Review



promoterless luciferase expression vector pgl3-basic  (Promega)

 
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 90

    Structured Review

    Promega promoterless luciferase expression vector pgl3-basic
    Promoterless Luciferase Expression Vector Pgl3 Basic, supplied by Promega, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/pgl3-basic+luciferase+expression+vector/pgl3+basic/pm35302184-60-63-68
    Average 90 stars, based on 1 article reviews
    promoterless luciferase expression vector pgl3-basic - by Bioz Stars, 2026-09
    90/100 stars

    Images

    Related Articles

    Luciferase:

    Article Title: Proline hydroxylation of CREB-regulated transcriptional coactivator 2 controls hepatic glucose metabolism
    Article Snippet: .. Dual luciferase activity assays—HEK293T cells were co-transfected with 0.5 μg of empty vector or plasmids encoding CRTC2 variants as indicated, along with 0.5 μg luciferase reporter plasmids and 80 ng of Renilla luciferase plasmid pRL-SV40 (Promega) as an internal control in 12 well plates. ..

    Activity Assay:

    Article Title: Proline hydroxylation of CREB-regulated transcriptional coactivator 2 controls hepatic glucose metabolism
    Article Snippet: .. Dual luciferase activity assays—HEK293T cells were co-transfected with 0.5 μg of empty vector or plasmids encoding CRTC2 variants as indicated, along with 0.5 μg luciferase reporter plasmids and 80 ng of Renilla luciferase plasmid pRL-SV40 (Promega) as an internal control in 12 well plates. ..

    Plasmid Preparation:

    Article Title: Proline hydroxylation of CREB-regulated transcriptional coactivator 2 controls hepatic glucose metabolism
    Article Snippet: .. Dual luciferase activity assays—HEK293T cells were co-transfected with 0.5 μg of empty vector or plasmids encoding CRTC2 variants as indicated, along with 0.5 μg luciferase reporter plasmids and 80 ng of Renilla luciferase plasmid pRL-SV40 (Promega) as an internal control in 12 well plates. ..

    Control:

    Article Title: Proline hydroxylation of CREB-regulated transcriptional coactivator 2 controls hepatic glucose metabolism
    Article Snippet: .. Dual luciferase activity assays—HEK293T cells were co-transfected with 0.5 μg of empty vector or plasmids encoding CRTC2 variants as indicated, along with 0.5 μg luciferase reporter plasmids and 80 ng of Renilla luciferase plasmid pRL-SV40 (Promega) as an internal control in 12 well plates. ..

    other:

    Article Title:
    Article Snippet: The plasmids for enhancer activity analysis were generated from pNL1.1 (Promega, N1001) (Supplemental Fig. S9B), and the plasmid served as the internal reference was generated from pGL4.10 (Promega, E6651) by insert a promoter of BmNPV ie-1 before luc2 (Supplemental Fig. S9A), which enables stable expression of the reference luciferase in BmN cells.

    Article Title: Egr-1 promotes the proliferation and migration of vascular smooth muscle cells by transcriptionally activating Egr-2 in arteriovenous fistulas
    Article Snippet: Rat EGR1 promoter (~1.3 Kb; PCR-amplified from rat VSMCs) cloned into pGL3-basic luciferase rep plasmid (Promega Corporation) to form EGR1 luciferase reporters.

    Article Title: Folie 1
    Article Snippet: Vendor Bulk anti-TGFB1,2,3 In Vivo 1D11.1 Human, Mouse, Bovine, Chicken Mouse IgG1 10μg/gBW AB_292143 6 Ichorbio Mouse IgG1 Isotype Control HKSP - Mouse IgG1 10μg/gBW AB_292138 2 Ichorbio Anti-mouse CD8 in vivo YTS169 Mouse Rat IgG2b 12,5μg/g BW AB_292144 5 Ichorbio Anti-mouse CD4 in vivo GK1.5 Mouse Rat IgG2b 12,5μg/g BW AB_292144 4 Ichorbio Rat IgG2b Isotype Control in vivo 1-2 - Rat IgG2b 12,5μg/g BW AB_292137 8 Ichorbio Supplementary Table S3: Primers used for RT-qPCR Target gene Direction Sequence (5’3’) GC [%] Length TM hu-TGF-β1 Fwd ATTCCTGGCGATACCTCAGC 55 20 59,4 hu-TGF-β1 Rev CGGTAGTGAACCCGTTGATG 55 20 59,4 hu-GAPDH Fwd GTCAGTGGTGGACCTGACCT 60 20 61,4 hu-GAPDH Rev TGAGCTTGACAAAGTGGTCG 50 20 57,3 Supplementary Table S4: Expression vectors Name Backbone Insert (cDNA) Selection marker RRID/parentage pMIG pMSCV empty IRES-GFP RRID:Addgene_ 9044 pMIG-CALRWT pMSCV Human CALRWT IRES-GFP Provided by Ann Mullally pMIG-CALRins5 pMSCV Human CALRins5 IRES-GFP Provided by Ann Mullally 9 pMIG-CALRdel52 pMSCV Human CALRdel52 IRES-GFP Provided by Ann Mullally pMSCV-MPL pMSCV Human MPL PKG- hygromycin resistance gene Provided by Ann Mullally pMIG-JAK2WT pMSCV Human JAK2WT IRES-GFP Provided by Justus Duyster pMIG-JAK2V617F pMSCV Human JAK2V617F IRES-GFP Provided by Justus Duyster pMSCV-EpoR pMSCV Human EPOR neomycin resistance gene In-house pMIG-STAT3WT pMX Human STAT3WT IRES-GFP In-house pMIGSTAT3V640F pMX Human STAT3V640F IRES-GFP In-house pGL4.73[ hRluc/SV40] pGL4 SV40 early enhancer, rRluc renilla luciferase Promega (E691A) pGL3-TGFb1 pGL3 Human TGFb1 promoter luciferase RRID:Addgene_ 101762 References: 1.

    Article Title:
    Article Snippet: RIG-I ubiquitination assays Purification of GST-RIG-I 2CARD from mammalian cells was done as previously described (8, 11). pEBGRIG-I 2CARD (4 μg) and pcDNA4 carrying indicated gene or pCAGGS-NS1 (Influenza A virus, 10 μg) (7) and pGL4.45[luc2P/ISRE/Hygro] (Promega) (100 ng) were transfected with Mirus TransIT-LT1 into 5x106 HEK293T cells in a 10 cm2 dish in DMEM high glucose with 5% FBS per manufacturer guidelines.

    Article Title:
    Article Snippet: The constructed pGL3-ELO11 reporter plasmid was cotransfected 211 with the pac-dsxM or pac-dsxF expression plasmid by FuGENE HD Transfection Reagent 212 (Promega) into Sf9 cells.

    Article Title:
    Article Snippet: A total of 24 h after gene KD in 6-well culture plates, 2 μg TOPFlash and 0.5 μg pRL (Promega, E2261) plasmids were transfected into SH-SY5Y cells (7.5×105) using FuGENE HD Transfection Reagent (Promega).

    Article Title:
    Article Snippet: A total of 2 μg of DKK1 promoter and 0.5 μg of pRL (Promega, E2261) plasmids were transfected into SH-SY5Y cells (7.5×105) using FuGENE HD Transfection Reagent (Promega) in a 6-well culture plate.



    Similar Products

    90
    Promega pgl3‐basic luciferase expression vector
    A , Alignment of the human, mouse, and rat Ht sequences is shown. Conserved nucleotides are marked with asterisk. The arrow indicates the TSS. B through E , <t>Luciferase</t> assay in SH‐SY5Y cells transfected for 48 hour with <t>pGL3‐Br</t> ( B and D ) or pGL3‐Ht ( C and E ) and cotransfected with siCTL, siDNMT1, siMeCP2, or siREST ( B , C ), or with EV, DNMT1, MeCP2, or REST ( D and E ). * P ≤0.05 vs siCTL or EV by 1‐way ANOVA analysis followed by Tukey's post hoc test (n=4). CTL indicates control; DNMT1, DNA‐methyltransferase‐1; EV, empty vector; Ht , heart promoter, MeCP2, methyl‐CpG binding protein 2; NCX1, sodium/calcium exchanger 1; pGL3‐Br, Ncx1 brain promoter construct inserted in pGL3basic; pGL3‐Ht, Ncx1 heart promoter construct inserted in pGL3basic; REST, repressor element 1‐silencing transcription factor; si, small interfering; and TSS, transcription start site.
    Pgl3‐Basic Luciferase Expression Vector, supplied by Promega, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/pgl3-basic+luciferase+expression+vector/pgl3+basic/pmc11010005-43-21-25
    Average 90 stars, based on 1 article reviews
    pgl3‐basic luciferase expression vector - by Bioz Stars, 2026-09
    90/100 stars
      Buy from Supplier

    90
    Promega luciferase-expressing vector pgl3.basic
    A , Alignment of the human, mouse, and rat Ht sequences is shown. Conserved nucleotides are marked with asterisk. The arrow indicates the TSS. B through E , <t>Luciferase</t> assay in SH‐SY5Y cells transfected for 48 hour with <t>pGL3‐Br</t> ( B and D ) or pGL3‐Ht ( C and E ) and cotransfected with siCTL, siDNMT1, siMeCP2, or siREST ( B , C ), or with EV, DNMT1, MeCP2, or REST ( D and E ). * P ≤0.05 vs siCTL or EV by 1‐way ANOVA analysis followed by Tukey's post hoc test (n=4). CTL indicates control; DNMT1, DNA‐methyltransferase‐1; EV, empty vector; Ht , heart promoter, MeCP2, methyl‐CpG binding protein 2; NCX1, sodium/calcium exchanger 1; pGL3‐Br, Ncx1 brain promoter construct inserted in pGL3basic; pGL3‐Ht, Ncx1 heart promoter construct inserted in pGL3basic; REST, repressor element 1‐silencing transcription factor; si, small interfering; and TSS, transcription start site.
    Luciferase Expressing Vector Pgl3.Basic, supplied by Promega, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/pgl3-basic+luciferase+expression+vector/pgl3+basic/pmc10415575-84-16-18
    Average 90 stars, based on 1 article reviews
    luciferase-expressing vector pgl3.basic - by Bioz Stars, 2026-09
    90/100 stars
      Buy from Supplier

    90
    Promega pgl3 basic luciferase expression vector
    A. Quantification of DDAH2 mRNA levels in primary HUVECs naturally carrying the G/G (n = 10) or C/G genotype (n = 5). Total RNA was extracted from confluent cells. cDNA was reverse transcripted and analyzed by quantitative Real-Time PCR technique. Bars represent the means ± SD of two independent experiments carried out in triplicate (* P = 0.008 for G/G HUVECs vs C/G HUVECs); B. Luciferase activity was evaluated in immortalized HUVEC transfected with an empty <t>PGL3</t> luciferase vector (PGL3, light gray bar, n = 21); or a PGL3 vector carrying the rs9267551 G (PGL3G, white bar, n = 21); or a PGL3 vector carrying the rs9267551 C form (PGL3C, black bar, n = 21). Luciferase activity in mock transfected cells (mock, dark gray bar, n = 21) was assessed as a control. (** P = 0.00076 for PGL3G vs. PGL3C).
    Pgl3 Basic Luciferase Expression Vector, supplied by Promega, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/pgl3-basic+luciferase+expression+vector/pgl3+basic/pmc03338696-46-6-11
    Average 90 stars, based on 1 article reviews
    pgl3 basic luciferase expression vector - by Bioz Stars, 2026-09
    90/100 stars
      Buy from Supplier

    90
    Promega pgl3-basic firefly luciferase expression vector
    A. Quantification of DDAH2 mRNA levels in primary HUVECs naturally carrying the G/G (n = 10) or C/G genotype (n = 5). Total RNA was extracted from confluent cells. cDNA was reverse transcripted and analyzed by quantitative Real-Time PCR technique. Bars represent the means ± SD of two independent experiments carried out in triplicate (* P = 0.008 for G/G HUVECs vs C/G HUVECs); B. Luciferase activity was evaluated in immortalized HUVEC transfected with an empty <t>PGL3</t> luciferase vector (PGL3, light gray bar, n = 21); or a PGL3 vector carrying the rs9267551 G (PGL3G, white bar, n = 21); or a PGL3 vector carrying the rs9267551 C form (PGL3C, black bar, n = 21). Luciferase activity in mock transfected cells (mock, dark gray bar, n = 21) was assessed as a control. (** P = 0.00076 for PGL3G vs. PGL3C).
    Pgl3 Basic Firefly Luciferase Expression Vector, supplied by Promega, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/pgl3-basic+luciferase+expression+vector/pgl3+basic/pm36293554-293-16-21
    Average 90 stars, based on 1 article reviews
    pgl3-basic firefly luciferase expression vector - by Bioz Stars, 2026-09
    90/100 stars
      Buy from Supplier

    90
    Promega pgl3-basic luciferase expression vector
    A. Quantification of DDAH2 mRNA levels in primary HUVECs naturally carrying the G/G (n = 10) or C/G genotype (n = 5). Total RNA was extracted from confluent cells. cDNA was reverse transcripted and analyzed by quantitative Real-Time PCR technique. Bars represent the means ± SD of two independent experiments carried out in triplicate (* P = 0.008 for G/G HUVECs vs C/G HUVECs); B. Luciferase activity was evaluated in immortalized HUVEC transfected with an empty <t>PGL3</t> luciferase vector (PGL3, light gray bar, n = 21); or a PGL3 vector carrying the rs9267551 G (PGL3G, white bar, n = 21); or a PGL3 vector carrying the rs9267551 C form (PGL3C, black bar, n = 21). Luciferase activity in mock transfected cells (mock, dark gray bar, n = 21) was assessed as a control. (** P = 0.00076 for PGL3G vs. PGL3C).
    Pgl3 Basic Luciferase Expression Vector, supplied by Promega, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/pgl3-basic+luciferase+expression+vector/pgl3+basic/pmc09303992-180-20-24
    Average 90 stars, based on 1 article reviews
    pgl3-basic luciferase expression vector - by Bioz Stars, 2026-09
    90/100 stars
      Buy from Supplier

    90
    Promega promoterless luciferase expression vector pgl3-basic
    A. Quantification of DDAH2 mRNA levels in primary HUVECs naturally carrying the G/G (n = 10) or C/G genotype (n = 5). Total RNA was extracted from confluent cells. cDNA was reverse transcripted and analyzed by quantitative Real-Time PCR technique. Bars represent the means ± SD of two independent experiments carried out in triplicate (* P = 0.008 for G/G HUVECs vs C/G HUVECs); B. Luciferase activity was evaluated in immortalized HUVEC transfected with an empty <t>PGL3</t> luciferase vector (PGL3, light gray bar, n = 21); or a PGL3 vector carrying the rs9267551 G (PGL3G, white bar, n = 21); or a PGL3 vector carrying the rs9267551 C form (PGL3C, black bar, n = 21). Luciferase activity in mock transfected cells (mock, dark gray bar, n = 21) was assessed as a control. (** P = 0.00076 for PGL3G vs. PGL3C).
    Promoterless Luciferase Expression Vector Pgl3 Basic, supplied by Promega, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/pgl3-basic+luciferase+expression+vector/pgl3+basic/pm35302184-60-63-68
    Average 90 stars, based on 1 article reviews
    promoterless luciferase expression vector pgl3-basic - by Bioz Stars, 2026-09
    90/100 stars
      Buy from Supplier

    90
    Promega firefly luciferase expression vector (pgl3-basic vector
    A. Quantification of DDAH2 mRNA levels in primary HUVECs naturally carrying the G/G (n = 10) or C/G genotype (n = 5). Total RNA was extracted from confluent cells. cDNA was reverse transcripted and analyzed by quantitative Real-Time PCR technique. Bars represent the means ± SD of two independent experiments carried out in triplicate (* P = 0.008 for G/G HUVECs vs C/G HUVECs); B. Luciferase activity was evaluated in immortalized HUVEC transfected with an empty <t>PGL3</t> luciferase vector (PGL3, light gray bar, n = 21); or a PGL3 vector carrying the rs9267551 G (PGL3G, white bar, n = 21); or a PGL3 vector carrying the rs9267551 C form (PGL3C, black bar, n = 21). Luciferase activity in mock transfected cells (mock, dark gray bar, n = 21) was assessed as a control. (** P = 0.00076 for PGL3G vs. PGL3C).
    Firefly Luciferase Expression Vector (Pgl3 Basic Vector, supplied by Promega, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/pgl3-basic+luciferase+expression+vector/pgl3+basic/pm32911010-285-34-40
    Average 90 stars, based on 1 article reviews
    firefly luciferase expression vector (pgl3-basic vector - by Bioz Stars, 2026-09
    90/100 stars
      Buy from Supplier

    Image Search Results


    A , Alignment of the human, mouse, and rat Ht sequences is shown. Conserved nucleotides are marked with asterisk. The arrow indicates the TSS. B through E , Luciferase assay in SH‐SY5Y cells transfected for 48 hour with pGL3‐Br ( B and D ) or pGL3‐Ht ( C and E ) and cotransfected with siCTL, siDNMT1, siMeCP2, or siREST ( B , C ), or with EV, DNMT1, MeCP2, or REST ( D and E ). * P ≤0.05 vs siCTL or EV by 1‐way ANOVA analysis followed by Tukey's post hoc test (n=4). CTL indicates control; DNMT1, DNA‐methyltransferase‐1; EV, empty vector; Ht , heart promoter, MeCP2, methyl‐CpG binding protein 2; NCX1, sodium/calcium exchanger 1; pGL3‐Br, Ncx1 brain promoter construct inserted in pGL3basic; pGL3‐Ht, Ncx1 heart promoter construct inserted in pGL3basic; REST, repressor element 1‐silencing transcription factor; si, small interfering; and TSS, transcription start site.

    Journal: Journal of the American Heart Association: Cardiovascular and Cerebrovascular Disease

    Article Title: Stroke Causes DNA Methylation at Ncx1 Heart Promoter in the Brain Via DNMT1/MeCP2/REST Epigenetic Complex

    doi: 10.1161/JAHA.123.030460

    Figure Lengend Snippet: A , Alignment of the human, mouse, and rat Ht sequences is shown. Conserved nucleotides are marked with asterisk. The arrow indicates the TSS. B through E , Luciferase assay in SH‐SY5Y cells transfected for 48 hour with pGL3‐Br ( B and D ) or pGL3‐Ht ( C and E ) and cotransfected with siCTL, siDNMT1, siMeCP2, or siREST ( B , C ), or with EV, DNMT1, MeCP2, or REST ( D and E ). * P ≤0.05 vs siCTL or EV by 1‐way ANOVA analysis followed by Tukey's post hoc test (n=4). CTL indicates control; DNMT1, DNA‐methyltransferase‐1; EV, empty vector; Ht , heart promoter, MeCP2, methyl‐CpG binding protein 2; NCX1, sodium/calcium exchanger 1; pGL3‐Br, Ncx1 brain promoter construct inserted in pGL3basic; pGL3‐Ht, Ncx1 heart promoter construct inserted in pGL3basic; REST, repressor element 1‐silencing transcription factor; si, small interfering; and TSS, transcription start site.

    Article Snippet: The PCR product was purified using StrataPrep DNA gel extraction kits (Agilent, Milan, Italy) and cloned into multiple cloning sites of pGL3‐basic luciferase expression vector (Promega, Milan, Italy).

    Techniques: Luciferase, Transfection, Plasmid Preparation, Binding Assay, Construct

    A , Top: JASPAR matrix representation (MA0138.1) of the consensus REST binding site on Ht gene ( Ht ‐RE1). Ht ‐RE1 sequence is represented in International Union of Pure and Applied Chemistry code. Bottom: Partial human genomic Ht sequence containing the predicted REST binding site (underlined). B , Luciferase assay in SH‐SY5Y cells under the following experimental conditions: (1) pGL3basic, (2) pGL3‐Ht+EV, (3) pGL3‐Ht+REST, (4) pGL3‐Ht‐RE1mut+EV, (5) pGL3‐Ht‐RE1mut+REST. * P ≤0.05 vs pGL3Ht+EV by 1‐way ANOVA analysis followed by Tukey's post hoc test (n=4). C , ChIP with anti‐REST antibody followed by qPCR of the promoter region containing the RE1 site on the Ht gene in SH‐SY5Y cells transiently transfected with (1) pGL3‐Ht+EV, (2) pGL3‐Ht+REST, (3) pGL3‐Ht+RE1mut+REST. * P ≤0.05 vs pGL3‐Ht+EV by 1‐way ANOVA analysis followed by Tukey's post hoc test (n=4). ChIP indicates chromatin immunoprecipitation; CTL, control; DNMT1, DNA‐methyltransferase‐1; EV, empty vector; Ht , heart promoter, MeCP2, methyl‐CpG binding protein 2; NCX1, sodium/calcium exchanger 1; pGL3‐Br, Ncx1 brain promoter construct inserted in pGL3basic; pGL3‐Ht, Ncx1 heart promoter construct inserted in pGL3basic; qRT‐PCR, quantitative real time polymerase chain reaction; RE1, repressor element 1; and REST, repressor element 1‐silencing transcription factor.

    Journal: Journal of the American Heart Association: Cardiovascular and Cerebrovascular Disease

    Article Title: Stroke Causes DNA Methylation at Ncx1 Heart Promoter in the Brain Via DNMT1/MeCP2/REST Epigenetic Complex

    doi: 10.1161/JAHA.123.030460

    Figure Lengend Snippet: A , Top: JASPAR matrix representation (MA0138.1) of the consensus REST binding site on Ht gene ( Ht ‐RE1). Ht ‐RE1 sequence is represented in International Union of Pure and Applied Chemistry code. Bottom: Partial human genomic Ht sequence containing the predicted REST binding site (underlined). B , Luciferase assay in SH‐SY5Y cells under the following experimental conditions: (1) pGL3basic, (2) pGL3‐Ht+EV, (3) pGL3‐Ht+REST, (4) pGL3‐Ht‐RE1mut+EV, (5) pGL3‐Ht‐RE1mut+REST. * P ≤0.05 vs pGL3Ht+EV by 1‐way ANOVA analysis followed by Tukey's post hoc test (n=4). C , ChIP with anti‐REST antibody followed by qPCR of the promoter region containing the RE1 site on the Ht gene in SH‐SY5Y cells transiently transfected with (1) pGL3‐Ht+EV, (2) pGL3‐Ht+REST, (3) pGL3‐Ht+RE1mut+REST. * P ≤0.05 vs pGL3‐Ht+EV by 1‐way ANOVA analysis followed by Tukey's post hoc test (n=4). ChIP indicates chromatin immunoprecipitation; CTL, control; DNMT1, DNA‐methyltransferase‐1; EV, empty vector; Ht , heart promoter, MeCP2, methyl‐CpG binding protein 2; NCX1, sodium/calcium exchanger 1; pGL3‐Br, Ncx1 brain promoter construct inserted in pGL3basic; pGL3‐Ht, Ncx1 heart promoter construct inserted in pGL3basic; qRT‐PCR, quantitative real time polymerase chain reaction; RE1, repressor element 1; and REST, repressor element 1‐silencing transcription factor.

    Article Snippet: The PCR product was purified using StrataPrep DNA gel extraction kits (Agilent, Milan, Italy) and cloned into multiple cloning sites of pGL3‐basic luciferase expression vector (Promega, Milan, Italy).

    Techniques: Binding Assay, Sequencing, Luciferase, Transfection, Chromatin Immunoprecipitation, Plasmid Preparation, Construct, Quantitative RT-PCR, Real-time Polymerase Chain Reaction

    A. Quantification of DDAH2 mRNA levels in primary HUVECs naturally carrying the G/G (n = 10) or C/G genotype (n = 5). Total RNA was extracted from confluent cells. cDNA was reverse transcripted and analyzed by quantitative Real-Time PCR technique. Bars represent the means ± SD of two independent experiments carried out in triplicate (* P = 0.008 for G/G HUVECs vs C/G HUVECs); B. Luciferase activity was evaluated in immortalized HUVEC transfected with an empty PGL3 luciferase vector (PGL3, light gray bar, n = 21); or a PGL3 vector carrying the rs9267551 G (PGL3G, white bar, n = 21); or a PGL3 vector carrying the rs9267551 C form (PGL3C, black bar, n = 21). Luciferase activity in mock transfected cells (mock, dark gray bar, n = 21) was assessed as a control. (** P = 0.00076 for PGL3G vs. PGL3C).

    Journal: PLoS ONE

    Article Title: A Functional Variant of the Dimethylarginine Dimethylaminohydrolase-2 Gene Is Associated with Insulin Sensitivity

    doi: 10.1371/journal.pone.0036224

    Figure Lengend Snippet: A. Quantification of DDAH2 mRNA levels in primary HUVECs naturally carrying the G/G (n = 10) or C/G genotype (n = 5). Total RNA was extracted from confluent cells. cDNA was reverse transcripted and analyzed by quantitative Real-Time PCR technique. Bars represent the means ± SD of two independent experiments carried out in triplicate (* P = 0.008 for G/G HUVECs vs C/G HUVECs); B. Luciferase activity was evaluated in immortalized HUVEC transfected with an empty PGL3 luciferase vector (PGL3, light gray bar, n = 21); or a PGL3 vector carrying the rs9267551 G (PGL3G, white bar, n = 21); or a PGL3 vector carrying the rs9267551 C form (PGL3C, black bar, n = 21). Luciferase activity in mock transfected cells (mock, dark gray bar, n = 21) was assessed as a control. (** P = 0.00076 for PGL3G vs. PGL3C).

    Article Snippet: Both fragments were inserted in the pGL3 basic luciferase expression vector (Promega, Madison, WI) and constructs sequence was confirmed by direct sequencing.

    Techniques: Real-time Polymerase Chain Reaction, Luciferase, Activity Assay, Transfection, Plasmid Preparation