Quantitative Proteomics:Article Title: An amino acid-based amphoteric liposomal delivery system for systemic administration of siRNA.
Article Snippet: Quantitative real-time PCR to detect mRNA expression levels was carried out in a 384-well format using the PerfeCta SYBR Green FastMix (Quanta Biosciences), using the Applied Biosystems 7900HT platform (Applied Biosystems, Foster City, CA). .. Data was then analyzed using ΔΔCT method in qBASE relative quantification software (Biogazelle, Belgium). .. The endogenous genes, GAPDH and PPIA, were selected for use in mRNA normalization based on geNorm analysis (http://medgen.ugent.be/~jvdesomp/ genorm).
Article Title: Development of an experimental model of maternal allergic asthma during pregnancy
Article Snippet: .. The reference genes (β actin, hypoxanthine phosphoribosyltransferase 1 and tyrosine 3-monooxygenase (YWAHZ)) were chosen (Duffield et al. 2009; Passmore et al. 2009; Wang et al. 2013; Hellemans & Vandesompele, 2014) based on expression analysis using the geNorm component of the qBase (Biogazelle, Zwinjnaarde, Belgium) relative quantification analysis software (Hellemans et al. 2007) because their expression was stable across samples (maximum value, factor = 0.3–0.4; Vandesompele et al. 2002; Soo et al. 2012; Hellemans & Vandesompele, 2014). .. The relative expression of messenger ribonucleic acid (mRNA) transcripts of molecules involved in physiological hypertrophy (IGF1, IGF1R and IGF2; Gentili et al. 2009; Zhang et al. 2010), pathological hypertrophy (ANP, BNP, IGF2R and AT1R; Lie et al. 2013, 2014; Zhang et al. 2013), cortisol availability (GR, MR, 11βHSD1 and 11βHSD2; Gentili et al. 2009), inflammation (TNFα and IL1β), fibrosis (TGFβ, collagen type II, MMP 2, TIMP 1, TIMP 2 and TIMP 3; Zhang et al. 2010; Wang et al. 2015), proliferation (PCNA and Ki67), reactive oxygen species (HO1) and glucose and fatty acid uptake (GLUT1, GLUT4, FATP1 and CPT1; Gentili et al. 2009; Wang et al. 2013; Nicholas et al. 2014) were measured by quantitative real-time RT-PCR (qRT-PCR) (Table 1) using Fast SYBR Green Master Mix (Applied Biosystems, Foster City, CA, USA) on a ViiA7 Fast Real-time PCR system (Applied Biosystems) as previously described (Wang et al. 2011; Soo et al. 2012; McGillick et al. 2013).
Article Title: RNAi-based therapeutics targeting survivin and PLK1 for treatment of bladder cancer.
Article Snippet: Quantitative real-time PCR was carried out in a 384-well format to detect survivin or PLK1 expression levels using the Quanta Perfecta SYBR Green Fast Mix with ROX (Quanta Biosciences, Gaithersburg, MD), on the Applied Biosystems 7900HT platform (Applied Biosystems). .. Data were analyzed using the ΔΔCT method in qBASE relative quantification software (Biogazelle, Ghent, Belgium). .. Endogenous housekeeping genes, HPRT1, HSPCB, and TBP were selected based on geNorm analysis (http://medgen.ugent.be/~jvdesomp/genorm).
Article Title: Development of an experimental model of maternal allergic asthma during pregnancy
Article Snippet: .. The reference genes (β actin, hypoxanthine phosphoribosyltransferase 1 and tyrosine 3‐monooxygenase (YWAHZ)) were chosen (Duffield et al . 2009 ; Passmore et al . 2009 ; Wang et al . 2013 ; Hellemans & Vandesompele, 2014 ) based on expression analysis using the geNorm component of the qBase (Biogazelle, Zwinjnaarde, Belgium) relative quantification analysis software (Hellemans et al . 2007 ) because their expression was stable across samples (maximum value, factor = 0.3–0.4; Vandesompele et al . 2002 ; Soo et al . 2012 ; Hellemans & Vandesompele, 2014 ). .. The relative expression of messenger ribonucleic acid (mRNA) transcripts of molecules involved in physiological hypertrophy (IGF1, IGF1R and IGF2; Gentili et al . 2009 ; Zhang et al . 2010 ), pathological hypertrophy (ANP, BNP, IGF2R and AT1R; Lie et al . 2013 , 2014 ; Zhang et al . 2013 ), cortisol availability (GR, MR, 11βHSD1 and 11βHSD2; Gentili et al . 2009 ), inflammation (TNFα and IL1β), fibrosis (TGFβ, collagen type II, MMP 2, TIMP 1, TIMP 2 and TIMP 3; Zhang et al . 2010 ; Wang et al . 2015 ), proliferation (PCNA and Ki67), reactive oxygen species (HO1) and glucose and fatty acid uptake (GLUT1, GLUT4, FATP1 and CPT1; Gentili et al . 2009 ; Wang et al . 2013 ; Nicholas et al . 2014 ) were measured by quantitative real‐time RT‐PCR (qRT‐PCR) (Table ) using Fast SYBR Green Master Mix (Applied Biosystems, Foster City, CA, USA) on a ViiA7 Fast Real‐time PCR system (Applied Biosystems) as previously described (Wang et al . 2011 ; Soo et al . 2012 ; McGillick et al . 2013 ). table ft1 table-wrap mode="anchored" t5 Table 1 caption a7 Accession no. Gene Forward (F) and reverse (R) primer sequences {"type":"entrez-nucleotide","attrs":{"text":"NM_001160026.1","term_id":"229892287","term_text":"NM_001160026.1"}} NM_001160026.1 BNP F: CCTGCTTCTCCTCTTCTTGC R: TAGACGGTCCAACAGCTCCT {"type":"entrez-nucleotide","attrs":{"text":"X55152","term_id":"1405","term_text":"X55152"}} X55152 TNFα F: ACACCATGAGCACCAAAAGC R: AGGCACCAGCAACTTCTGGA {"type":"entrez-nucleotide","attrs":{"text":"NM_001009465.2","term_id":"57527828","term_text":"NM_001009465.2"}} NM_001009465.2 IL1β F: TGCCTACGAACATGTCTTCCGTGA R: TGCTCTCTGTCCTGGAGTTTGCAT {"type":"entrez-nucleotide","attrs":{"text":"NM_001034494.1","term_id":"77735938","term_text":"NM_001034494.1"}} NM_001034494.1 PCNA F: ACTCCACTGTCTCCTACAGTAA R: CGATCTTGGGAGCCAAATAGT {"type":"entrez-nucleotide","attrs":{"text":"XM_005197116.1","term_id":"528926801","term_text":"XM_005197116.1"}} XM_005197116.1 Ki67 F: TCAGTGAGCAGGAGGCAGTA R: GGAAATCCAGGTGACTTGCT {"type":"entrez-nucleotide","attrs":{"text":"NM_001014912.1","term_id":"62460519","term_text":"NM_001014912.1"}} NM_001014912.1 HO 1 F: CTGGTGATGGCGTCTTTGTA R: CAGCTCCTCTGGGAAGTAGA Open in a separate window Sequences of oligonucleotide primers used for quantitative real‐time RT‐PCR for maternal cardiac tissues Fetal lung phenotype Tissue was sampled from the left caudal lobe of the fetal lung, avoiding large airways and blood vessels, and snap frozen in liquid nitrogen.
Software:Article Title: An amino acid-based amphoteric liposomal delivery system for systemic administration of siRNA.
Article Snippet: Quantitative real-time PCR to detect mRNA expression levels was carried out in a 384-well format using the PerfeCta SYBR Green FastMix (Quanta Biosciences), using the Applied Biosystems 7900HT platform (Applied Biosystems, Foster City, CA). .. Data was then analyzed using ΔΔCT method in qBASE relative quantification software (Biogazelle, Belgium). .. The endogenous genes, GAPDH and PPIA, were selected for use in mRNA normalization based on geNorm analysis (http://medgen.ugent.be/~jvdesomp/ genorm).
Article Title: Development of an experimental model of maternal allergic asthma during pregnancy
Article Snippet: .. The reference genes (β actin, hypoxanthine phosphoribosyltransferase 1 and tyrosine 3-monooxygenase (YWAHZ)) were chosen (Duffield et al. 2009; Passmore et al. 2009; Wang et al. 2013; Hellemans & Vandesompele, 2014) based on expression analysis using the geNorm component of the qBase (Biogazelle, Zwinjnaarde, Belgium) relative quantification analysis software (Hellemans et al. 2007) because their expression was stable across samples (maximum value, factor = 0.3–0.4; Vandesompele et al. 2002; Soo et al. 2012; Hellemans & Vandesompele, 2014). .. The relative expression of messenger ribonucleic acid (mRNA) transcripts of molecules involved in physiological hypertrophy (IGF1, IGF1R and IGF2; Gentili et al. 2009; Zhang et al. 2010), pathological hypertrophy (ANP, BNP, IGF2R and AT1R; Lie et al. 2013, 2014; Zhang et al. 2013), cortisol availability (GR, MR, 11βHSD1 and 11βHSD2; Gentili et al. 2009), inflammation (TNFα and IL1β), fibrosis (TGFβ, collagen type II, MMP 2, TIMP 1, TIMP 2 and TIMP 3; Zhang et al. 2010; Wang et al. 2015), proliferation (PCNA and Ki67), reactive oxygen species (HO1) and glucose and fatty acid uptake (GLUT1, GLUT4, FATP1 and CPT1; Gentili et al. 2009; Wang et al. 2013; Nicholas et al. 2014) were measured by quantitative real-time RT-PCR (qRT-PCR) (Table 1) using Fast SYBR Green Master Mix (Applied Biosystems, Foster City, CA, USA) on a ViiA7 Fast Real-time PCR system (Applied Biosystems) as previously described (Wang et al. 2011; Soo et al. 2012; McGillick et al. 2013).
Article Title: Association of left ventricular structure and function with peripheral blood mitochondrial DNA content in a general population.
Article Snippet: a Research Unit Hypertension and Cardiovascular Epidemiology, KU Leuven Department of Cardiovascular Sciences, University of Leuven, Leuven, Belgium b Hypertension Division, Department of Internal Medicine, University Clinical Centre Ljubljana, Slovenia c Centre for Environmental Sciences, Hasselt University, Diepenbeek, Belgium d KU Leuven Department of Public Health, Occupational and Environmental Medicine, University of Leuven, Leuven, Belgium
Article Title: RNAi-based therapeutics targeting survivin and PLK1 for treatment of bladder cancer.
Article Snippet: Quantitative real-time PCR was carried out in a 384-well format to detect survivin or PLK1 expression levels using the Quanta Perfecta SYBR Green Fast Mix with ROX (Quanta Biosciences, Gaithersburg, MD), on the Applied Biosystems 7900HT platform (Applied Biosystems). .. Data were analyzed using the ΔΔCT method in qBASE relative quantification software (Biogazelle, Ghent, Belgium). .. Endogenous housekeeping genes, HPRT1, HSPCB, and TBP were selected based on geNorm analysis (http://medgen.ugent.be/~jvdesomp/genorm).
Article Title: Development of an experimental model of maternal allergic asthma during pregnancy
Article Snippet: .. The reference genes (β actin, hypoxanthine phosphoribosyltransferase 1 and tyrosine 3‐monooxygenase (YWAHZ)) were chosen (Duffield et al . 2009 ; Passmore et al . 2009 ; Wang et al . 2013 ; Hellemans & Vandesompele, 2014 ) based on expression analysis using the geNorm component of the qBase (Biogazelle, Zwinjnaarde, Belgium) relative quantification analysis software (Hellemans et al . 2007 ) because their expression was stable across samples (maximum value, factor = 0.3–0.4; Vandesompele et al . 2002 ; Soo et al . 2012 ; Hellemans & Vandesompele, 2014 ). .. The relative expression of messenger ribonucleic acid (mRNA) transcripts of molecules involved in physiological hypertrophy (IGF1, IGF1R and IGF2; Gentili et al . 2009 ; Zhang et al . 2010 ), pathological hypertrophy (ANP, BNP, IGF2R and AT1R; Lie et al . 2013 , 2014 ; Zhang et al . 2013 ), cortisol availability (GR, MR, 11βHSD1 and 11βHSD2; Gentili et al . 2009 ), inflammation (TNFα and IL1β), fibrosis (TGFβ, collagen type II, MMP 2, TIMP 1, TIMP 2 and TIMP 3; Zhang et al . 2010 ; Wang et al . 2015 ), proliferation (PCNA and Ki67), reactive oxygen species (HO1) and glucose and fatty acid uptake (GLUT1, GLUT4, FATP1 and CPT1; Gentili et al . 2009 ; Wang et al . 2013 ; Nicholas et al . 2014 ) were measured by quantitative real‐time RT‐PCR (qRT‐PCR) (Table ) using Fast SYBR Green Master Mix (Applied Biosystems, Foster City, CA, USA) on a ViiA7 Fast Real‐time PCR system (Applied Biosystems) as previously described (Wang et al . 2011 ; Soo et al . 2012 ; McGillick et al . 2013 ). table ft1 table-wrap mode="anchored" t5 Table 1 caption a7 Accession no. Gene Forward (F) and reverse (R) primer sequences {"type":"entrez-nucleotide","attrs":{"text":"NM_001160026.1","term_id":"229892287","term_text":"NM_001160026.1"}} NM_001160026.1 BNP F: CCTGCTTCTCCTCTTCTTGC R: TAGACGGTCCAACAGCTCCT {"type":"entrez-nucleotide","attrs":{"text":"X55152","term_id":"1405","term_text":"X55152"}} X55152 TNFα F: ACACCATGAGCACCAAAAGC R: AGGCACCAGCAACTTCTGGA {"type":"entrez-nucleotide","attrs":{"text":"NM_001009465.2","term_id":"57527828","term_text":"NM_001009465.2"}} NM_001009465.2 IL1β F: TGCCTACGAACATGTCTTCCGTGA R: TGCTCTCTGTCCTGGAGTTTGCAT {"type":"entrez-nucleotide","attrs":{"text":"NM_001034494.1","term_id":"77735938","term_text":"NM_001034494.1"}} NM_001034494.1 PCNA F: ACTCCACTGTCTCCTACAGTAA R: CGATCTTGGGAGCCAAATAGT {"type":"entrez-nucleotide","attrs":{"text":"XM_005197116.1","term_id":"528926801","term_text":"XM_005197116.1"}} XM_005197116.1 Ki67 F: TCAGTGAGCAGGAGGCAGTA R: GGAAATCCAGGTGACTTGCT {"type":"entrez-nucleotide","attrs":{"text":"NM_001014912.1","term_id":"62460519","term_text":"NM_001014912.1"}} NM_001014912.1 HO 1 F: CTGGTGATGGCGTCTTTGTA R: CAGCTCCTCTGGGAAGTAGA Open in a separate window Sequences of oligonucleotide primers used for quantitative real‐time RT‐PCR for maternal cardiac tissues Fetal lung phenotype Tissue was sampled from the left caudal lobe of the fetal lung, avoiding large airways and blood vessels, and snap frozen in liquid nitrogen.
Expressing:Article Title: Development of an experimental model of maternal allergic asthma during pregnancy
Article Snippet: .. The reference genes (β actin, hypoxanthine phosphoribosyltransferase 1 and tyrosine 3-monooxygenase (YWAHZ)) were chosen (Duffield et al. 2009; Passmore et al. 2009; Wang et al. 2013; Hellemans & Vandesompele, 2014) based on expression analysis using the geNorm component of the qBase (Biogazelle, Zwinjnaarde, Belgium) relative quantification analysis software (Hellemans et al. 2007) because their expression was stable across samples (maximum value, factor = 0.3–0.4; Vandesompele et al. 2002; Soo et al. 2012; Hellemans & Vandesompele, 2014). .. The relative expression of messenger ribonucleic acid (mRNA) transcripts of molecules involved in physiological hypertrophy (IGF1, IGF1R and IGF2; Gentili et al. 2009; Zhang et al. 2010), pathological hypertrophy (ANP, BNP, IGF2R and AT1R; Lie et al. 2013, 2014; Zhang et al. 2013), cortisol availability (GR, MR, 11βHSD1 and 11βHSD2; Gentili et al. 2009), inflammation (TNFα and IL1β), fibrosis (TGFβ, collagen type II, MMP 2, TIMP 1, TIMP 2 and TIMP 3; Zhang et al. 2010; Wang et al. 2015), proliferation (PCNA and Ki67), reactive oxygen species (HO1) and glucose and fatty acid uptake (GLUT1, GLUT4, FATP1 and CPT1; Gentili et al. 2009; Wang et al. 2013; Nicholas et al. 2014) were measured by quantitative real-time RT-PCR (qRT-PCR) (Table 1) using Fast SYBR Green Master Mix (Applied Biosystems, Foster City, CA, USA) on a ViiA7 Fast Real-time PCR system (Applied Biosystems) as previously described (Wang et al. 2011; Soo et al. 2012; McGillick et al. 2013).
Article Title: Development of an experimental model of maternal allergic asthma during pregnancy
Article Snippet: .. The reference genes (β actin, hypoxanthine phosphoribosyltransferase 1 and tyrosine 3‐monooxygenase (YWAHZ)) were chosen (Duffield et al . 2009 ; Passmore et al . 2009 ; Wang et al . 2013 ; Hellemans & Vandesompele, 2014 ) based on expression analysis using the geNorm component of the qBase (Biogazelle, Zwinjnaarde, Belgium) relative quantification analysis software (Hellemans et al . 2007 ) because their expression was stable across samples (maximum value, factor = 0.3–0.4; Vandesompele et al . 2002 ; Soo et al . 2012 ; Hellemans & Vandesompele, 2014 ). .. The relative expression of messenger ribonucleic acid (mRNA) transcripts of molecules involved in physiological hypertrophy (IGF1, IGF1R and IGF2; Gentili et al . 2009 ; Zhang et al . 2010 ), pathological hypertrophy (ANP, BNP, IGF2R and AT1R; Lie et al . 2013 , 2014 ; Zhang et al . 2013 ), cortisol availability (GR, MR, 11βHSD1 and 11βHSD2; Gentili et al . 2009 ), inflammation (TNFα and IL1β), fibrosis (TGFβ, collagen type II, MMP 2, TIMP 1, TIMP 2 and TIMP 3; Zhang et al . 2010 ; Wang et al . 2015 ), proliferation (PCNA and Ki67), reactive oxygen species (HO1) and glucose and fatty acid uptake (GLUT1, GLUT4, FATP1 and CPT1; Gentili et al . 2009 ; Wang et al . 2013 ; Nicholas et al . 2014 ) were measured by quantitative real‐time RT‐PCR (qRT‐PCR) (Table ) using Fast SYBR Green Master Mix (Applied Biosystems, Foster City, CA, USA) on a ViiA7 Fast Real‐time PCR system (Applied Biosystems) as previously described (Wang et al . 2011 ; Soo et al . 2012 ; McGillick et al . 2013 ). table ft1 table-wrap mode="anchored" t5 Table 1 caption a7 Accession no. Gene Forward (F) and reverse (R) primer sequences {"type":"entrez-nucleotide","attrs":{"text":"NM_001160026.1","term_id":"229892287","term_text":"NM_001160026.1"}} NM_001160026.1 BNP F: CCTGCTTCTCCTCTTCTTGC R: TAGACGGTCCAACAGCTCCT {"type":"entrez-nucleotide","attrs":{"text":"X55152","term_id":"1405","term_text":"X55152"}} X55152 TNFα F: ACACCATGAGCACCAAAAGC R: AGGCACCAGCAACTTCTGGA {"type":"entrez-nucleotide","attrs":{"text":"NM_001009465.2","term_id":"57527828","term_text":"NM_001009465.2"}} NM_001009465.2 IL1β F: TGCCTACGAACATGTCTTCCGTGA R: TGCTCTCTGTCCTGGAGTTTGCAT {"type":"entrez-nucleotide","attrs":{"text":"NM_001034494.1","term_id":"77735938","term_text":"NM_001034494.1"}} NM_001034494.1 PCNA F: ACTCCACTGTCTCCTACAGTAA R: CGATCTTGGGAGCCAAATAGT {"type":"entrez-nucleotide","attrs":{"text":"XM_005197116.1","term_id":"528926801","term_text":"XM_005197116.1"}} XM_005197116.1 Ki67 F: TCAGTGAGCAGGAGGCAGTA R: GGAAATCCAGGTGACTTGCT {"type":"entrez-nucleotide","attrs":{"text":"NM_001014912.1","term_id":"62460519","term_text":"NM_001014912.1"}} NM_001014912.1 HO 1 F: CTGGTGATGGCGTCTTTGTA R: CAGCTCCTCTGGGAAGTAGA Open in a separate window Sequences of oligonucleotide primers used for quantitative real‐time RT‐PCR for maternal cardiac tissues Fetal lung phenotype Tissue was sampled from the left caudal lobe of the fetal lung, avoiding large airways and blood vessels, and snap frozen in liquid nitrogen.
other:
|
