Review



pgl3basic luc vector  (New England Biolabs)


Bioz Verified Symbol New England Biolabs is a verified supplier
Bioz Manufacturer Symbol New England Biolabs manufactures this product  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
    • 99
      Buy from Supplier

    Structured Review

    New England Biolabs pgl3basic luc vector
    Pgl3basic Luc Vector, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 99/100, based on 11036 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/pgl3-basic+luciferase+expression+vector/HindIII/pmc03400802-169-47-54
    Average 99 stars, based on 11036 article reviews
    pgl3basic luc vector - by Bioz Stars, 2026-10
    99/100 stars

    Images

    Related Articles

    Plasmid Preparation:

    Article Title: CHCHD2 mitigates age-associated proteostatic collapse by maintaining homeostasis of the mitochondria-lysosome axis.
    Article Snippet: .. MTS-BirA (empty vector), MTS-BirA-CHCHD2WT, and MTS-BirA-CHCHD2T61I plasmids were cut with HindIII, the 5’ overhang was blunted with Hot Start (New England Biolabs), and linearized plasmids cut with XhoI. ..

    Article Title: Translocation-induced enhancer rewiring reveals cryptic oncogenic circuits in multiple myeloma.
    Article Snippet: .. Enhancer regions amplified from LP- 1 genomic DNA (2× SuperNova PCR Mix, GenStar; primers in table S11) were cloned into the pGL4.23[luc2/minP] vector (Promega) via SacI/HindIII (NEB) restriction sites and T4 DNA ligase (NEB), with constructs verified by sequencing. .. LP- 1 cells (5 × 105) were co- electroporated with 0.5 μg of enhancer- pGL4.23 and 5 ng of pRL- TK (Renilla control) using the Lonza 4D Nucleofector SF Kit (DS- 150 program).

    Article Title: A wheat-specific proline-rich protein regulates grain weight through a ubiquitin-mediated delay of endosperm cellularization.
    Article Snippet: ligated into a PstI-digested pUC19-based intermediate vector carrying the Actin1 promoter from rice (OsActin1, GenBank accession S44221, 1.3 kb upstream region) and the nopaline synthase (Nos) terminator from Agrobacterium tumefaciens using T4 DNA ligase (M0202S, NEB), generating the Actin1:TaPGW1-A1:Ter expression cassette .. The resulting Actin1::TaPGW1-A1::Ter expression cassette was then excised with HindIII and ligated into the HindIIIdigested pUCBS vector using T4 DNA ligase (M0202S, NEB), generating the final biolistic transformation vector (Figure S13). ..

    Generated:

    Article Title: Reactivation of a loss-of-function SlGLK2 allele by frame-restoring genome editing in tomato
    Article Snippet: .. The pDe-Cas9_NTPII was generated by inserting a synthetic NTPII cassette into the Hind III-digested pDe-Cas9 fragment using NEBuilder HiFi DNA Assembly Master Mix (New England Biolabs, Ipswich, MA, USA). .. The tt Lb Cas12a fragment was purified by gel extraction using the FastGene Gel/PCR Extraction Kit (NIPPON Genetics, Tokyo, Japan) and inserted into the Asc I-digested pDe-CAS9_NTPII vector using Ligation Mix (Takara, Shiga, Japan).

    Amplification:

    Article Title: Translocation-induced enhancer rewiring reveals cryptic oncogenic circuits in multiple myeloma.
    Article Snippet: .. Enhancer regions amplified from LP- 1 genomic DNA (2× SuperNova PCR Mix, GenStar; primers in table S11) were cloned into the pGL4.23[luc2/minP] vector (Promega) via SacI/HindIII (NEB) restriction sites and T4 DNA ligase (NEB), with constructs verified by sequencing. .. LP- 1 cells (5 × 105) were co- electroporated with 0.5 μg of enhancer- pGL4.23 and 5 ng of pRL- TK (Renilla control) using the Lonza 4D Nucleofector SF Kit (DS- 150 program).

    Polymerase Chain Reaction:

    Article Title: Translocation-induced enhancer rewiring reveals cryptic oncogenic circuits in multiple myeloma.
    Article Snippet: .. Enhancer regions amplified from LP- 1 genomic DNA (2× SuperNova PCR Mix, GenStar; primers in table S11) were cloned into the pGL4.23[luc2/minP] vector (Promega) via SacI/HindIII (NEB) restriction sites and T4 DNA ligase (NEB), with constructs verified by sequencing. .. LP- 1 cells (5 × 105) were co- electroporated with 0.5 μg of enhancer- pGL4.23 and 5 ng of pRL- TK (Renilla control) using the Lonza 4D Nucleofector SF Kit (DS- 150 program).

    Clone Assay:

    Article Title: Translocation-induced enhancer rewiring reveals cryptic oncogenic circuits in multiple myeloma.
    Article Snippet: .. Enhancer regions amplified from LP- 1 genomic DNA (2× SuperNova PCR Mix, GenStar; primers in table S11) were cloned into the pGL4.23[luc2/minP] vector (Promega) via SacI/HindIII (NEB) restriction sites and T4 DNA ligase (NEB), with constructs verified by sequencing. .. LP- 1 cells (5 × 105) were co- electroporated with 0.5 μg of enhancer- pGL4.23 and 5 ng of pRL- TK (Renilla control) using the Lonza 4D Nucleofector SF Kit (DS- 150 program).

    Construct:

    Article Title: Translocation-induced enhancer rewiring reveals cryptic oncogenic circuits in multiple myeloma.
    Article Snippet: .. Enhancer regions amplified from LP- 1 genomic DNA (2× SuperNova PCR Mix, GenStar; primers in table S11) were cloned into the pGL4.23[luc2/minP] vector (Promega) via SacI/HindIII (NEB) restriction sites and T4 DNA ligase (NEB), with constructs verified by sequencing. .. LP- 1 cells (5 × 105) were co- electroporated with 0.5 μg of enhancer- pGL4.23 and 5 ng of pRL- TK (Renilla control) using the Lonza 4D Nucleofector SF Kit (DS- 150 program).

    Sequencing:

    Article Title: Translocation-induced enhancer rewiring reveals cryptic oncogenic circuits in multiple myeloma.
    Article Snippet: .. Enhancer regions amplified from LP- 1 genomic DNA (2× SuperNova PCR Mix, GenStar; primers in table S11) were cloned into the pGL4.23[luc2/minP] vector (Promega) via SacI/HindIII (NEB) restriction sites and T4 DNA ligase (NEB), with constructs verified by sequencing. .. LP- 1 cells (5 × 105) were co- electroporated with 0.5 μg of enhancer- pGL4.23 and 5 ng of pRL- TK (Renilla control) using the Lonza 4D Nucleofector SF Kit (DS- 150 program).

    Expressing:

    Article Title: A wheat-specific proline-rich protein regulates grain weight through a ubiquitin-mediated delay of endosperm cellularization.
    Article Snippet: ligated into a PstI-digested pUC19-based intermediate vector carrying the Actin1 promoter from rice (OsActin1, GenBank accession S44221, 1.3 kb upstream region) and the nopaline synthase (Nos) terminator from Agrobacterium tumefaciens using T4 DNA ligase (M0202S, NEB), generating the Actin1:TaPGW1-A1:Ter expression cassette .. The resulting Actin1::TaPGW1-A1::Ter expression cassette was then excised with HindIII and ligated into the HindIIIdigested pUCBS vector using T4 DNA ligase (M0202S, NEB), generating the final biolistic transformation vector (Figure S13). ..

    Transformation Assay:

    Article Title: A wheat-specific proline-rich protein regulates grain weight through a ubiquitin-mediated delay of endosperm cellularization.
    Article Snippet: ligated into a PstI-digested pUC19-based intermediate vector carrying the Actin1 promoter from rice (OsActin1, GenBank accession S44221, 1.3 kb upstream region) and the nopaline synthase (Nos) terminator from Agrobacterium tumefaciens using T4 DNA ligase (M0202S, NEB), generating the Actin1:TaPGW1-A1:Ter expression cassette .. The resulting Actin1::TaPGW1-A1::Ter expression cassette was then excised with HindIII and ligated into the HindIIIdigested pUCBS vector using T4 DNA ligase (M0202S, NEB), generating the final biolistic transformation vector (Figure S13). ..

    other:

    Article Title: Protocol for eVLP-mediated CRISPR-Cas9 and prime editing in pancreatic cancer cell lines.
    Article Snippet: PBS, pH 7.2 Gibco Cat# 20012019 FBS Gibco Cat# 16000044 Hank’s Balanced Salt Solution (HBSS) Gibco Cat# 14025100 Polyethylenimine Polysciences Cat# 23966-2 PEG-it Virus Precipitation Solution System Biosciences Cat# LV810A-1 GoTaq G2 DNA Polymerase Promega Cat# M7841 Agarose Invitrogen Cat# 16500500 Polybrene Sigma-Aldrich Cat# TR-1003-G TAE Buffer 503 Geneflow Cat# B9-0030 T4 ligase Promega Cat# ADM1801 dNTP Promega Cat# ADU1240 Glycerol Fisher Scientific Cat# 10579570 Carbenicillin Sigma-Aldrich Cat# C1613 Purple 100bp ladder New England Biolabs Cat# N3231S PEI MAX Transfection Reagent Kyfora Bio Cat# 24765 Tryptone Melford Cat# 91079–40–2 Yeast extract Melford Cat# 8013-01-2 Potassium Chloride KCl Fisher Scientific Cat# 10375810 Glucose Fisher Scientific Cat# 10141520 Agar Sigma-Aldrich Cat# A1296 Stationary phase for GC, phase Synperonic PE/F68 Supelco Cat# 81112 Opti-MEM Reduced Serum Medium Gibco Cat#31985062 BsaI-HFv2 New England Biolabs Cat# R3733S XmaI New England Biolabs Cat# R0180S HindIII New England Biolabs Cat#R0104S Esp3I (BsmBI) Thermo Fisher Scientific Cat# ER0451 Critical commercial assays Wizard SV Genomic DNA Purification System Promega Cat# A2360 Monarch Spin Plasmid Miniprep Kit New England Biolabs Cat# T1110S Pierce BCA Protein Assay Kits Thermo Scientific Cat#23225 Wizard SV Gel and PCR Clean-Up System Promega Cat# A9281 Deposited data Human NQO1 Ensembl ENSG00000181019 Human EPHA8 (HEK3) Ensembl ENSG00000070886 Experimental models: Cell lines SUIT-2 Creative Bioarray Cat# CSC-C6655J PANC-1 Creative Bioarray Cat#CSC-C7095J MIA-PaCa-2 Creative Bioarray Cat#CSC-C9492L HEK293T ATCC Cat# CRL-3216 Oligonucleotides HEK site3 guide antisenseF (29-mer): caccgacgccctctggaggaagcagttta IDT DNA N/A HEK site3 guide antisenseR (29-mer): ctcttaaactgcttcctccagagggcgtc IDT DNA N/A HEK site 3 PEG-RT_PBS antisense for Tevo (84-mer): gtgcgggcccagact gagcacggattacaaggatgacgacgataagtgatggcagaggaaaggaagccctgcttcctccagagg IDT DNA N/A HEK site 3 PEG-RT_PBS antisense rev Tevo (84-mer): cgcgcctctggag gaagcagggcttcctttcctctgccatcacttatcgtcgtcatccttgtaatccgtgctcagtctgggccc IDT DNA N/A HEK site3 guide senseF (29-mer): caccggcccagactgagcacgtgagttta IDT DNA N/A HEK site3 guide senseR (29-mer): ctcttaaactcacgtgctcagtctgggcc IDT DNA N/A HEK site 3 PEG-RT_PBS sense for Tevo (74-mer): gtgctggaggaagca gggcttcctttcctctgccatcacttatcgtcgtcatccttgtaatccgtgctcagtct IDT DNA N/A HEK site 3 PEG-RT_PBS anti rev Tevo (74-mer): cgcgagactgagcacgg attacaaggatgacgacgataagtgatggcagaggaaaggaagccctgcttcctcca IDT DNA N/A sgRNA guide 1, 5′- CAC CGA ATG CAG AAT GCC ACT CTG- 3′ IDT DNA N/A sgRNA guide 2, 5′- CAC CGC CCG AAT TCA AAT CCT GGA-3′ IDT DNA N/A F1 HEK3 5′- CGG ATT ACA AGG ATG ACG ATA AGT G- 3′ IDT DNA N/A (Continued on next page) STAR Protocols 7, 104904, December 18, 2026 7 MATERIALS AND EQUIPMENT eVLP plasmid DNA mix CRITICAL: Make fresh for each use.



    Similar Products

    pgl3‐basic luciferase expression vector  (Promega)
    90
    Promega pgl3‐basic luciferase expression vector
    A , Alignment of the human, mouse, and rat Ht sequences is shown. Conserved nucleotides are marked with asterisk. The arrow indicates the TSS. B through E , <t>Luciferase</t> assay in SH‐SY5Y cells transfected for 48 hour with <t>pGL3‐Br</t> ( B and D ) or pGL3‐Ht ( C and E ) and cotransfected with siCTL, siDNMT1, siMeCP2, or siREST ( B , C ), or with EV, DNMT1, MeCP2, or REST ( D and E ). * P ≤0.05 vs siCTL or EV by 1‐way ANOVA analysis followed by Tukey's post hoc test (n=4). CTL indicates control; DNMT1, DNA‐methyltransferase‐1; EV, empty vector; Ht , heart promoter, MeCP2, methyl‐CpG binding protein 2; NCX1, sodium/calcium exchanger 1; pGL3‐Br, Ncx1 brain promoter construct inserted in pGL3basic; pGL3‐Ht, Ncx1 heart promoter construct inserted in pGL3basic; REST, repressor element 1‐silencing transcription factor; si, small interfering; and TSS, transcription start site.
    Pgl3‐Basic Luciferase Expression Vector, supplied by Promega, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/pgl3-basic+luciferase+expression+vector/pgl3+basic/pmc11010005-43-21-25
    Average 90 stars, based on 1 article reviews
    pgl3‐basic luciferase expression vector - by Bioz Stars, 2026-10
    90/100 stars
    		  Buy from Supplier
    luciferase-expressing vector pgl3.basic  (Promega)
    90
    Promega luciferase-expressing vector pgl3.basic
    A , Alignment of the human, mouse, and rat Ht sequences is shown. Conserved nucleotides are marked with asterisk. The arrow indicates the TSS. B through E , <t>Luciferase</t> assay in SH‐SY5Y cells transfected for 48 hour with <t>pGL3‐Br</t> ( B and D ) or pGL3‐Ht ( C and E ) and cotransfected with siCTL, siDNMT1, siMeCP2, or siREST ( B , C ), or with EV, DNMT1, MeCP2, or REST ( D and E ). * P ≤0.05 vs siCTL or EV by 1‐way ANOVA analysis followed by Tukey's post hoc test (n=4). CTL indicates control; DNMT1, DNA‐methyltransferase‐1; EV, empty vector; Ht , heart promoter, MeCP2, methyl‐CpG binding protein 2; NCX1, sodium/calcium exchanger 1; pGL3‐Br, Ncx1 brain promoter construct inserted in pGL3basic; pGL3‐Ht, Ncx1 heart promoter construct inserted in pGL3basic; REST, repressor element 1‐silencing transcription factor; si, small interfering; and TSS, transcription start site.
    Luciferase Expressing Vector Pgl3.Basic, supplied by Promega, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/pgl3-basic+luciferase+expression+vector/pgl3+basic/pmc10415575-84-16-18
    Average 90 stars, based on 1 article reviews
    luciferase-expressing vector pgl3.basic - by Bioz Stars, 2026-10
    90/100 stars
    		  Buy from Supplier
    pgl3 basic luciferase expression vector  (Promega)
    90
    Promega pgl3 basic luciferase expression vector
    A. Quantification of DDAH2 mRNA levels in primary HUVECs naturally carrying the G/G (n = 10) or C/G genotype (n = 5). Total RNA was extracted from confluent cells. cDNA was reverse transcripted and analyzed by quantitative Real-Time PCR technique. Bars represent the means ± SD of two independent experiments carried out in triplicate (* P = 0.008 for G/G HUVECs vs C/G HUVECs); B. Luciferase activity was evaluated in immortalized HUVEC transfected with an empty <t>PGL3</t> luciferase vector (PGL3, light gray bar, n = 21); or a PGL3 vector carrying the rs9267551 G (PGL3G, white bar, n = 21); or a PGL3 vector carrying the rs9267551 C form (PGL3C, black bar, n = 21). Luciferase activity in mock transfected cells (mock, dark gray bar, n = 21) was assessed as a control. (** P = 0.00076 for PGL3G vs. PGL3C).
    Pgl3 Basic Luciferase Expression Vector, supplied by Promega, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/pgl3-basic+luciferase+expression+vector/pgl3+basic/pmc03338696-46-6-11
    Average 90 stars, based on 1 article reviews
    pgl3 basic luciferase expression vector - by Bioz Stars, 2026-10
    90/100 stars
    		  Buy from Supplier
    pgl3-basic firefly luciferase expression vector  (Promega)
    90
    Promega pgl3-basic firefly luciferase expression vector
    A. Quantification of DDAH2 mRNA levels in primary HUVECs naturally carrying the G/G (n = 10) or C/G genotype (n = 5). Total RNA was extracted from confluent cells. cDNA was reverse transcripted and analyzed by quantitative Real-Time PCR technique. Bars represent the means ± SD of two independent experiments carried out in triplicate (* P = 0.008 for G/G HUVECs vs C/G HUVECs); B. Luciferase activity was evaluated in immortalized HUVEC transfected with an empty <t>PGL3</t> luciferase vector (PGL3, light gray bar, n = 21); or a PGL3 vector carrying the rs9267551 G (PGL3G, white bar, n = 21); or a PGL3 vector carrying the rs9267551 C form (PGL3C, black bar, n = 21). Luciferase activity in mock transfected cells (mock, dark gray bar, n = 21) was assessed as a control. (** P = 0.00076 for PGL3G vs. PGL3C).
    Pgl3 Basic Firefly Luciferase Expression Vector, supplied by Promega, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/pgl3-basic+luciferase+expression+vector/pgl3+basic/pm36293554-293-16-21
    Average 90 stars, based on 1 article reviews
    pgl3-basic firefly luciferase expression vector - by Bioz Stars, 2026-10
    90/100 stars
    		  Buy from Supplier
    pgl3-basic luciferase expression vector  (Promega)
    90
    Promega pgl3-basic luciferase expression vector
    A. Quantification of DDAH2 mRNA levels in primary HUVECs naturally carrying the G/G (n = 10) or C/G genotype (n = 5). Total RNA was extracted from confluent cells. cDNA was reverse transcripted and analyzed by quantitative Real-Time PCR technique. Bars represent the means ± SD of two independent experiments carried out in triplicate (* P = 0.008 for G/G HUVECs vs C/G HUVECs); B. Luciferase activity was evaluated in immortalized HUVEC transfected with an empty <t>PGL3</t> luciferase vector (PGL3, light gray bar, n = 21); or a PGL3 vector carrying the rs9267551 G (PGL3G, white bar, n = 21); or a PGL3 vector carrying the rs9267551 C form (PGL3C, black bar, n = 21). Luciferase activity in mock transfected cells (mock, dark gray bar, n = 21) was assessed as a control. (** P = 0.00076 for PGL3G vs. PGL3C).
    Pgl3 Basic Luciferase Expression Vector, supplied by Promega, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/pgl3-basic+luciferase+expression+vector/pgl3+basic/pmc09303992-180-20-24
    Average 90 stars, based on 1 article reviews
    pgl3-basic luciferase expression vector - by Bioz Stars, 2026-10
    90/100 stars
    		  Buy from Supplier
    promoterless luciferase expression vector pgl3-basic  (Promega)
    90
    Promega promoterless luciferase expression vector pgl3-basic
    A. Quantification of DDAH2 mRNA levels in primary HUVECs naturally carrying the G/G (n = 10) or C/G genotype (n = 5). Total RNA was extracted from confluent cells. cDNA was reverse transcripted and analyzed by quantitative Real-Time PCR technique. Bars represent the means ± SD of two independent experiments carried out in triplicate (* P = 0.008 for G/G HUVECs vs C/G HUVECs); B. Luciferase activity was evaluated in immortalized HUVEC transfected with an empty <t>PGL3</t> luciferase vector (PGL3, light gray bar, n = 21); or a PGL3 vector carrying the rs9267551 G (PGL3G, white bar, n = 21); or a PGL3 vector carrying the rs9267551 C form (PGL3C, black bar, n = 21). Luciferase activity in mock transfected cells (mock, dark gray bar, n = 21) was assessed as a control. (** P = 0.00076 for PGL3G vs. PGL3C).
    Promoterless Luciferase Expression Vector Pgl3 Basic, supplied by Promega, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/pgl3-basic+luciferase+expression+vector/pgl3+basic/pm35302184-60-63-68
    Average 90 stars, based on 1 article reviews
    promoterless luciferase expression vector pgl3-basic - by Bioz Stars, 2026-10
    90/100 stars
    		  Buy from Supplier
    firefly luciferase expression vector (pgl3-basic vector  (Promega)
    90
    Promega firefly luciferase expression vector (pgl3-basic vector
    A. Quantification of DDAH2 mRNA levels in primary HUVECs naturally carrying the G/G (n = 10) or C/G genotype (n = 5). Total RNA was extracted from confluent cells. cDNA was reverse transcripted and analyzed by quantitative Real-Time PCR technique. Bars represent the means ± SD of two independent experiments carried out in triplicate (* P = 0.008 for G/G HUVECs vs C/G HUVECs); B. Luciferase activity was evaluated in immortalized HUVEC transfected with an empty <t>PGL3</t> luciferase vector (PGL3, light gray bar, n = 21); or a PGL3 vector carrying the rs9267551 G (PGL3G, white bar, n = 21); or a PGL3 vector carrying the rs9267551 C form (PGL3C, black bar, n = 21). Luciferase activity in mock transfected cells (mock, dark gray bar, n = 21) was assessed as a control. (** P = 0.00076 for PGL3G vs. PGL3C).
    Firefly Luciferase Expression Vector (Pgl3 Basic Vector, supplied by Promega, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/pgl3-basic+luciferase+expression+vector/pgl3+basic/pm32911010-285-34-40
    Average 90 stars, based on 1 article reviews
    firefly luciferase expression vector (pgl3-basic vector - by Bioz Stars, 2026-10
    90/100 stars
    		  Buy from Supplier

    Image Search Results


    A , Alignment of the human, mouse, and rat Ht sequences is shown. Conserved nucleotides are marked with asterisk. The arrow indicates the TSS. B through E , Luciferase assay in SH‐SY5Y cells transfected for 48 hour with pGL3‐Br ( B and D ) or pGL3‐Ht ( C and E ) and cotransfected with siCTL, siDNMT1, siMeCP2, or siREST ( B , C ), or with EV, DNMT1, MeCP2, or REST ( D and E ). * P ≤0.05 vs siCTL or EV by 1‐way ANOVA analysis followed by Tukey's post hoc test (n=4). CTL indicates control; DNMT1, DNA‐methyltransferase‐1; EV, empty vector; Ht , heart promoter, MeCP2, methyl‐CpG binding protein 2; NCX1, sodium/calcium exchanger 1; pGL3‐Br, Ncx1 brain promoter construct inserted in pGL3basic; pGL3‐Ht, Ncx1 heart promoter construct inserted in pGL3basic; REST, repressor element 1‐silencing transcription factor; si, small interfering; and TSS, transcription start site.

    Journal: Journal of the American Heart Association: Cardiovascular and Cerebrovascular Disease

    Article Title: Stroke Causes DNA Methylation at Ncx1 Heart Promoter in the Brain Via DNMT1/MeCP2/REST Epigenetic Complex

    doi: 10.1161/JAHA.123.030460

    Figure Lengend Snippet: A , Alignment of the human, mouse, and rat Ht sequences is shown. Conserved nucleotides are marked with asterisk. The arrow indicates the TSS. B through E , Luciferase assay in SH‐SY5Y cells transfected for 48 hour with pGL3‐Br ( B and D ) or pGL3‐Ht ( C and E ) and cotransfected with siCTL, siDNMT1, siMeCP2, or siREST ( B , C ), or with EV, DNMT1, MeCP2, or REST ( D and E ). * P ≤0.05 vs siCTL or EV by 1‐way ANOVA analysis followed by Tukey's post hoc test (n=4). CTL indicates control; DNMT1, DNA‐methyltransferase‐1; EV, empty vector; Ht , heart promoter, MeCP2, methyl‐CpG binding protein 2; NCX1, sodium/calcium exchanger 1; pGL3‐Br, Ncx1 brain promoter construct inserted in pGL3basic; pGL3‐Ht, Ncx1 heart promoter construct inserted in pGL3basic; REST, repressor element 1‐silencing transcription factor; si, small interfering; and TSS, transcription start site.

    Article Snippet: The PCR product was purified using StrataPrep DNA gel extraction kits (Agilent, Milan, Italy) and cloned into multiple cloning sites of pGL3‐basic luciferase expression vector (Promega, Milan, Italy).

    Techniques: Luciferase, Transfection, Plasmid Preparation, Binding Assay, Construct

    A , Top: JASPAR matrix representation (MA0138.1) of the consensus REST binding site on Ht gene ( Ht ‐RE1). Ht ‐RE1 sequence is represented in International Union of Pure and Applied Chemistry code. Bottom: Partial human genomic Ht sequence containing the predicted REST binding site (underlined). B , Luciferase assay in SH‐SY5Y cells under the following experimental conditions: (1) pGL3basic, (2) pGL3‐Ht+EV, (3) pGL3‐Ht+REST, (4) pGL3‐Ht‐RE1mut+EV, (5) pGL3‐Ht‐RE1mut+REST. * P ≤0.05 vs pGL3Ht+EV by 1‐way ANOVA analysis followed by Tukey's post hoc test (n=4). C , ChIP with anti‐REST antibody followed by qPCR of the promoter region containing the RE1 site on the Ht gene in SH‐SY5Y cells transiently transfected with (1) pGL3‐Ht+EV, (2) pGL3‐Ht+REST, (3) pGL3‐Ht+RE1mut+REST. * P ≤0.05 vs pGL3‐Ht+EV by 1‐way ANOVA analysis followed by Tukey's post hoc test (n=4). ChIP indicates chromatin immunoprecipitation; CTL, control; DNMT1, DNA‐methyltransferase‐1; EV, empty vector; Ht , heart promoter, MeCP2, methyl‐CpG binding protein 2; NCX1, sodium/calcium exchanger 1; pGL3‐Br, Ncx1 brain promoter construct inserted in pGL3basic; pGL3‐Ht, Ncx1 heart promoter construct inserted in pGL3basic; qRT‐PCR, quantitative real time polymerase chain reaction; RE1, repressor element 1; and REST, repressor element 1‐silencing transcription factor.

    Journal: Journal of the American Heart Association: Cardiovascular and Cerebrovascular Disease

    Article Title: Stroke Causes DNA Methylation at Ncx1 Heart Promoter in the Brain Via DNMT1/MeCP2/REST Epigenetic Complex

    doi: 10.1161/JAHA.123.030460

    Figure Lengend Snippet: A , Top: JASPAR matrix representation (MA0138.1) of the consensus REST binding site on Ht gene ( Ht ‐RE1). Ht ‐RE1 sequence is represented in International Union of Pure and Applied Chemistry code. Bottom: Partial human genomic Ht sequence containing the predicted REST binding site (underlined). B , Luciferase assay in SH‐SY5Y cells under the following experimental conditions: (1) pGL3basic, (2) pGL3‐Ht+EV, (3) pGL3‐Ht+REST, (4) pGL3‐Ht‐RE1mut+EV, (5) pGL3‐Ht‐RE1mut+REST. * P ≤0.05 vs pGL3Ht+EV by 1‐way ANOVA analysis followed by Tukey's post hoc test (n=4). C , ChIP with anti‐REST antibody followed by qPCR of the promoter region containing the RE1 site on the Ht gene in SH‐SY5Y cells transiently transfected with (1) pGL3‐Ht+EV, (2) pGL3‐Ht+REST, (3) pGL3‐Ht+RE1mut+REST. * P ≤0.05 vs pGL3‐Ht+EV by 1‐way ANOVA analysis followed by Tukey's post hoc test (n=4). ChIP indicates chromatin immunoprecipitation; CTL, control; DNMT1, DNA‐methyltransferase‐1; EV, empty vector; Ht , heart promoter, MeCP2, methyl‐CpG binding protein 2; NCX1, sodium/calcium exchanger 1; pGL3‐Br, Ncx1 brain promoter construct inserted in pGL3basic; pGL3‐Ht, Ncx1 heart promoter construct inserted in pGL3basic; qRT‐PCR, quantitative real time polymerase chain reaction; RE1, repressor element 1; and REST, repressor element 1‐silencing transcription factor.

    Article Snippet: The PCR product was purified using StrataPrep DNA gel extraction kits (Agilent, Milan, Italy) and cloned into multiple cloning sites of pGL3‐basic luciferase expression vector (Promega, Milan, Italy).

    Techniques: Binding Assay, Sequencing, Luciferase, Transfection, Chromatin Immunoprecipitation, Plasmid Preparation, Construct, Quantitative RT-PCR, Real-time Polymerase Chain Reaction

    A. Quantification of DDAH2 mRNA levels in primary HUVECs naturally carrying the G/G (n = 10) or C/G genotype (n = 5). Total RNA was extracted from confluent cells. cDNA was reverse transcripted and analyzed by quantitative Real-Time PCR technique. Bars represent the means ± SD of two independent experiments carried out in triplicate (* P = 0.008 for G/G HUVECs vs C/G HUVECs); B. Luciferase activity was evaluated in immortalized HUVEC transfected with an empty PGL3 luciferase vector (PGL3, light gray bar, n = 21); or a PGL3 vector carrying the rs9267551 G (PGL3G, white bar, n = 21); or a PGL3 vector carrying the rs9267551 C form (PGL3C, black bar, n = 21). Luciferase activity in mock transfected cells (mock, dark gray bar, n = 21) was assessed as a control. (** P = 0.00076 for PGL3G vs. PGL3C).

    Journal: PLoS ONE

    Article Title: A Functional Variant of the Dimethylarginine Dimethylaminohydrolase-2 Gene Is Associated with Insulin Sensitivity

    doi: 10.1371/journal.pone.0036224

    Figure Lengend Snippet: A. Quantification of DDAH2 mRNA levels in primary HUVECs naturally carrying the G/G (n = 10) or C/G genotype (n = 5). Total RNA was extracted from confluent cells. cDNA was reverse transcripted and analyzed by quantitative Real-Time PCR technique. Bars represent the means ± SD of two independent experiments carried out in triplicate (* P = 0.008 for G/G HUVECs vs C/G HUVECs); B. Luciferase activity was evaluated in immortalized HUVEC transfected with an empty PGL3 luciferase vector (PGL3, light gray bar, n = 21); or a PGL3 vector carrying the rs9267551 G (PGL3G, white bar, n = 21); or a PGL3 vector carrying the rs9267551 C form (PGL3C, black bar, n = 21). Luciferase activity in mock transfected cells (mock, dark gray bar, n = 21) was assessed as a control. (** P = 0.00076 for PGL3G vs. PGL3C).

    Article Snippet: Both fragments were inserted in the pGL3 basic luciferase expression vector (Promega, Madison, WI) and constructs sequence was confirmed by direct sequencing.

    Techniques: Real-time Polymerase Chain Reaction, Luciferase, Activity Assay, Transfection, Plasmid Preparation