Review



quickchange protocol  (Qiagen)


Bioz Verified Symbol Qiagen is a verified supplier
Bioz Manufacturer Symbol Qiagen manufactures this product  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 90

    Structured Review

    Qiagen quickchange protocol
    Quickchange Protocol, supplied by Qiagen, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/quickchange+protocol/quickchange+protocol/pmc03323742-85-44-14
    Average 90 stars, based on 1 article reviews
    quickchange protocol - by Bioz Stars, 2026-10
    90/100 stars

    Images

    Related Articles

    Mutagenesis:

    Article Title: Structure of geranyl diphosphate C -methyltransferase from Streptomyces coelicolor and implications for the mechanism of isoprenoid modification
    Article Snippet: The Y51F GPPMT mutant was prepared using the QuickChange protocol (Qiagen Inc., USA) with the mutagenic primers CTATCACCACCACTTCGGCATCGGCCCCG (sense) and CGGGGCCGATGCCGAAGTGGTGGTGATAG (antisense).

    Article Title: Structure of 2-methylisoborneol synthase from Streptomyces coelicolor and implications for the cyclization of a non-canonical C -methylated monoterpenoid substrate
    Article Snippet: Mutagenesis and Activity Assays Site-directed mutagenesis studies were performed according to the QuickChange protocol (Qiagen Inc., USA) using the full-length MIBS gene carrying the N-terminal hexahistidine tag and the following mutagenic primers: E193A, CTGATGGTCGCGGCGAACGCGGTGGAC (sense), GTCCACCGCGTTCGCCGCGACCATCAG (antisense); E193D, CTGATGGTCGCGGAC AACGCGGTGGAC (sense), GTCCACCGCGTTGTCCGCGACCATCAG (antisense); E193L, CTGATGGTCGCGCTGAACGCGGTGGAC (sense), GTCCACCGCGTTCAGCGCGACCATCAG (antisense); Y169F, CGGTGGGCCGCTTCATGGTCGGCTG (sense), CAGCCGACCATGAAGCGGCCCACCG (antisense).

    Article Title: Perturbation of the tRNA Tertiary Core Differentially Affects Specific Steps of the Elongation Cycle
    Article Snippet: Mutations were introduced into plasmid pTFMa (a derivative of pUC18) containing E. coli WT-tRNA Phe sequence using the QuickChange protocol (Qiagen) and confirmed by DNA sequencing.

    Article Title: Deregulated Cdk5 promotes oxidative stress and mitochondrial dysfunction.
    Article Snippet: Cloning, expression and purification of Cdk5, Cdk5 (F80G), and p25 The mutant Cdk5 protein (F80G) (Cdk5-as1) construct was generated from Cdk5 in pGEX-2T bacterial expression system using the Quickchange protocol from Qiagen (Valencia, CA, USA) according to the manufacturer’s instructions.

    Article Title: Structure of 2-methylisoborneol synthase from Streptomyces coelicolor and implications for the cyclization of a non-canonical C -methylated monoterpenoid substrate
    Article Snippet: Site-directed mutagenesis studies were performed according to the QuickChange protocol (Qiagen Inc., USA) using the full-length MIBS gene carrying the N-terminal hexahistidine tag and the following mutagenic primers: E193A, CTGATGGTCGCGGCGAACGCGGTGGAC (sense), GTCCACCGCGTTCGCCGCGACCATCAG (antisense); E193D, CTGATGGTCGCGGAC AACGCGGTGGAC (sense), GTCCACCGCGTTGTCCGCGACCATCAG (antisense); E193L, CTGATGGTCGCGCTGAACGCGGTGGAC (sense), GTCCACCGCGTTCAGCGCGACCATCAG (antisense); Y169F, CGGTGGGCCGCTTCATGGTCGGCTG (sense), CAGCCGACCATGAAGCGGCCCACCG (antisense).

    Article Title: Perturbation of the tRNA Tertiary Core Differentially Affects Specific Steps of the Elongation Cycle
    Article Snippet: The plasmid was extracted, restricted, and then transcribed using the EPICENTRE Ampliscribe T7 flash transcription kit. mRNA was purified by precipitation with 2.5 m LiCl on ice (30 min). mRNA022CUC was made by mutation of UUU to CUC, using the QuickChange protocol (Qiagen) followed by a preparation procedure essentially identical to that described for making mRNA022UUU. tRNAs —Native E. coli tRNA fMet and tRNA Phe were acquired from Chemical Block (Moscow, Russia).

    Article Title: Perturbation of the tRNA Tertiary Core Differentially Affects Specific Steps of the Elongation Cycle
    Article Snippet: Mutations were introduced into plasmid pTFMa (a derivative of pUC18) containing E. coliWT-tRNAPhe sequence using theQuickChange protocol (Qiagen) and confirmed by DNA sequencing.

    Article Title: Structure of geranyl diphosphate C -methyltransferase from Streptomyces coelicolor and implications for the mechanism of isoprenoid modification
    Article Snippet: Preparation and Assay of Y51F GPPMT The Y51F GPPMT mutant was prepared using the QuickChange protocol (Qiagen Inc., USA) with the mutagenic primers CTATCACCACCACTTCGGCATCGGCCCCG (sense) and CGGGGCCGATGCCGAAGTGGTGGTGATAG (antisense).

    Activity Assay:

    Article Title: Structure of geranyl diphosphate C -methyltransferase from Streptomyces coelicolor and implications for the mechanism of isoprenoid modification
    Article Snippet: The Y51F GPPMT mutant was prepared using the QuickChange protocol (Qiagen Inc., USA) with the mutagenic primers CTATCACCACCACTTCGGCATCGGCCCCG (sense) and CGGGGCCGATGCCGAAGTGGTGGTGATAG (antisense).

    Article Title: Structure of 2-methylisoborneol synthase from Streptomyces coelicolor and implications for the cyclization of a non-canonical C -methylated monoterpenoid substrate
    Article Snippet: Mutagenesis and Activity Assays Site-directed mutagenesis studies were performed according to the QuickChange protocol (Qiagen Inc., USA) using the full-length MIBS gene carrying the N-terminal hexahistidine tag and the following mutagenic primers: E193A, CTGATGGTCGCGGCGAACGCGGTGGAC (sense), GTCCACCGCGTTCGCCGCGACCATCAG (antisense); E193D, CTGATGGTCGCGGAC AACGCGGTGGAC (sense), GTCCACCGCGTTGTCCGCGACCATCAG (antisense); E193L, CTGATGGTCGCGCTGAACGCGGTGGAC (sense), GTCCACCGCGTTCAGCGCGACCATCAG (antisense); Y169F, CGGTGGGCCGCTTCATGGTCGGCTG (sense), CAGCCGACCATGAAGCGGCCCACCG (antisense).

    Article Title: Perturbation of the tRNA Tertiary Core Differentially Affects Specific Steps of the Elongation Cycle
    Article Snippet: Mutations were introduced into plasmid pTFMa (a derivative of pUC18) containing E. coli WT-tRNA Phe sequence using the QuickChange protocol (Qiagen) and confirmed by DNA sequencing.

    Article Title: Deregulated Cdk5 promotes oxidative stress and mitochondrial dysfunction.
    Article Snippet: Cloning, expression and purification of Cdk5, Cdk5 (F80G), and p25 The mutant Cdk5 protein (F80G) (Cdk5-as1) construct was generated from Cdk5 in pGEX-2T bacterial expression system using the Quickchange protocol from Qiagen (Valencia, CA, USA) according to the manufacturer’s instructions.

    Article Title: Structure of 2-methylisoborneol synthase from Streptomyces coelicolor and implications for the cyclization of a non-canonical C -methylated monoterpenoid substrate
    Article Snippet: Site-directed mutagenesis studies were performed according to the QuickChange protocol (Qiagen Inc., USA) using the full-length MIBS gene carrying the N-terminal hexahistidine tag and the following mutagenic primers: E193A, CTGATGGTCGCGGCGAACGCGGTGGAC (sense), GTCCACCGCGTTCGCCGCGACCATCAG (antisense); E193D, CTGATGGTCGCGGAC AACGCGGTGGAC (sense), GTCCACCGCGTTGTCCGCGACCATCAG (antisense); E193L, CTGATGGTCGCGCTGAACGCGGTGGAC (sense), GTCCACCGCGTTCAGCGCGACCATCAG (antisense); Y169F, CGGTGGGCCGCTTCATGGTCGGCTG (sense), CAGCCGACCATGAAGCGGCCCACCG (antisense).

    Article Title: Perturbation of the tRNA Tertiary Core Differentially Affects Specific Steps of the Elongation Cycle
    Article Snippet: The plasmid was extracted, restricted, and then transcribed using the EPICENTRE Ampliscribe T7 flash transcription kit. mRNA was purified by precipitation with 2.5 m LiCl on ice (30 min). mRNA022CUC was made by mutation of UUU to CUC, using the QuickChange protocol (Qiagen) followed by a preparation procedure essentially identical to that described for making mRNA022UUU. tRNAs —Native E. coli tRNA fMet and tRNA Phe were acquired from Chemical Block (Moscow, Russia).

    Article Title: Perturbation of the tRNA Tertiary Core Differentially Affects Specific Steps of the Elongation Cycle
    Article Snippet: Mutations were introduced into plasmid pTFMa (a derivative of pUC18) containing E. coliWT-tRNAPhe sequence using theQuickChange protocol (Qiagen) and confirmed by DNA sequencing.

    Article Title: Structure of geranyl diphosphate C -methyltransferase from Streptomyces coelicolor and implications for the mechanism of isoprenoid modification
    Article Snippet: Preparation and Assay of Y51F GPPMT The Y51F GPPMT mutant was prepared using the QuickChange protocol (Qiagen Inc., USA) with the mutagenic primers CTATCACCACCACTTCGGCATCGGCCCCG (sense) and CGGGGCCGATGCCGAAGTGGTGGTGATAG (antisense).

    Plasmid Preparation:

    Article Title: Structure of geranyl diphosphate C -methyltransferase from Streptomyces coelicolor and implications for the mechanism of isoprenoid modification
    Article Snippet: The Y51F GPPMT mutant was prepared using the QuickChange protocol (Qiagen Inc., USA) with the mutagenic primers CTATCACCACCACTTCGGCATCGGCCCCG (sense) and CGGGGCCGATGCCGAAGTGGTGGTGATAG (antisense).

    Article Title: Structure of 2-methylisoborneol synthase from Streptomyces coelicolor and implications for the cyclization of a non-canonical C -methylated monoterpenoid substrate
    Article Snippet: Mutagenesis and Activity Assays Site-directed mutagenesis studies were performed according to the QuickChange protocol (Qiagen Inc., USA) using the full-length MIBS gene carrying the N-terminal hexahistidine tag and the following mutagenic primers: E193A, CTGATGGTCGCGGCGAACGCGGTGGAC (sense), GTCCACCGCGTTCGCCGCGACCATCAG (antisense); E193D, CTGATGGTCGCGGAC AACGCGGTGGAC (sense), GTCCACCGCGTTGTCCGCGACCATCAG (antisense); E193L, CTGATGGTCGCGCTGAACGCGGTGGAC (sense), GTCCACCGCGTTCAGCGCGACCATCAG (antisense); Y169F, CGGTGGGCCGCTTCATGGTCGGCTG (sense), CAGCCGACCATGAAGCGGCCCACCG (antisense).

    Article Title: Perturbation of the tRNA Tertiary Core Differentially Affects Specific Steps of the Elongation Cycle
    Article Snippet: Mutations were introduced into plasmid pTFMa (a derivative of pUC18) containing E. coli WT-tRNA Phe sequence using the QuickChange protocol (Qiagen) and confirmed by DNA sequencing.

    Article Title: Deregulated Cdk5 promotes oxidative stress and mitochondrial dysfunction.
    Article Snippet: Cloning, expression and purification of Cdk5, Cdk5 (F80G), and p25 The mutant Cdk5 protein (F80G) (Cdk5-as1) construct was generated from Cdk5 in pGEX-2T bacterial expression system using the Quickchange protocol from Qiagen (Valencia, CA, USA) according to the manufacturer’s instructions.

    Article Title: Structure of 2-methylisoborneol synthase from Streptomyces coelicolor and implications for the cyclization of a non-canonical C -methylated monoterpenoid substrate
    Article Snippet: Site-directed mutagenesis studies were performed according to the QuickChange protocol (Qiagen Inc., USA) using the full-length MIBS gene carrying the N-terminal hexahistidine tag and the following mutagenic primers: E193A, CTGATGGTCGCGGCGAACGCGGTGGAC (sense), GTCCACCGCGTTCGCCGCGACCATCAG (antisense); E193D, CTGATGGTCGCGGAC AACGCGGTGGAC (sense), GTCCACCGCGTTGTCCGCGACCATCAG (antisense); E193L, CTGATGGTCGCGCTGAACGCGGTGGAC (sense), GTCCACCGCGTTCAGCGCGACCATCAG (antisense); Y169F, CGGTGGGCCGCTTCATGGTCGGCTG (sense), CAGCCGACCATGAAGCGGCCCACCG (antisense).

    Article Title: Perturbation of the tRNA Tertiary Core Differentially Affects Specific Steps of the Elongation Cycle
    Article Snippet: The plasmid was extracted, restricted, and then transcribed using the EPICENTRE Ampliscribe T7 flash transcription kit. mRNA was purified by precipitation with 2.5 m LiCl on ice (30 min). mRNA022CUC was made by mutation of UUU to CUC, using the QuickChange protocol (Qiagen) followed by a preparation procedure essentially identical to that described for making mRNA022UUU. tRNAs —Native E. coli tRNA fMet and tRNA Phe were acquired from Chemical Block (Moscow, Russia).

    Article Title: Perturbation of the tRNA Tertiary Core Differentially Affects Specific Steps of the Elongation Cycle
    Article Snippet: Mutations were introduced into plasmid pTFMa (a derivative of pUC18) containing E. coliWT-tRNAPhe sequence using theQuickChange protocol (Qiagen) and confirmed by DNA sequencing.

    Article Title: Structure of geranyl diphosphate C -methyltransferase from Streptomyces coelicolor and implications for the mechanism of isoprenoid modification
    Article Snippet: Preparation and Assay of Y51F GPPMT The Y51F GPPMT mutant was prepared using the QuickChange protocol (Qiagen Inc., USA) with the mutagenic primers CTATCACCACCACTTCGGCATCGGCCCCG (sense) and CGGGGCCGATGCCGAAGTGGTGGTGATAG (antisense).

    Purification:

    Article Title: Structure of geranyl diphosphate C -methyltransferase from Streptomyces coelicolor and implications for the mechanism of isoprenoid modification
    Article Snippet: The Y51F GPPMT mutant was prepared using the QuickChange protocol (Qiagen Inc., USA) with the mutagenic primers CTATCACCACCACTTCGGCATCGGCCCCG (sense) and CGGGGCCGATGCCGAAGTGGTGGTGATAG (antisense).

    Article Title: Structure of 2-methylisoborneol synthase from Streptomyces coelicolor and implications for the cyclization of a non-canonical C -methylated monoterpenoid substrate
    Article Snippet: Mutagenesis and Activity Assays Site-directed mutagenesis studies were performed according to the QuickChange protocol (Qiagen Inc., USA) using the full-length MIBS gene carrying the N-terminal hexahistidine tag and the following mutagenic primers: E193A, CTGATGGTCGCGGCGAACGCGGTGGAC (sense), GTCCACCGCGTTCGCCGCGACCATCAG (antisense); E193D, CTGATGGTCGCGGAC AACGCGGTGGAC (sense), GTCCACCGCGTTGTCCGCGACCATCAG (antisense); E193L, CTGATGGTCGCGCTGAACGCGGTGGAC (sense), GTCCACCGCGTTCAGCGCGACCATCAG (antisense); Y169F, CGGTGGGCCGCTTCATGGTCGGCTG (sense), CAGCCGACCATGAAGCGGCCCACCG (antisense).

    Article Title: Perturbation of the tRNA Tertiary Core Differentially Affects Specific Steps of the Elongation Cycle
    Article Snippet: Mutations were introduced into plasmid pTFMa (a derivative of pUC18) containing E. coli WT-tRNA Phe sequence using the QuickChange protocol (Qiagen) and confirmed by DNA sequencing.

    Article Title: Deregulated Cdk5 promotes oxidative stress and mitochondrial dysfunction.
    Article Snippet: Cloning, expression and purification of Cdk5, Cdk5 (F80G), and p25 The mutant Cdk5 protein (F80G) (Cdk5-as1) construct was generated from Cdk5 in pGEX-2T bacterial expression system using the Quickchange protocol from Qiagen (Valencia, CA, USA) according to the manufacturer’s instructions.

    Article Title: Structure of 2-methylisoborneol synthase from Streptomyces coelicolor and implications for the cyclization of a non-canonical C -methylated monoterpenoid substrate
    Article Snippet: Site-directed mutagenesis studies were performed according to the QuickChange protocol (Qiagen Inc., USA) using the full-length MIBS gene carrying the N-terminal hexahistidine tag and the following mutagenic primers: E193A, CTGATGGTCGCGGCGAACGCGGTGGAC (sense), GTCCACCGCGTTCGCCGCGACCATCAG (antisense); E193D, CTGATGGTCGCGGAC AACGCGGTGGAC (sense), GTCCACCGCGTTGTCCGCGACCATCAG (antisense); E193L, CTGATGGTCGCGCTGAACGCGGTGGAC (sense), GTCCACCGCGTTCAGCGCGACCATCAG (antisense); Y169F, CGGTGGGCCGCTTCATGGTCGGCTG (sense), CAGCCGACCATGAAGCGGCCCACCG (antisense).

    Article Title: Perturbation of the tRNA Tertiary Core Differentially Affects Specific Steps of the Elongation Cycle
    Article Snippet: The plasmid was extracted, restricted, and then transcribed using the EPICENTRE Ampliscribe T7 flash transcription kit. mRNA was purified by precipitation with 2.5 m LiCl on ice (30 min). mRNA022CUC was made by mutation of UUU to CUC, using the QuickChange protocol (Qiagen) followed by a preparation procedure essentially identical to that described for making mRNA022UUU. tRNAs —Native E. coli tRNA fMet and tRNA Phe were acquired from Chemical Block (Moscow, Russia).

    Article Title: Perturbation of the tRNA Tertiary Core Differentially Affects Specific Steps of the Elongation Cycle
    Article Snippet: Mutations were introduced into plasmid pTFMa (a derivative of pUC18) containing E. coliWT-tRNAPhe sequence using theQuickChange protocol (Qiagen) and confirmed by DNA sequencing.

    Article Title: Structure of geranyl diphosphate C -methyltransferase from Streptomyces coelicolor and implications for the mechanism of isoprenoid modification
    Article Snippet: Preparation and Assay of Y51F GPPMT The Y51F GPPMT mutant was prepared using the QuickChange protocol (Qiagen Inc., USA) with the mutagenic primers CTATCACCACCACTTCGGCATCGGCCCCG (sense) and CGGGGCCGATGCCGAAGTGGTGGTGATAG (antisense).

    Blocking Assay:

    Article Title: Structure of geranyl diphosphate C -methyltransferase from Streptomyces coelicolor and implications for the mechanism of isoprenoid modification
    Article Snippet: The Y51F GPPMT mutant was prepared using the QuickChange protocol (Qiagen Inc., USA) with the mutagenic primers CTATCACCACCACTTCGGCATCGGCCCCG (sense) and CGGGGCCGATGCCGAAGTGGTGGTGATAG (antisense).

    Article Title: Structure of 2-methylisoborneol synthase from Streptomyces coelicolor and implications for the cyclization of a non-canonical C -methylated monoterpenoid substrate
    Article Snippet: Mutagenesis and Activity Assays Site-directed mutagenesis studies were performed according to the QuickChange protocol (Qiagen Inc., USA) using the full-length MIBS gene carrying the N-terminal hexahistidine tag and the following mutagenic primers: E193A, CTGATGGTCGCGGCGAACGCGGTGGAC (sense), GTCCACCGCGTTCGCCGCGACCATCAG (antisense); E193D, CTGATGGTCGCGGAC AACGCGGTGGAC (sense), GTCCACCGCGTTGTCCGCGACCATCAG (antisense); E193L, CTGATGGTCGCGCTGAACGCGGTGGAC (sense), GTCCACCGCGTTCAGCGCGACCATCAG (antisense); Y169F, CGGTGGGCCGCTTCATGGTCGGCTG (sense), CAGCCGACCATGAAGCGGCCCACCG (antisense).

    Article Title: Perturbation of the tRNA Tertiary Core Differentially Affects Specific Steps of the Elongation Cycle
    Article Snippet: Mutations were introduced into plasmid pTFMa (a derivative of pUC18) containing E. coli WT-tRNA Phe sequence using the QuickChange protocol (Qiagen) and confirmed by DNA sequencing.

    Article Title: Deregulated Cdk5 promotes oxidative stress and mitochondrial dysfunction.
    Article Snippet: Cloning, expression and purification of Cdk5, Cdk5 (F80G), and p25 The mutant Cdk5 protein (F80G) (Cdk5-as1) construct was generated from Cdk5 in pGEX-2T bacterial expression system using the Quickchange protocol from Qiagen (Valencia, CA, USA) according to the manufacturer’s instructions.

    Article Title: Structure of 2-methylisoborneol synthase from Streptomyces coelicolor and implications for the cyclization of a non-canonical C -methylated monoterpenoid substrate
    Article Snippet: Site-directed mutagenesis studies were performed according to the QuickChange protocol (Qiagen Inc., USA) using the full-length MIBS gene carrying the N-terminal hexahistidine tag and the following mutagenic primers: E193A, CTGATGGTCGCGGCGAACGCGGTGGAC (sense), GTCCACCGCGTTCGCCGCGACCATCAG (antisense); E193D, CTGATGGTCGCGGAC AACGCGGTGGAC (sense), GTCCACCGCGTTGTCCGCGACCATCAG (antisense); E193L, CTGATGGTCGCGCTGAACGCGGTGGAC (sense), GTCCACCGCGTTCAGCGCGACCATCAG (antisense); Y169F, CGGTGGGCCGCTTCATGGTCGGCTG (sense), CAGCCGACCATGAAGCGGCCCACCG (antisense).

    Article Title: Perturbation of the tRNA Tertiary Core Differentially Affects Specific Steps of the Elongation Cycle
    Article Snippet: The plasmid was extracted, restricted, and then transcribed using the EPICENTRE Ampliscribe T7 flash transcription kit. mRNA was purified by precipitation with 2.5 m LiCl on ice (30 min). mRNA022CUC was made by mutation of UUU to CUC, using the QuickChange protocol (Qiagen) followed by a preparation procedure essentially identical to that described for making mRNA022UUU. tRNAs —Native E. coli tRNA fMet and tRNA Phe were acquired from Chemical Block (Moscow, Russia).

    Article Title: Perturbation of the tRNA Tertiary Core Differentially Affects Specific Steps of the Elongation Cycle
    Article Snippet: Mutations were introduced into plasmid pTFMa (a derivative of pUC18) containing E. coliWT-tRNAPhe sequence using theQuickChange protocol (Qiagen) and confirmed by DNA sequencing.

    Article Title: Structure of geranyl diphosphate C -methyltransferase from Streptomyces coelicolor and implications for the mechanism of isoprenoid modification
    Article Snippet: Preparation and Assay of Y51F GPPMT The Y51F GPPMT mutant was prepared using the QuickChange protocol (Qiagen Inc., USA) with the mutagenic primers CTATCACCACCACTTCGGCATCGGCCCCG (sense) and CGGGGCCGATGCCGAAGTGGTGGTGATAG (antisense).

    Concentration Assay:

    Article Title: Structure of geranyl diphosphate C -methyltransferase from Streptomyces coelicolor and implications for the mechanism of isoprenoid modification
    Article Snippet: The Y51F GPPMT mutant was prepared using the QuickChange protocol (Qiagen Inc., USA) with the mutagenic primers CTATCACCACCACTTCGGCATCGGCCCCG (sense) and CGGGGCCGATGCCGAAGTGGTGGTGATAG (antisense).

    Article Title: Structure of 2-methylisoborneol synthase from Streptomyces coelicolor and implications for the cyclization of a non-canonical C -methylated monoterpenoid substrate
    Article Snippet: Mutagenesis and Activity Assays Site-directed mutagenesis studies were performed according to the QuickChange protocol (Qiagen Inc., USA) using the full-length MIBS gene carrying the N-terminal hexahistidine tag and the following mutagenic primers: E193A, CTGATGGTCGCGGCGAACGCGGTGGAC (sense), GTCCACCGCGTTCGCCGCGACCATCAG (antisense); E193D, CTGATGGTCGCGGAC AACGCGGTGGAC (sense), GTCCACCGCGTTGTCCGCGACCATCAG (antisense); E193L, CTGATGGTCGCGCTGAACGCGGTGGAC (sense), GTCCACCGCGTTCAGCGCGACCATCAG (antisense); Y169F, CGGTGGGCCGCTTCATGGTCGGCTG (sense), CAGCCGACCATGAAGCGGCCCACCG (antisense).

    Article Title: Perturbation of the tRNA Tertiary Core Differentially Affects Specific Steps of the Elongation Cycle
    Article Snippet: Mutations were introduced into plasmid pTFMa (a derivative of pUC18) containing E. coli WT-tRNA Phe sequence using the QuickChange protocol (Qiagen) and confirmed by DNA sequencing.

    Article Title: Deregulated Cdk5 promotes oxidative stress and mitochondrial dysfunction.
    Article Snippet: Cloning, expression and purification of Cdk5, Cdk5 (F80G), and p25 The mutant Cdk5 protein (F80G) (Cdk5-as1) construct was generated from Cdk5 in pGEX-2T bacterial expression system using the Quickchange protocol from Qiagen (Valencia, CA, USA) according to the manufacturer’s instructions.

    Article Title: Structure of 2-methylisoborneol synthase from Streptomyces coelicolor and implications for the cyclization of a non-canonical C -methylated monoterpenoid substrate
    Article Snippet: Site-directed mutagenesis studies were performed according to the QuickChange protocol (Qiagen Inc., USA) using the full-length MIBS gene carrying the N-terminal hexahistidine tag and the following mutagenic primers: E193A, CTGATGGTCGCGGCGAACGCGGTGGAC (sense), GTCCACCGCGTTCGCCGCGACCATCAG (antisense); E193D, CTGATGGTCGCGGAC AACGCGGTGGAC (sense), GTCCACCGCGTTGTCCGCGACCATCAG (antisense); E193L, CTGATGGTCGCGCTGAACGCGGTGGAC (sense), GTCCACCGCGTTCAGCGCGACCATCAG (antisense); Y169F, CGGTGGGCCGCTTCATGGTCGGCTG (sense), CAGCCGACCATGAAGCGGCCCACCG (antisense).

    Article Title: Perturbation of the tRNA Tertiary Core Differentially Affects Specific Steps of the Elongation Cycle
    Article Snippet: The plasmid was extracted, restricted, and then transcribed using the EPICENTRE Ampliscribe T7 flash transcription kit. mRNA was purified by precipitation with 2.5 m LiCl on ice (30 min). mRNA022CUC was made by mutation of UUU to CUC, using the QuickChange protocol (Qiagen) followed by a preparation procedure essentially identical to that described for making mRNA022UUU. tRNAs —Native E. coli tRNA fMet and tRNA Phe were acquired from Chemical Block (Moscow, Russia).

    Article Title: Perturbation of the tRNA Tertiary Core Differentially Affects Specific Steps of the Elongation Cycle
    Article Snippet: Mutations were introduced into plasmid pTFMa (a derivative of pUC18) containing E. coliWT-tRNAPhe sequence using theQuickChange protocol (Qiagen) and confirmed by DNA sequencing.

    Article Title: Structure of geranyl diphosphate C -methyltransferase from Streptomyces coelicolor and implications for the mechanism of isoprenoid modification
    Article Snippet: Preparation and Assay of Y51F GPPMT The Y51F GPPMT mutant was prepared using the QuickChange protocol (Qiagen Inc., USA) with the mutagenic primers CTATCACCACCACTTCGGCATCGGCCCCG (sense) and CGGGGCCGATGCCGAAGTGGTGGTGATAG (antisense).

    Fluorescence:

    Article Title: Structure of geranyl diphosphate C -methyltransferase from Streptomyces coelicolor and implications for the mechanism of isoprenoid modification
    Article Snippet: The Y51F GPPMT mutant was prepared using the QuickChange protocol (Qiagen Inc., USA) with the mutagenic primers CTATCACCACCACTTCGGCATCGGCCCCG (sense) and CGGGGCCGATGCCGAAGTGGTGGTGATAG (antisense).

    Article Title: Structure of 2-methylisoborneol synthase from Streptomyces coelicolor and implications for the cyclization of a non-canonical C -methylated monoterpenoid substrate
    Article Snippet: Mutagenesis and Activity Assays Site-directed mutagenesis studies were performed according to the QuickChange protocol (Qiagen Inc., USA) using the full-length MIBS gene carrying the N-terminal hexahistidine tag and the following mutagenic primers: E193A, CTGATGGTCGCGGCGAACGCGGTGGAC (sense), GTCCACCGCGTTCGCCGCGACCATCAG (antisense); E193D, CTGATGGTCGCGGAC AACGCGGTGGAC (sense), GTCCACCGCGTTGTCCGCGACCATCAG (antisense); E193L, CTGATGGTCGCGCTGAACGCGGTGGAC (sense), GTCCACCGCGTTCAGCGCGACCATCAG (antisense); Y169F, CGGTGGGCCGCTTCATGGTCGGCTG (sense), CAGCCGACCATGAAGCGGCCCACCG (antisense).

    Article Title: Perturbation of the tRNA Tertiary Core Differentially Affects Specific Steps of the Elongation Cycle
    Article Snippet: Mutations were introduced into plasmid pTFMa (a derivative of pUC18) containing E. coli WT-tRNA Phe sequence using the QuickChange protocol (Qiagen) and confirmed by DNA sequencing.

    Article Title: Deregulated Cdk5 promotes oxidative stress and mitochondrial dysfunction.
    Article Snippet: Cloning, expression and purification of Cdk5, Cdk5 (F80G), and p25 The mutant Cdk5 protein (F80G) (Cdk5-as1) construct was generated from Cdk5 in pGEX-2T bacterial expression system using the Quickchange protocol from Qiagen (Valencia, CA, USA) according to the manufacturer’s instructions.

    Article Title: Structure of 2-methylisoborneol synthase from Streptomyces coelicolor and implications for the cyclization of a non-canonical C -methylated monoterpenoid substrate
    Article Snippet: Site-directed mutagenesis studies were performed according to the QuickChange protocol (Qiagen Inc., USA) using the full-length MIBS gene carrying the N-terminal hexahistidine tag and the following mutagenic primers: E193A, CTGATGGTCGCGGCGAACGCGGTGGAC (sense), GTCCACCGCGTTCGCCGCGACCATCAG (antisense); E193D, CTGATGGTCGCGGAC AACGCGGTGGAC (sense), GTCCACCGCGTTGTCCGCGACCATCAG (antisense); E193L, CTGATGGTCGCGCTGAACGCGGTGGAC (sense), GTCCACCGCGTTCAGCGCGACCATCAG (antisense); Y169F, CGGTGGGCCGCTTCATGGTCGGCTG (sense), CAGCCGACCATGAAGCGGCCCACCG (antisense).

    Article Title: Perturbation of the tRNA Tertiary Core Differentially Affects Specific Steps of the Elongation Cycle
    Article Snippet: The plasmid was extracted, restricted, and then transcribed using the EPICENTRE Ampliscribe T7 flash transcription kit. mRNA was purified by precipitation with 2.5 m LiCl on ice (30 min). mRNA022CUC was made by mutation of UUU to CUC, using the QuickChange protocol (Qiagen) followed by a preparation procedure essentially identical to that described for making mRNA022UUU. tRNAs —Native E. coli tRNA fMet and tRNA Phe were acquired from Chemical Block (Moscow, Russia).

    Article Title: Perturbation of the tRNA Tertiary Core Differentially Affects Specific Steps of the Elongation Cycle
    Article Snippet: Mutations were introduced into plasmid pTFMa (a derivative of pUC18) containing E. coliWT-tRNAPhe sequence using theQuickChange protocol (Qiagen) and confirmed by DNA sequencing.

    Article Title: Structure of geranyl diphosphate C -methyltransferase from Streptomyces coelicolor and implications for the mechanism of isoprenoid modification
    Article Snippet: Preparation and Assay of Y51F GPPMT The Y51F GPPMT mutant was prepared using the QuickChange protocol (Qiagen Inc., USA) with the mutagenic primers CTATCACCACCACTTCGGCATCGGCCCCG (sense) and CGGGGCCGATGCCGAAGTGGTGGTGATAG (antisense).

    Binding Assay:

    Article Title: Structure of geranyl diphosphate C -methyltransferase from Streptomyces coelicolor and implications for the mechanism of isoprenoid modification
    Article Snippet: The Y51F GPPMT mutant was prepared using the QuickChange protocol (Qiagen Inc., USA) with the mutagenic primers CTATCACCACCACTTCGGCATCGGCCCCG (sense) and CGGGGCCGATGCCGAAGTGGTGGTGATAG (antisense).

    Article Title: Structure of 2-methylisoborneol synthase from Streptomyces coelicolor and implications for the cyclization of a non-canonical C -methylated monoterpenoid substrate
    Article Snippet: Mutagenesis and Activity Assays Site-directed mutagenesis studies were performed according to the QuickChange protocol (Qiagen Inc., USA) using the full-length MIBS gene carrying the N-terminal hexahistidine tag and the following mutagenic primers: E193A, CTGATGGTCGCGGCGAACGCGGTGGAC (sense), GTCCACCGCGTTCGCCGCGACCATCAG (antisense); E193D, CTGATGGTCGCGGAC AACGCGGTGGAC (sense), GTCCACCGCGTTGTCCGCGACCATCAG (antisense); E193L, CTGATGGTCGCGCTGAACGCGGTGGAC (sense), GTCCACCGCGTTCAGCGCGACCATCAG (antisense); Y169F, CGGTGGGCCGCTTCATGGTCGGCTG (sense), CAGCCGACCATGAAGCGGCCCACCG (antisense).

    Article Title: Perturbation of the tRNA Tertiary Core Differentially Affects Specific Steps of the Elongation Cycle
    Article Snippet: Mutations were introduced into plasmid pTFMa (a derivative of pUC18) containing E. coli WT-tRNA Phe sequence using the QuickChange protocol (Qiagen) and confirmed by DNA sequencing.

    Article Title: Deregulated Cdk5 promotes oxidative stress and mitochondrial dysfunction.
    Article Snippet: Cloning, expression and purification of Cdk5, Cdk5 (F80G), and p25 The mutant Cdk5 protein (F80G) (Cdk5-as1) construct was generated from Cdk5 in pGEX-2T bacterial expression system using the Quickchange protocol from Qiagen (Valencia, CA, USA) according to the manufacturer’s instructions.

    Article Title: Structure of 2-methylisoborneol synthase from Streptomyces coelicolor and implications for the cyclization of a non-canonical C -methylated monoterpenoid substrate
    Article Snippet: Site-directed mutagenesis studies were performed according to the QuickChange protocol (Qiagen Inc., USA) using the full-length MIBS gene carrying the N-terminal hexahistidine tag and the following mutagenic primers: E193A, CTGATGGTCGCGGCGAACGCGGTGGAC (sense), GTCCACCGCGTTCGCCGCGACCATCAG (antisense); E193D, CTGATGGTCGCGGAC AACGCGGTGGAC (sense), GTCCACCGCGTTGTCCGCGACCATCAG (antisense); E193L, CTGATGGTCGCGCTGAACGCGGTGGAC (sense), GTCCACCGCGTTCAGCGCGACCATCAG (antisense); Y169F, CGGTGGGCCGCTTCATGGTCGGCTG (sense), CAGCCGACCATGAAGCGGCCCACCG (antisense).

    Article Title: Perturbation of the tRNA Tertiary Core Differentially Affects Specific Steps of the Elongation Cycle
    Article Snippet: The plasmid was extracted, restricted, and then transcribed using the EPICENTRE Ampliscribe T7 flash transcription kit. mRNA was purified by precipitation with 2.5 m LiCl on ice (30 min). mRNA022CUC was made by mutation of UUU to CUC, using the QuickChange protocol (Qiagen) followed by a preparation procedure essentially identical to that described for making mRNA022UUU. tRNAs —Native E. coli tRNA fMet and tRNA Phe were acquired from Chemical Block (Moscow, Russia).

    Article Title: Perturbation of the tRNA Tertiary Core Differentially Affects Specific Steps of the Elongation Cycle
    Article Snippet: Mutations were introduced into plasmid pTFMa (a derivative of pUC18) containing E. coliWT-tRNAPhe sequence using theQuickChange protocol (Qiagen) and confirmed by DNA sequencing.

    Article Title: Structure of geranyl diphosphate C -methyltransferase from Streptomyces coelicolor and implications for the mechanism of isoprenoid modification
    Article Snippet: Preparation and Assay of Y51F GPPMT The Y51F GPPMT mutant was prepared using the QuickChange protocol (Qiagen Inc., USA) with the mutagenic primers CTATCACCACCACTTCGGCATCGGCCCCG (sense) and CGGGGCCGATGCCGAAGTGGTGGTGATAG (antisense).

    Cloning:

    Article Title: Structure of geranyl diphosphate C -methyltransferase from Streptomyces coelicolor and implications for the mechanism of isoprenoid modification
    Article Snippet: The Y51F GPPMT mutant was prepared using the QuickChange protocol (Qiagen Inc., USA) with the mutagenic primers CTATCACCACCACTTCGGCATCGGCCCCG (sense) and CGGGGCCGATGCCGAAGTGGTGGTGATAG (antisense).

    Article Title: Structure of 2-methylisoborneol synthase from Streptomyces coelicolor and implications for the cyclization of a non-canonical C -methylated monoterpenoid substrate
    Article Snippet: Mutagenesis and Activity Assays Site-directed mutagenesis studies were performed according to the QuickChange protocol (Qiagen Inc., USA) using the full-length MIBS gene carrying the N-terminal hexahistidine tag and the following mutagenic primers: E193A, CTGATGGTCGCGGCGAACGCGGTGGAC (sense), GTCCACCGCGTTCGCCGCGACCATCAG (antisense); E193D, CTGATGGTCGCGGAC AACGCGGTGGAC (sense), GTCCACCGCGTTGTCCGCGACCATCAG (antisense); E193L, CTGATGGTCGCGCTGAACGCGGTGGAC (sense), GTCCACCGCGTTCAGCGCGACCATCAG (antisense); Y169F, CGGTGGGCCGCTTCATGGTCGGCTG (sense), CAGCCGACCATGAAGCGGCCCACCG (antisense).

    Article Title: Perturbation of the tRNA Tertiary Core Differentially Affects Specific Steps of the Elongation Cycle
    Article Snippet: Mutations were introduced into plasmid pTFMa (a derivative of pUC18) containing E. coli WT-tRNA Phe sequence using the QuickChange protocol (Qiagen) and confirmed by DNA sequencing.

    Article Title: Deregulated Cdk5 promotes oxidative stress and mitochondrial dysfunction.
    Article Snippet: Cloning, expression and purification of Cdk5, Cdk5 (F80G), and p25 The mutant Cdk5 protein (F80G) (Cdk5-as1) construct was generated from Cdk5 in pGEX-2T bacterial expression system using the Quickchange protocol from Qiagen (Valencia, CA, USA) according to the manufacturer’s instructions.

    Article Title: Structure of 2-methylisoborneol synthase from Streptomyces coelicolor and implications for the cyclization of a non-canonical C -methylated monoterpenoid substrate
    Article Snippet: Site-directed mutagenesis studies were performed according to the QuickChange protocol (Qiagen Inc., USA) using the full-length MIBS gene carrying the N-terminal hexahistidine tag and the following mutagenic primers: E193A, CTGATGGTCGCGGCGAACGCGGTGGAC (sense), GTCCACCGCGTTCGCCGCGACCATCAG (antisense); E193D, CTGATGGTCGCGGAC AACGCGGTGGAC (sense), GTCCACCGCGTTGTCCGCGACCATCAG (antisense); E193L, CTGATGGTCGCGCTGAACGCGGTGGAC (sense), GTCCACCGCGTTCAGCGCGACCATCAG (antisense); Y169F, CGGTGGGCCGCTTCATGGTCGGCTG (sense), CAGCCGACCATGAAGCGGCCCACCG (antisense).

    Article Title: Perturbation of the tRNA Tertiary Core Differentially Affects Specific Steps of the Elongation Cycle
    Article Snippet: The plasmid was extracted, restricted, and then transcribed using the EPICENTRE Ampliscribe T7 flash transcription kit. mRNA was purified by precipitation with 2.5 m LiCl on ice (30 min). mRNA022CUC was made by mutation of UUU to CUC, using the QuickChange protocol (Qiagen) followed by a preparation procedure essentially identical to that described for making mRNA022UUU. tRNAs —Native E. coli tRNA fMet and tRNA Phe were acquired from Chemical Block (Moscow, Russia).

    Article Title: Perturbation of the tRNA Tertiary Core Differentially Affects Specific Steps of the Elongation Cycle
    Article Snippet: Mutations were introduced into plasmid pTFMa (a derivative of pUC18) containing E. coliWT-tRNAPhe sequence using theQuickChange protocol (Qiagen) and confirmed by DNA sequencing.

    Article Title: Structure of geranyl diphosphate C -methyltransferase from Streptomyces coelicolor and implications for the mechanism of isoprenoid modification
    Article Snippet: Preparation and Assay of Y51F GPPMT The Y51F GPPMT mutant was prepared using the QuickChange protocol (Qiagen Inc., USA) with the mutagenic primers CTATCACCACCACTTCGGCATCGGCCCCG (sense) and CGGGGCCGATGCCGAAGTGGTGGTGATAG (antisense).

    Expressing:

    Article Title: Structure of geranyl diphosphate C -methyltransferase from Streptomyces coelicolor and implications for the mechanism of isoprenoid modification
    Article Snippet: The Y51F GPPMT mutant was prepared using the QuickChange protocol (Qiagen Inc., USA) with the mutagenic primers CTATCACCACCACTTCGGCATCGGCCCCG (sense) and CGGGGCCGATGCCGAAGTGGTGGTGATAG (antisense).

    Article Title: Structure of 2-methylisoborneol synthase from Streptomyces coelicolor and implications for the cyclization of a non-canonical C -methylated monoterpenoid substrate
    Article Snippet: Mutagenesis and Activity Assays Site-directed mutagenesis studies were performed according to the QuickChange protocol (Qiagen Inc., USA) using the full-length MIBS gene carrying the N-terminal hexahistidine tag and the following mutagenic primers: E193A, CTGATGGTCGCGGCGAACGCGGTGGAC (sense), GTCCACCGCGTTCGCCGCGACCATCAG (antisense); E193D, CTGATGGTCGCGGAC AACGCGGTGGAC (sense), GTCCACCGCGTTGTCCGCGACCATCAG (antisense); E193L, CTGATGGTCGCGCTGAACGCGGTGGAC (sense), GTCCACCGCGTTCAGCGCGACCATCAG (antisense); Y169F, CGGTGGGCCGCTTCATGGTCGGCTG (sense), CAGCCGACCATGAAGCGGCCCACCG (antisense).

    Article Title: Perturbation of the tRNA Tertiary Core Differentially Affects Specific Steps of the Elongation Cycle
    Article Snippet: Mutations were introduced into plasmid pTFMa (a derivative of pUC18) containing E. coli WT-tRNA Phe sequence using the QuickChange protocol (Qiagen) and confirmed by DNA sequencing.

    Article Title: Deregulated Cdk5 promotes oxidative stress and mitochondrial dysfunction.
    Article Snippet: Cloning, expression and purification of Cdk5, Cdk5 (F80G), and p25 The mutant Cdk5 protein (F80G) (Cdk5-as1) construct was generated from Cdk5 in pGEX-2T bacterial expression system using the Quickchange protocol from Qiagen (Valencia, CA, USA) according to the manufacturer’s instructions.

    Article Title: Structure of 2-methylisoborneol synthase from Streptomyces coelicolor and implications for the cyclization of a non-canonical C -methylated monoterpenoid substrate
    Article Snippet: Site-directed mutagenesis studies were performed according to the QuickChange protocol (Qiagen Inc., USA) using the full-length MIBS gene carrying the N-terminal hexahistidine tag and the following mutagenic primers: E193A, CTGATGGTCGCGGCGAACGCGGTGGAC (sense), GTCCACCGCGTTCGCCGCGACCATCAG (antisense); E193D, CTGATGGTCGCGGAC AACGCGGTGGAC (sense), GTCCACCGCGTTGTCCGCGACCATCAG (antisense); E193L, CTGATGGTCGCGCTGAACGCGGTGGAC (sense), GTCCACCGCGTTCAGCGCGACCATCAG (antisense); Y169F, CGGTGGGCCGCTTCATGGTCGGCTG (sense), CAGCCGACCATGAAGCGGCCCACCG (antisense).

    Article Title: Perturbation of the tRNA Tertiary Core Differentially Affects Specific Steps of the Elongation Cycle
    Article Snippet: The plasmid was extracted, restricted, and then transcribed using the EPICENTRE Ampliscribe T7 flash transcription kit. mRNA was purified by precipitation with 2.5 m LiCl on ice (30 min). mRNA022CUC was made by mutation of UUU to CUC, using the QuickChange protocol (Qiagen) followed by a preparation procedure essentially identical to that described for making mRNA022UUU. tRNAs —Native E. coli tRNA fMet and tRNA Phe were acquired from Chemical Block (Moscow, Russia).

    Article Title: Perturbation of the tRNA Tertiary Core Differentially Affects Specific Steps of the Elongation Cycle
    Article Snippet: Mutations were introduced into plasmid pTFMa (a derivative of pUC18) containing E. coliWT-tRNAPhe sequence using theQuickChange protocol (Qiagen) and confirmed by DNA sequencing.

    Article Title: Structure of geranyl diphosphate C -methyltransferase from Streptomyces coelicolor and implications for the mechanism of isoprenoid modification
    Article Snippet: Preparation and Assay of Y51F GPPMT The Y51F GPPMT mutant was prepared using the QuickChange protocol (Qiagen Inc., USA) with the mutagenic primers CTATCACCACCACTTCGGCATCGGCCCCG (sense) and CGGGGCCGATGCCGAAGTGGTGGTGATAG (antisense).

    Construct:

    Article Title: Structure of geranyl diphosphate C -methyltransferase from Streptomyces coelicolor and implications for the mechanism of isoprenoid modification
    Article Snippet: The Y51F GPPMT mutant was prepared using the QuickChange protocol (Qiagen Inc., USA) with the mutagenic primers CTATCACCACCACTTCGGCATCGGCCCCG (sense) and CGGGGCCGATGCCGAAGTGGTGGTGATAG (antisense).

    Article Title: Structure of 2-methylisoborneol synthase from Streptomyces coelicolor and implications for the cyclization of a non-canonical C -methylated monoterpenoid substrate
    Article Snippet: Mutagenesis and Activity Assays Site-directed mutagenesis studies were performed according to the QuickChange protocol (Qiagen Inc., USA) using the full-length MIBS gene carrying the N-terminal hexahistidine tag and the following mutagenic primers: E193A, CTGATGGTCGCGGCGAACGCGGTGGAC (sense), GTCCACCGCGTTCGCCGCGACCATCAG (antisense); E193D, CTGATGGTCGCGGAC AACGCGGTGGAC (sense), GTCCACCGCGTTGTCCGCGACCATCAG (antisense); E193L, CTGATGGTCGCGCTGAACGCGGTGGAC (sense), GTCCACCGCGTTCAGCGCGACCATCAG (antisense); Y169F, CGGTGGGCCGCTTCATGGTCGGCTG (sense), CAGCCGACCATGAAGCGGCCCACCG (antisense).

    Article Title: Perturbation of the tRNA Tertiary Core Differentially Affects Specific Steps of the Elongation Cycle
    Article Snippet: Mutations were introduced into plasmid pTFMa (a derivative of pUC18) containing E. coli WT-tRNA Phe sequence using the QuickChange protocol (Qiagen) and confirmed by DNA sequencing.

    Article Title: Deregulated Cdk5 promotes oxidative stress and mitochondrial dysfunction.
    Article Snippet: Cloning, expression and purification of Cdk5, Cdk5 (F80G), and p25 The mutant Cdk5 protein (F80G) (Cdk5-as1) construct was generated from Cdk5 in pGEX-2T bacterial expression system using the Quickchange protocol from Qiagen (Valencia, CA, USA) according to the manufacturer’s instructions.

    Article Title: Structure of 2-methylisoborneol synthase from Streptomyces coelicolor and implications for the cyclization of a non-canonical C -methylated monoterpenoid substrate
    Article Snippet: Site-directed mutagenesis studies were performed according to the QuickChange protocol (Qiagen Inc., USA) using the full-length MIBS gene carrying the N-terminal hexahistidine tag and the following mutagenic primers: E193A, CTGATGGTCGCGGCGAACGCGGTGGAC (sense), GTCCACCGCGTTCGCCGCGACCATCAG (antisense); E193D, CTGATGGTCGCGGAC AACGCGGTGGAC (sense), GTCCACCGCGTTGTCCGCGACCATCAG (antisense); E193L, CTGATGGTCGCGCTGAACGCGGTGGAC (sense), GTCCACCGCGTTCAGCGCGACCATCAG (antisense); Y169F, CGGTGGGCCGCTTCATGGTCGGCTG (sense), CAGCCGACCATGAAGCGGCCCACCG (antisense).

    Article Title: Perturbation of the tRNA Tertiary Core Differentially Affects Specific Steps of the Elongation Cycle
    Article Snippet: The plasmid was extracted, restricted, and then transcribed using the EPICENTRE Ampliscribe T7 flash transcription kit. mRNA was purified by precipitation with 2.5 m LiCl on ice (30 min). mRNA022CUC was made by mutation of UUU to CUC, using the QuickChange protocol (Qiagen) followed by a preparation procedure essentially identical to that described for making mRNA022UUU. tRNAs —Native E. coli tRNA fMet and tRNA Phe were acquired from Chemical Block (Moscow, Russia).

    Article Title: Perturbation of the tRNA Tertiary Core Differentially Affects Specific Steps of the Elongation Cycle
    Article Snippet: Mutations were introduced into plasmid pTFMa (a derivative of pUC18) containing E. coliWT-tRNAPhe sequence using theQuickChange protocol (Qiagen) and confirmed by DNA sequencing.

    Article Title: Structure of geranyl diphosphate C -methyltransferase from Streptomyces coelicolor and implications for the mechanism of isoprenoid modification
    Article Snippet: Preparation and Assay of Y51F GPPMT The Y51F GPPMT mutant was prepared using the QuickChange protocol (Qiagen Inc., USA) with the mutagenic primers CTATCACCACCACTTCGGCATCGGCCCCG (sense) and CGGGGCCGATGCCGAAGTGGTGGTGATAG (antisense).

    Generated:

    Article Title: Structure of geranyl diphosphate C -methyltransferase from Streptomyces coelicolor and implications for the mechanism of isoprenoid modification
    Article Snippet: The Y51F GPPMT mutant was prepared using the QuickChange protocol (Qiagen Inc., USA) with the mutagenic primers CTATCACCACCACTTCGGCATCGGCCCCG (sense) and CGGGGCCGATGCCGAAGTGGTGGTGATAG (antisense).

    Article Title: Structure of 2-methylisoborneol synthase from Streptomyces coelicolor and implications for the cyclization of a non-canonical C -methylated monoterpenoid substrate
    Article Snippet: Mutagenesis and Activity Assays Site-directed mutagenesis studies were performed according to the QuickChange protocol (Qiagen Inc., USA) using the full-length MIBS gene carrying the N-terminal hexahistidine tag and the following mutagenic primers: E193A, CTGATGGTCGCGGCGAACGCGGTGGAC (sense), GTCCACCGCGTTCGCCGCGACCATCAG (antisense); E193D, CTGATGGTCGCGGAC AACGCGGTGGAC (sense), GTCCACCGCGTTGTCCGCGACCATCAG (antisense); E193L, CTGATGGTCGCGCTGAACGCGGTGGAC (sense), GTCCACCGCGTTCAGCGCGACCATCAG (antisense); Y169F, CGGTGGGCCGCTTCATGGTCGGCTG (sense), CAGCCGACCATGAAGCGGCCCACCG (antisense).

    Article Title: Perturbation of the tRNA Tertiary Core Differentially Affects Specific Steps of the Elongation Cycle
    Article Snippet: Mutations were introduced into plasmid pTFMa (a derivative of pUC18) containing E. coli WT-tRNA Phe sequence using the QuickChange protocol (Qiagen) and confirmed by DNA sequencing.

    Article Title: Deregulated Cdk5 promotes oxidative stress and mitochondrial dysfunction.
    Article Snippet: Cloning, expression and purification of Cdk5, Cdk5 (F80G), and p25 The mutant Cdk5 protein (F80G) (Cdk5-as1) construct was generated from Cdk5 in pGEX-2T bacterial expression system using the Quickchange protocol from Qiagen (Valencia, CA, USA) according to the manufacturer’s instructions.

    Article Title: Structure of 2-methylisoborneol synthase from Streptomyces coelicolor and implications for the cyclization of a non-canonical C -methylated monoterpenoid substrate
    Article Snippet: Site-directed mutagenesis studies were performed according to the QuickChange protocol (Qiagen Inc., USA) using the full-length MIBS gene carrying the N-terminal hexahistidine tag and the following mutagenic primers: E193A, CTGATGGTCGCGGCGAACGCGGTGGAC (sense), GTCCACCGCGTTCGCCGCGACCATCAG (antisense); E193D, CTGATGGTCGCGGAC AACGCGGTGGAC (sense), GTCCACCGCGTTGTCCGCGACCATCAG (antisense); E193L, CTGATGGTCGCGCTGAACGCGGTGGAC (sense), GTCCACCGCGTTCAGCGCGACCATCAG (antisense); Y169F, CGGTGGGCCGCTTCATGGTCGGCTG (sense), CAGCCGACCATGAAGCGGCCCACCG (antisense).

    Article Title: Perturbation of the tRNA Tertiary Core Differentially Affects Specific Steps of the Elongation Cycle
    Article Snippet: The plasmid was extracted, restricted, and then transcribed using the EPICENTRE Ampliscribe T7 flash transcription kit. mRNA was purified by precipitation with 2.5 m LiCl on ice (30 min). mRNA022CUC was made by mutation of UUU to CUC, using the QuickChange protocol (Qiagen) followed by a preparation procedure essentially identical to that described for making mRNA022UUU. tRNAs —Native E. coli tRNA fMet and tRNA Phe were acquired from Chemical Block (Moscow, Russia).

    Article Title: Perturbation of the tRNA Tertiary Core Differentially Affects Specific Steps of the Elongation Cycle
    Article Snippet: Mutations were introduced into plasmid pTFMa (a derivative of pUC18) containing E. coliWT-tRNAPhe sequence using theQuickChange protocol (Qiagen) and confirmed by DNA sequencing.

    Article Title: Structure of geranyl diphosphate C -methyltransferase from Streptomyces coelicolor and implications for the mechanism of isoprenoid modification
    Article Snippet: Preparation and Assay of Y51F GPPMT The Y51F GPPMT mutant was prepared using the QuickChange protocol (Qiagen Inc., USA) with the mutagenic primers CTATCACCACCACTTCGGCATCGGCCCCG (sense) and CGGGGCCGATGCCGAAGTGGTGGTGATAG (antisense).



    Similar Products

    90
    Qiagen quickchange mutagenesis protocol
    Quickchange Mutagenesis Protocol, supplied by Qiagen, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/quickchange+protocol/quickchange+mutagenesis+protocol/pm27248857-168-1-6
    Average 90 stars, based on 1 article reviews
    quickchange mutagenesis protocol - by Bioz Stars, 2026-10
    90/100 stars
      Buy from Supplier

    90
    Merck KGaA quickchange protocol
    Quickchange Protocol, supplied by Merck KGaA, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/quickchange+protocol/quickchange+protocol/pmc04715182__mmc1-180-9-18
    Average 90 stars, based on 1 article reviews
    quickchange protocol - by Bioz Stars, 2026-10
    90/100 stars
      Buy from Supplier

    90
    Qiagen quickchange protocol
    Quickchange Protocol, supplied by Qiagen, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/quickchange+protocol/quickchange+protocol/pmc03323742-85-44-14
    Average 90 stars, based on 1 article reviews
    quickchange protocol - by Bioz Stars, 2026-10
    90/100 stars
      Buy from Supplier

    Image Search Results