Review



primescript high fidelity reverse transcriptase kit  (TaKaRa)


Bioz Verified Symbol TaKaRa is a verified supplier
Bioz Manufacturer Symbol TaKaRa manufactures this product  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 97

    Structured Review

    TaKaRa primescript high fidelity reverse transcriptase kit
    Primescript High Fidelity Reverse Transcriptase Kit, supplied by TaKaRa, used in various techniques. Bioz Stars score: 97/100, based on 4919 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/primescript+high+fidelity+reverse+transcriptase+kit/PrimeScript+Reverse+Transcriptase/pm25249323-308-11-17
    Average 97 stars, based on 4919 article reviews
    primescript high fidelity reverse transcriptase kit - by Bioz Stars, 2026-09
    97/100 stars

    Images

    Related Articles

    Reverse Transcription:

    Article Title: Comprehensive genome-wide identification, structural analysis, and cold-responsive expression profiling of double B-box (DBB) transcription factors in melon (Cucumis melo L.).
    Article Snippet: .. Total RNA was extracted from melon leaves with the help of RNase inhibitor (Thermo Fisher Scientific, AM2696) and DNA/RNA-free water (Tiangen Biotech (Beijing) Co., Ltd., RT121), and then reverse transcribed using PrimeScriptTM reverse transcriptase (TaKaRa Bio Engineering (Dalian) Co., Ltd., 2680A). ..

    Article Title: Gel-free library preparation for next-generation RNA sequencing and small RNA quantification.
    Article Snippet: Excess Linker 1 not ligated to RNAs was then deadenylated using 5’-deadenylase (New England Biolabs) through incubation at 30 °C for 1 h and subsequently digested with RecJf exonuclease (New England Biolabs) through two 30-min incubations at 37 °C. .. Reverse transcription (RT) was initiated with a 2-min incubation at 80 °C to anneal the RT primers to the RNA template, followed by a 2-h incubation at 50 °C to synthesize the cDNA strand using the PrimeScriptTM reverse transcriptase (RTase; TaKaRa) and a 15-min incubation at 70 °C to deactivate the enzyme. .. After the synthesis of the cDNA strand, the RNA template was hydrolyzed using sodium hydroxide (Sigma-Aldrich) through incubation at 95 °C for 3 min, followed by immediate neutralization using hydrochloric acid (VWR).

    Article Title: Tumor-Infiltrating mregDCs Restrain Anti-Tumor Immunity in Early Relapse HCC.
    Article Snippet: Cellular RNA was extracted using TRIzol reagent (Invitrogen; Thermo Fisher Scientific, Inc.). .. Complementary DNA synthesis was carried out using the PrimeScriptTM reverse transcriptase reagent kit (Takara Bio, Inc.). .. Amplification and quantification were conducted using the ABI PRISM 7900 Sequence Detection System (Applied Biosystems; Thermo Fisher Scientific, Inc.) and SYBR Premix Ex TaqTM (Tli RNaseH Plus; Takara Bio, Inc.).

    Article Title: Dendrobine promotes osteogenesis-angiogenesis in postmenopausal osteoporosis by inhibiting Hippo signaling pathway.
    Article Snippet: 3 Wuhan Fourth Hospital, No.473 Hanzheng Street, Wuhan, Hubei, China Abstract Postmenopausal osteoporosis (PMOP) is a skeletal disorder marked by progressive bone mineral density decline and increased susceptibility to fractures.. Accumulating evidence indicates that coupled osteogenesis and angiogenesis are indispensable for bone remodeling and repair.. This study investigated the therapeutic potential of dendrobine in concurrently modulating osteogenic differentiation of bone marrow-derived mesenchymal stem cells (BMSCs) and angiogenic activity in the context of PMOP.

    Article Title: The astrocyte-enriched gene Tmem44 regulates circadian protein translation in mouse astrocytes
    Article Snippet: Total RNA was extracted from cells and purified using the RNeasy Plus Micro Kit (Qiagen, Germany, 74034). .. 1 μg of total RNA was reverse transcribed using an oligo-dT primer and PrimeScript RTase (TaKaRa (Japan), 2680A). .. Quantitative real-time PCR was performed using a Rotor Gene Q (Qiagen) with TB Green Premix Ex Taq (Takara, RR420A).

    Article Title: SARS-CoV-2 3CLpro mutations T21I and E166A confer differential resistance to simnotrelvir, bofutrelvir, and ensitrelvir.
    Article Snippet: .. Viral RNA from the lung tissues was extracted using the RNeasy Mini Kit (Qiagen) and reverse-tran scribed (PrimeScript Reverse Transcriptase, Takara) according to the operation instruc tion; then, the absolute viral RNA copy in the tissue was detected quantitatively by real-time fluorescence quantitative PCR. ..

    Article Title: Depleting HIF-1α attenuates the progression of osteosarcoma, but tumorigenicity is sustained through HIF-independent pathways
    Article Snippet: .. Extraction of total RNA from cultured cells, RT and qPCR were performed using the NucleoSpin RNA kit, PrimeScript reverse transcriptase (Takara Bio, Inc.) and Thunderbird SYBR qPCR mix (Toyobo Co., Ltd.). ..

    Article Title: Differential Expression and Function of Arginase in Mouse Uterus During Early Pregnancy
    Article Snippet: .. Total RNAs were extracted from mouse stromal cells using TRIzol (AG21101, Accurate Biology, Changsha, China), digested with RQ1 deoxyribonuclease I (Promega, Fitchburg, WI, USA), and reverse-transcribed into cDNA with the Prime Script Reverse Transcriptase Reagent Kit (Takara, Japan). .. RT-qPCR was performed using the SYBR Premix (Q311-02-AA, Vazyme, Nanjing, China).

    Incubation:

    Article Title: Gel-free library preparation for next-generation RNA sequencing and small RNA quantification.
    Article Snippet: Excess Linker 1 not ligated to RNAs was then deadenylated using 5’-deadenylase (New England Biolabs) through incubation at 30 °C for 1 h and subsequently digested with RecJf exonuclease (New England Biolabs) through two 30-min incubations at 37 °C. .. Reverse transcription (RT) was initiated with a 2-min incubation at 80 °C to anneal the RT primers to the RNA template, followed by a 2-h incubation at 50 °C to synthesize the cDNA strand using the PrimeScriptTM reverse transcriptase (RTase; TaKaRa) and a 15-min incubation at 70 °C to deactivate the enzyme. .. After the synthesis of the cDNA strand, the RNA template was hydrolyzed using sodium hydroxide (Sigma-Aldrich) through incubation at 95 °C for 3 min, followed by immediate neutralization using hydrochloric acid (VWR).

    DNA Synthesis:

    Article Title: Tumor-Infiltrating mregDCs Restrain Anti-Tumor Immunity in Early Relapse HCC.
    Article Snippet: Cellular RNA was extracted using TRIzol reagent (Invitrogen; Thermo Fisher Scientific, Inc.). .. Complementary DNA synthesis was carried out using the PrimeScriptTM reverse transcriptase reagent kit (Takara Bio, Inc.). .. Amplification and quantification were conducted using the ABI PRISM 7900 Sequence Detection System (Applied Biosystems; Thermo Fisher Scientific, Inc.) and SYBR Premix Ex TaqTM (Tli RNaseH Plus; Takara Bio, Inc.).

    Fluorescence:

    Article Title: SARS-CoV-2 3CLpro mutations T21I and E166A confer differential resistance to simnotrelvir, bofutrelvir, and ensitrelvir.
    Article Snippet: .. Viral RNA from the lung tissues was extracted using the RNeasy Mini Kit (Qiagen) and reverse-tran scribed (PrimeScript Reverse Transcriptase, Takara) according to the operation instruc tion; then, the absolute viral RNA copy in the tissue was detected quantitatively by real-time fluorescence quantitative PCR. ..

    Real-time Polymerase Chain Reaction:

    Article Title: SARS-CoV-2 3CLpro mutations T21I and E166A confer differential resistance to simnotrelvir, bofutrelvir, and ensitrelvir.
    Article Snippet: .. Viral RNA from the lung tissues was extracted using the RNeasy Mini Kit (Qiagen) and reverse-tran scribed (PrimeScript Reverse Transcriptase, Takara) according to the operation instruc tion; then, the absolute viral RNA copy in the tissue was detected quantitatively by real-time fluorescence quantitative PCR. ..

    Article Title: Depleting HIF-1α attenuates the progression of osteosarcoma, but tumorigenicity is sustained through HIF-independent pathways
    Article Snippet: .. Extraction of total RNA from cultured cells, RT and qPCR were performed using the NucleoSpin RNA kit, PrimeScript reverse transcriptase (Takara Bio, Inc.) and Thunderbird SYBR qPCR mix (Toyobo Co., Ltd.). ..

    Extraction:

    Article Title: Depleting HIF-1α attenuates the progression of osteosarcoma, but tumorigenicity is sustained through HIF-independent pathways
    Article Snippet: .. Extraction of total RNA from cultured cells, RT and qPCR were performed using the NucleoSpin RNA kit, PrimeScript reverse transcriptase (Takara Bio, Inc.) and Thunderbird SYBR qPCR mix (Toyobo Co., Ltd.). ..

    Cell Culture:

    Article Title: Depleting HIF-1α attenuates the progression of osteosarcoma, but tumorigenicity is sustained through HIF-independent pathways
    Article Snippet: .. Extraction of total RNA from cultured cells, RT and qPCR were performed using the NucleoSpin RNA kit, PrimeScript reverse transcriptase (Takara Bio, Inc.) and Thunderbird SYBR qPCR mix (Toyobo Co., Ltd.). ..



    Similar Products

    97
    TaKaRa primescript high fidelity reverse transcriptase kit
    Primescript High Fidelity Reverse Transcriptase Kit, supplied by TaKaRa, used in various techniques. Bioz Stars score: 97/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/primescript+high+fidelity+reverse+transcriptase+kit/PrimeScript+Reverse+Transcriptase/pm25249323-308-11-17
    Average 97 stars, based on 1 article reviews
    primescript high fidelity reverse transcriptase kit - by Bioz Stars, 2026-09
    97/100 stars
      Buy from Supplier

    96
    TaKaRa prime script ii high fidelity reverse transcriptase polymerase chain reaction rt pcr kit
    Fibronectin deposition on the surface of gelatin material after co‐culture of MSCs and SCs. ECM accumulation is significant in gelatin sponge (GS) in the MSCs group (A), as evidenced by the rough surface (inset in A), while the surface of GS without MSCs is smooth (inset in B). FN, secreted by GFP positive MSCs (arrowheads in C), deposits onto the surface of gelatin material and displays thread‐like red fluorescence (arrows in C). Application of FN antibody decreases the deposition of FN onto the surface of gelatin material. Three dimensional reconstructive image shows that the surface of gelatin material is decorated by adherent FN (blue, in D). After adding FN blocking antibody (FNab) to the culture medium, deposition of FN (blue) onto the surface is obviously reduced as shown in (E). Green cells in D and E are MSCs. <t>RT‐PCR</t> and Western blot results indicate that, although the transcriptional level of FN decreases with the increase in duration of co‐culture (F), the amount of FN protein increases within the gelatin sponge (GS) scaffolds (G,H). Scale bars: 200 μm in (A,B), 20 μm in the inset of (A,B), and 20 μm in (C–E).
    Prime Script Ii High Fidelity Reverse Transcriptase Polymerase Chain Reaction Rt Pcr Kit, supplied by TaKaRa, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/primescript+high+fidelity+reverse+transcriptase+kit/PrimeScript+High+Fidelity+RT-PCR+Kit/pmc05101622-85-11-22
    Average 96 stars, based on 1 article reviews
    prime script ii high fidelity reverse transcriptase polymerase chain reaction rt pcr kit - by Bioz Stars, 2026-09
    96/100 stars
      Buy from Supplier

    Image Search Results


    Fibronectin deposition on the surface of gelatin material after co‐culture of MSCs and SCs. ECM accumulation is significant in gelatin sponge (GS) in the MSCs group (A), as evidenced by the rough surface (inset in A), while the surface of GS without MSCs is smooth (inset in B). FN, secreted by GFP positive MSCs (arrowheads in C), deposits onto the surface of gelatin material and displays thread‐like red fluorescence (arrows in C). Application of FN antibody decreases the deposition of FN onto the surface of gelatin material. Three dimensional reconstructive image shows that the surface of gelatin material is decorated by adherent FN (blue, in D). After adding FN blocking antibody (FNab) to the culture medium, deposition of FN (blue) onto the surface is obviously reduced as shown in (E). Green cells in D and E are MSCs. RT‐PCR and Western blot results indicate that, although the transcriptional level of FN decreases with the increase in duration of co‐culture (F), the amount of FN protein increases within the gelatin sponge (GS) scaffolds (G,H). Scale bars: 200 μm in (A,B), 20 μm in the inset of (A,B), and 20 μm in (C–E).

    Journal: Journal of Biomedical Materials Research. Part a

    Article Title: Autocrine fibronectin from differentiating mesenchymal stem cells induces the neurite elongation in vitro and promotes nerve fiber regeneration in transected spinal cord injury

    doi: 10.1002/jbm.a.35720

    Figure Lengend Snippet: Fibronectin deposition on the surface of gelatin material after co‐culture of MSCs and SCs. ECM accumulation is significant in gelatin sponge (GS) in the MSCs group (A), as evidenced by the rough surface (inset in A), while the surface of GS without MSCs is smooth (inset in B). FN, secreted by GFP positive MSCs (arrowheads in C), deposits onto the surface of gelatin material and displays thread‐like red fluorescence (arrows in C). Application of FN antibody decreases the deposition of FN onto the surface of gelatin material. Three dimensional reconstructive image shows that the surface of gelatin material is decorated by adherent FN (blue, in D). After adding FN blocking antibody (FNab) to the culture medium, deposition of FN (blue) onto the surface is obviously reduced as shown in (E). Green cells in D and E are MSCs. RT‐PCR and Western blot results indicate that, although the transcriptional level of FN decreases with the increase in duration of co‐culture (F), the amount of FN protein increases within the gelatin sponge (GS) scaffolds (G,H). Scale bars: 200 μm in (A,B), 20 μm in the inset of (A,B), and 20 μm in (C–E).

    Article Snippet: Then, using each synthesized cDNA as a mould, PCR by using Prime Script II High Fidelity Reverse transcriptase‐polymerase chain reaction (RT‐PCR) Kit (Takara) was per formed with the FN primers with Forward strand: 5′‐GGCTCAATCCAAATGCCTCTAC‐3′ and Reverse strand: 5′‐CCCTCTGGTAAGGCCAGTCAG‐3′, while β‐actin with Forward strand: 5′‐AGAGGGAAATCGTGCGTGAC‐3′ and Reverse strand: 5′‐AGAGGTCTTTACGGATGTCAACG‐3′ as loading reference.

    Techniques: Co-Culture Assay, Fluorescence, Blocking Assay, Reverse Transcription Polymerase Chain Reaction, Western Blot