clustering of biological replicates for Monolayer (2D), PCL, and Fibril conditions. (b) Venn diagram showing the overlap of detected genes among Monolayer, PCL, and Fibril groups (numbers indicate gene counts in each intersection). (c) Gene Ontology (GO) Biological Process (BP) over-representation analysis (ORA) for differentially expressed genes in 2D vs nFMBs (left) and PCL-mFiBs vs nFMBs (right); bars are plotted as −log10 (adjusted p value), with terms enriched among genes upregulated in the first condition shown to the right (red) and terms enriched among genes downregulated in nFMBs shown to the left (blue). (d) KEGG pathway enrichment analysis for differentially expressed genes between PCL-mFiBs and nFMBs groups; dot size represents the number of genes mapped to each pathway (Count), dot color indicates adjusted p value, and the x-axis denotes Gene Ratio. (e) Category network plot (CNP; category–gene network plot) for the PCL-mFiBs vs nFMBs comparison, visualizing representative enriched GO BP terms and their associated genes; gene nodes are colored by fold change and term nodes reflect enrichment significance. (f–i) Heatmaps of selected genes associated with representative GO terms: GO:0000280 (nuclear division), GO:0030198 (extracellular matrix organization), GO:0003012 <t>(muscle</t> system process), and GO:0007519 <t>(skeletal</t> muscle tissue development), respectively; expression patterns are shown across 2D, PCL-mFiBs, and nFMBs, with gene symbols listed alongside each heatmap.
    Crispr Guide Rna Design Tool, supplied by Benchling Inc, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/tool/crispr+design+tool/pmc13155868-62-34-40
    Average 86 stars, based on 1 article reviews
    crispr guide rna design tool - by Bioz Stars, 2026-09
    86/100 stars
    		  Buy from Supplier
    ncbi basic local alignment search tool  (Biotechnology Information)
    86
    Biotechnology Information ncbi basic local alignment search tool
    RNA-seq profiling of human adipose-derived stem cells (hASCs) after 21 days of culture in myogenic <t>differentiation</t> <t>medium.</t> (a) Principal component analysis (PCA) based on transcriptome expression values (FPKM), showing clustering of biological replicates for Monolayer (2D), PCL, and Fibril conditions. (b) Venn diagram showing the overlap of detected genes among Monolayer, PCL, and Fibril groups (numbers indicate gene counts in each intersection). (c) Gene Ontology (GO) Biological Process (BP) over-representation analysis (ORA) for differentially expressed genes in 2D vs nFMBs (left) and PCL-mFiBs vs nFMBs (right); bars are plotted as −log10 (adjusted p value), with terms enriched among genes upregulated in the first condition shown to the right (red) and terms enriched among genes downregulated in nFMBs shown to the left (blue). (d) KEGG pathway enrichment analysis for differentially expressed genes between PCL-mFiBs and nFMBs groups; dot size represents the number of genes mapped to each pathway (Count), dot color indicates adjusted p value, and the x-axis denotes Gene Ratio. (e) Category network plot (CNP; category–gene network plot) for the PCL-mFiBs vs nFMBs comparison, visualizing representative enriched GO BP terms and their associated genes; gene nodes are colored by fold change and term nodes reflect enrichment significance. (f–i) Heatmaps of selected genes associated with representative GO terms: GO:0000280 (nuclear division), GO:0030198 (extracellular matrix organization), GO:0003012 <t>(muscle</t> system process), and GO:0007519 <t>(skeletal</t> muscle tissue development), respectively; expression patterns are shown across 2D, PCL-mFiBs, and nFMBs, with gene symbols listed alongside each heatmap.
    Ncbi Basic Local Alignment Search Tool, supplied by Biotechnology Information, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/tool/alignment+basic+local+search+tool/pmc13141756-116-17-15
    Average 86 stars, based on 1 article reviews
    ncbi basic local alignment search tool - by Bioz Stars, 2026-09
    86/100 stars
    		  Buy from Supplier

    Image Search Results


    RNA-seq profiling of human adipose-derived stem cells (hASCs) after 21 days of culture in myogenic differentiation medium. (a) Principal component analysis (PCA) based on transcriptome expression values (FPKM), showing clustering of biological replicates for Monolayer (2D), PCL, and Fibril conditions. (b) Venn diagram showing the overlap of detected genes among Monolayer, PCL, and Fibril groups (numbers indicate gene counts in each intersection). (c) Gene Ontology (GO) Biological Process (BP) over-representation analysis (ORA) for differentially expressed genes in 2D vs nFMBs (left) and PCL-mFiBs vs nFMBs (right); bars are plotted as −log10 (adjusted p value), with terms enriched among genes upregulated in the first condition shown to the right (red) and terms enriched among genes downregulated in nFMBs shown to the left (blue). (d) KEGG pathway enrichment analysis for differentially expressed genes between PCL-mFiBs and nFMBs groups; dot size represents the number of genes mapped to each pathway (Count), dot color indicates adjusted p value, and the x-axis denotes Gene Ratio. (e) Category network plot (CNP; category–gene network plot) for the PCL-mFiBs vs nFMBs comparison, visualizing representative enriched GO BP terms and their associated genes; gene nodes are colored by fold change and term nodes reflect enrichment significance. (f–i) Heatmaps of selected genes associated with representative GO terms: GO:0000280 (nuclear division), GO:0030198 (extracellular matrix organization), GO:0003012 (muscle system process), and GO:0007519 (skeletal muscle tissue development), respectively; expression patterns are shown across 2D, PCL-mFiBs, and nFMBs, with gene symbols listed alongside each heatmap.

    Journal: Bioactive Materials

    Article Title: Muscle-fiber-inspired nanofibrillar microbundles induce myogenic differentiation in human adipose-derived stem cells

    doi: 10.1016/j.bioactmat.2026.03.020

    Figure Lengend Snippet: RNA-seq profiling of human adipose-derived stem cells (hASCs) after 21 days of culture in myogenic differentiation medium. (a) Principal component analysis (PCA) based on transcriptome expression values (FPKM), showing clustering of biological replicates for Monolayer (2D), PCL, and Fibril conditions. (b) Venn diagram showing the overlap of detected genes among Monolayer, PCL, and Fibril groups (numbers indicate gene counts in each intersection). (c) Gene Ontology (GO) Biological Process (BP) over-representation analysis (ORA) for differentially expressed genes in 2D vs nFMBs (left) and PCL-mFiBs vs nFMBs (right); bars are plotted as −log10 (adjusted p value), with terms enriched among genes upregulated in the first condition shown to the right (red) and terms enriched among genes downregulated in nFMBs shown to the left (blue). (d) KEGG pathway enrichment analysis for differentially expressed genes between PCL-mFiBs and nFMBs groups; dot size represents the number of genes mapped to each pathway (Count), dot color indicates adjusted p value, and the x-axis denotes Gene Ratio. (e) Category network plot (CNP; category–gene network plot) for the PCL-mFiBs vs nFMBs comparison, visualizing representative enriched GO BP terms and their associated genes; gene nodes are colored by fold change and term nodes reflect enrichment significance. (f–i) Heatmaps of selected genes associated with representative GO terms: GO:0000280 (nuclear division), GO:0030198 (extracellular matrix organization), GO:0003012 (muscle system process), and GO:0007519 (skeletal muscle tissue development), respectively; expression patterns are shown across 2D, PCL-mFiBs, and nFMBs, with gene symbols listed alongside each heatmap.

    Article Snippet: For HSkMCs, myogenic differentiation was induced using Skeletal Muscle Differentiation Medium (ATCC, Manassas, USA).

    Techniques: RNA Sequencing, Derivative Assay, Cell Characterization, Expressing, Comparison