Review



pgl 3-basic vector  (Promega)

 
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
    • 90
      Buy from Supplier

    Structured Review

    Promega pgl 3-basic vector
    Pgl 3 Basic Vector, supplied by Promega, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/pgl-3+basic/pgl3+basic/pm37898353-84-8-11
    Average 90 stars, based on 1 article reviews
    pgl 3-basic vector - by Bioz Stars, 2026-09
    90/100 stars

    Images

    Related Articles

    Luciferase:

    Article Title: Proline hydroxylation of CREB-regulated transcriptional coactivator 2 controls hepatic glucose metabolism
    Article Snippet: .. Dual luciferase activity assays—HEK293T cells were co-transfected with 0.5 μg of empty vector or plasmids encoding CRTC2 variants as indicated, along with 0.5 μg luciferase reporter plasmids and 80 ng of Renilla luciferase plasmid pRL-SV40 (Promega) as an internal control in 12 well plates. ..

    Activity Assay:

    Article Title: Proline hydroxylation of CREB-regulated transcriptional coactivator 2 controls hepatic glucose metabolism
    Article Snippet: .. Dual luciferase activity assays—HEK293T cells were co-transfected with 0.5 μg of empty vector or plasmids encoding CRTC2 variants as indicated, along with 0.5 μg luciferase reporter plasmids and 80 ng of Renilla luciferase plasmid pRL-SV40 (Promega) as an internal control in 12 well plates. ..

    Plasmid Preparation:

    Article Title: Proline hydroxylation of CREB-regulated transcriptional coactivator 2 controls hepatic glucose metabolism
    Article Snippet: .. Dual luciferase activity assays—HEK293T cells were co-transfected with 0.5 μg of empty vector or plasmids encoding CRTC2 variants as indicated, along with 0.5 μg luciferase reporter plasmids and 80 ng of Renilla luciferase plasmid pRL-SV40 (Promega) as an internal control in 12 well plates. ..

    Control:

    Article Title: Proline hydroxylation of CREB-regulated transcriptional coactivator 2 controls hepatic glucose metabolism
    Article Snippet: .. Dual luciferase activity assays—HEK293T cells were co-transfected with 0.5 μg of empty vector or plasmids encoding CRTC2 variants as indicated, along with 0.5 μg luciferase reporter plasmids and 80 ng of Renilla luciferase plasmid pRL-SV40 (Promega) as an internal control in 12 well plates. ..

    other:

    Article Title:
    Article Snippet: The plasmids for enhancer activity analysis were generated from pNL1.1 (Promega, N1001) (Supplemental Fig. S9B), and the plasmid served as the internal reference was generated from pGL4.10 (Promega, E6651) by insert a promoter of BmNPV ie-1 before luc2 (Supplemental Fig. S9A), which enables stable expression of the reference luciferase in BmN cells.

    Article Title: Egr-1 promotes the proliferation and migration of vascular smooth muscle cells by transcriptionally activating Egr-2 in arteriovenous fistulas
    Article Snippet: Rat EGR1 promoter (~1.3 Kb; PCR-amplified from rat VSMCs) cloned into pGL3-basic luciferase rep plasmid (Promega Corporation) to form EGR1 luciferase reporters.

    Article Title: Folie 1
    Article Snippet: Vendor Bulk anti-TGFB1,2,3 In Vivo 1D11.1 Human, Mouse, Bovine, Chicken Mouse IgG1 10μg/gBW AB_292143 6 Ichorbio Mouse IgG1 Isotype Control HKSP - Mouse IgG1 10μg/gBW AB_292138 2 Ichorbio Anti-mouse CD8 in vivo YTS169 Mouse Rat IgG2b 12,5μg/g BW AB_292144 5 Ichorbio Anti-mouse CD4 in vivo GK1.5 Mouse Rat IgG2b 12,5μg/g BW AB_292144 4 Ichorbio Rat IgG2b Isotype Control in vivo 1-2 - Rat IgG2b 12,5μg/g BW AB_292137 8 Ichorbio Supplementary Table S3: Primers used for RT-qPCR Target gene Direction Sequence (5’3’) GC [%] Length TM hu-TGF-β1 Fwd ATTCCTGGCGATACCTCAGC 55 20 59,4 hu-TGF-β1 Rev CGGTAGTGAACCCGTTGATG 55 20 59,4 hu-GAPDH Fwd GTCAGTGGTGGACCTGACCT 60 20 61,4 hu-GAPDH Rev TGAGCTTGACAAAGTGGTCG 50 20 57,3 Supplementary Table S4: Expression vectors Name Backbone Insert (cDNA) Selection marker RRID/parentage pMIG pMSCV empty IRES-GFP RRID:Addgene_ 9044 pMIG-CALRWT pMSCV Human CALRWT IRES-GFP Provided by Ann Mullally pMIG-CALRins5 pMSCV Human CALRins5 IRES-GFP Provided by Ann Mullally 9 pMIG-CALRdel52 pMSCV Human CALRdel52 IRES-GFP Provided by Ann Mullally pMSCV-MPL pMSCV Human MPL PKG- hygromycin resistance gene Provided by Ann Mullally pMIG-JAK2WT pMSCV Human JAK2WT IRES-GFP Provided by Justus Duyster pMIG-JAK2V617F pMSCV Human JAK2V617F IRES-GFP Provided by Justus Duyster pMSCV-EpoR pMSCV Human EPOR neomycin resistance gene In-house pMIG-STAT3WT pMX Human STAT3WT IRES-GFP In-house pMIGSTAT3V640F pMX Human STAT3V640F IRES-GFP In-house pGL4.73[ hRluc/SV40] pGL4 SV40 early enhancer, rRluc renilla luciferase Promega (E691A) pGL3-TGFb1 pGL3 Human TGFb1 promoter luciferase RRID:Addgene_ 101762 References: 1.

    Article Title:
    Article Snippet: RIG-I ubiquitination assays Purification of GST-RIG-I 2CARD from mammalian cells was done as previously described (8, 11). pEBGRIG-I 2CARD (4 μg) and pcDNA4 carrying indicated gene or pCAGGS-NS1 (Influenza A virus, 10 μg) (7) and pGL4.45[luc2P/ISRE/Hygro] (Promega) (100 ng) were transfected with Mirus TransIT-LT1 into 5x106 HEK293T cells in a 10 cm2 dish in DMEM high glucose with 5% FBS per manufacturer guidelines.

    Article Title:
    Article Snippet: The constructed pGL3-ELO11 reporter plasmid was cotransfected 211 with the pac-dsxM or pac-dsxF expression plasmid by FuGENE HD Transfection Reagent 212 (Promega) into Sf9 cells.

    Article Title:
    Article Snippet: A total of 24 h after gene KD in 6-well culture plates, 2 μg TOPFlash and 0.5 μg pRL (Promega, E2261) plasmids were transfected into SH-SY5Y cells (7.5×105) using FuGENE HD Transfection Reagent (Promega).

    Article Title:
    Article Snippet: A total of 2 μg of DKK1 promoter and 0.5 μg of pRL (Promega, E2261) plasmids were transfected into SH-SY5Y cells (7.5×105) using FuGENE HD Transfection Reagent (Promega) in a 6-well culture plate.



    Similar Products

    pgl-3 basic luciferase reporter  (Promega)
    90
    Promega pgl-3 basic luciferase reporter
    Pgl 3 Basic Luciferase Reporter, supplied by Promega, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/pgl-3+basic/pgl3+basic/pm39395526-115-28-30
    Average 90 stars, based on 1 article reviews
    pgl-3 basic luciferase reporter - by Bioz Stars, 2026-09
    90/100 stars
    		  Buy from Supplier
    pgl-3 basic plasmid  (Promega)
    90
    Promega pgl-3 basic plasmid
    Pgl 3 Basic Plasmid, supplied by Promega, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/pgl-3+basic/pgl3+basic/pmc11363405-50-15-16
    Average 90 stars, based on 1 article reviews
    pgl-3 basic plasmid - by Bioz Stars, 2026-09
    90/100 stars
    		  Buy from Supplier
    pgl 3- basic vector  (Promega)
    90
    Promega pgl 3- basic vector
    Pgl 3 Basic Vector, supplied by Promega, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/pgl-3+basic/pgl3+basic/pm38360124-80-27-31
    Average 90 stars, based on 1 article reviews
    pgl 3- basic vector - by Bioz Stars, 2026-09
    90/100 stars
    		  Buy from Supplier
    pgl 3-basic vector  (Promega)
    90
    Promega pgl 3-basic vector
    Pgl 3 Basic Vector, supplied by Promega, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/pgl-3+basic/pgl3+basic/pm37898353-84-8-11
    Average 90 stars, based on 1 article reviews
    pgl 3-basic vector - by Bioz Stars, 2026-09
    90/100 stars
    		  Buy from Supplier
    pgl-3 basic luciferase plasmid  (Promega)
    90
    Promega pgl-3 basic luciferase plasmid
    Pgl 3 Basic Luciferase Plasmid, supplied by Promega, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/pgl-3+basic/pgl3+basic/pmc10543288-259-33-37
    Average 90 stars, based on 1 article reviews
    pgl-3 basic luciferase plasmid - by Bioz Stars, 2026-09
    90/100 stars
    		  Buy from Supplier
    luciferase reported vector, pgl 3 -basic  (Promega)
    90
    Promega luciferase reported vector, pgl 3 -basic
    The (−2436/+149) region of the PAK3 promoter, containing several putative cJun/AP- binding sites, was cloned into the <t>pGL</t> <t>3</t> -Basic reporter vector. A: Luciferase promoter reporter assays performed in control cells, Rat1a-GFP, and Rat1a-J4 cells transiently transfected with empty vector, pGL 3 -Basic, and PAK3 promoter construct containing vector, pGL 3 -Basic-pPAK3 (−2436/+149). Cells were grown in the absence and presence of doxycycline. B: Luciferase promoter reporter assays performed in the parental rat fibroblast cell line, Rat1a, transfected with either pCMV-cJun or empty pCMV vector with the PAK3 promoter construct containing vector, pGL 3 -Basic-pPAK3 (−2436/+149). A plasmid containing four AP-1 binding sites, 4 X AP-1-Luc, was used as a control showing cJun activation. C: Luciferase reporter promoter assays for deletion constructs of the PAK3 promoter region (−2436/+149), (−2329/+149), (−684/+149) and (−179/+149) as well as a (−179/+149) with a mutated cJun/AP-1 binding site at position (+52/+60), in the presence and absence of doxycycline-induced cJun/AP-1 expression. D: Luciferase reporter assays, using the (−179/+149) PAK3 promoter construct, showing the effect of transient cJun inhibition on PAK3 promoter activity in the absence and presence of doxycycline induced cJun/AP-1 over-expression. Results show the mean±S.E. of experiments performed in triplicate and repeated at least three times. (*p≤0.05 and **p≤0.01).
    Luciferase Reported Vector, Pgl 3 Basic, supplied by Promega, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/pgl-3+basic/pgl3+basic/pmc03688571-139-34-37
    Average 90 stars, based on 1 article reviews
    luciferase reported vector, pgl 3 -basic - by Bioz Stars, 2026-09
    90/100 stars
    		  Buy from Supplier
    pgl-3 basic luc+ reporter vector  (Promega)
    90
    Promega pgl-3 basic luc+ reporter vector
    The (−2436/+149) region of the PAK3 promoter, containing several putative cJun/AP- binding sites, was cloned into the <t>pGL</t> <t>3</t> -Basic reporter vector. A: Luciferase promoter reporter assays performed in control cells, Rat1a-GFP, and Rat1a-J4 cells transiently transfected with empty vector, pGL 3 -Basic, and PAK3 promoter construct containing vector, pGL 3 -Basic-pPAK3 (−2436/+149). Cells were grown in the absence and presence of doxycycline. B: Luciferase promoter reporter assays performed in the parental rat fibroblast cell line, Rat1a, transfected with either pCMV-cJun or empty pCMV vector with the PAK3 promoter construct containing vector, pGL 3 -Basic-pPAK3 (−2436/+149). A plasmid containing four AP-1 binding sites, 4 X AP-1-Luc, was used as a control showing cJun activation. C: Luciferase reporter promoter assays for deletion constructs of the PAK3 promoter region (−2436/+149), (−2329/+149), (−684/+149) and (−179/+149) as well as a (−179/+149) with a mutated cJun/AP-1 binding site at position (+52/+60), in the presence and absence of doxycycline-induced cJun/AP-1 expression. D: Luciferase reporter assays, using the (−179/+149) PAK3 promoter construct, showing the effect of transient cJun inhibition on PAK3 promoter activity in the absence and presence of doxycycline induced cJun/AP-1 over-expression. Results show the mean±S.E. of experiments performed in triplicate and repeated at least three times. (*p≤0.05 and **p≤0.01).
    Pgl 3 Basic Luc+ Reporter Vector, supplied by Promega, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/pgl-3+basic/pgl3+basic/pmc03141418-86-36-41
    Average 90 stars, based on 1 article reviews
    pgl-3 basic luc+ reporter vector - by Bioz Stars, 2026-09
    90/100 stars
    		  Buy from Supplier
    pgl-3 luciferase basic vector  (Promega)
    90
    Promega pgl-3 luciferase basic vector
    The (−2436/+149) region of the PAK3 promoter, containing several putative cJun/AP- binding sites, was cloned into the <t>pGL</t> <t>3</t> -Basic reporter vector. A: Luciferase promoter reporter assays performed in control cells, Rat1a-GFP, and Rat1a-J4 cells transiently transfected with empty vector, pGL 3 -Basic, and PAK3 promoter construct containing vector, pGL 3 -Basic-pPAK3 (−2436/+149). Cells were grown in the absence and presence of doxycycline. B: Luciferase promoter reporter assays performed in the parental rat fibroblast cell line, Rat1a, transfected with either pCMV-cJun or empty pCMV vector with the PAK3 promoter construct containing vector, pGL 3 -Basic-pPAK3 (−2436/+149). A plasmid containing four AP-1 binding sites, 4 X AP-1-Luc, was used as a control showing cJun activation. C: Luciferase reporter promoter assays for deletion constructs of the PAK3 promoter region (−2436/+149), (−2329/+149), (−684/+149) and (−179/+149) as well as a (−179/+149) with a mutated cJun/AP-1 binding site at position (+52/+60), in the presence and absence of doxycycline-induced cJun/AP-1 expression. D: Luciferase reporter assays, using the (−179/+149) PAK3 promoter construct, showing the effect of transient cJun inhibition on PAK3 promoter activity in the absence and presence of doxycycline induced cJun/AP-1 over-expression. Results show the mean±S.E. of experiments performed in triplicate and repeated at least three times. (*p≤0.05 and **p≤0.01).
    Pgl 3 Luciferase Basic Vector, supplied by Promega, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/pgl-3+basic/pgl3+basic/pmc09275950-94-17-21
    Average 90 stars, based on 1 article reviews
    pgl-3 luciferase basic vector - by Bioz Stars, 2026-09
    90/100 stars
    		  Buy from Supplier
    basic luciferase vector pgl-3 control  (Promega)
    90
    Promega basic luciferase vector pgl-3 control
    The (−2436/+149) region of the PAK3 promoter, containing several putative cJun/AP- binding sites, was cloned into the <t>pGL</t> <t>3</t> -Basic reporter vector. A: Luciferase promoter reporter assays performed in control cells, Rat1a-GFP, and Rat1a-J4 cells transiently transfected with empty vector, pGL 3 -Basic, and PAK3 promoter construct containing vector, pGL 3 -Basic-pPAK3 (−2436/+149). Cells were grown in the absence and presence of doxycycline. B: Luciferase promoter reporter assays performed in the parental rat fibroblast cell line, Rat1a, transfected with either pCMV-cJun or empty pCMV vector with the PAK3 promoter construct containing vector, pGL 3 -Basic-pPAK3 (−2436/+149). A plasmid containing four AP-1 binding sites, 4 X AP-1-Luc, was used as a control showing cJun activation. C: Luciferase reporter promoter assays for deletion constructs of the PAK3 promoter region (−2436/+149), (−2329/+149), (−684/+149) and (−179/+149) as well as a (−179/+149) with a mutated cJun/AP-1 binding site at position (+52/+60), in the presence and absence of doxycycline-induced cJun/AP-1 expression. D: Luciferase reporter assays, using the (−179/+149) PAK3 promoter construct, showing the effect of transient cJun inhibition on PAK3 promoter activity in the absence and presence of doxycycline induced cJun/AP-1 over-expression. Results show the mean±S.E. of experiments performed in triplicate and repeated at least three times. (*p≤0.05 and **p≤0.01).
    Basic Luciferase Vector Pgl 3 Control, supplied by Promega, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/pgl-3+basic/pgl3+basic/pm33634427-71-30-34
    Average 90 stars, based on 1 article reviews
    basic luciferase vector pgl-3 control - by Bioz Stars, 2026-09
    90/100 stars
    		  Buy from Supplier
    luciferase reporter plasmid pgl-3 basic mrna and protein  (Promega)
    90
    Promega luciferase reporter plasmid pgl-3 basic mrna and protein
    The (−2436/+149) region of the PAK3 promoter, containing several putative cJun/AP- binding sites, was cloned into the <t>pGL</t> <t>3</t> -Basic reporter vector. A: Luciferase promoter reporter assays performed in control cells, Rat1a-GFP, and Rat1a-J4 cells transiently transfected with empty vector, pGL 3 -Basic, and PAK3 promoter construct containing vector, pGL 3 -Basic-pPAK3 (−2436/+149). Cells were grown in the absence and presence of doxycycline. B: Luciferase promoter reporter assays performed in the parental rat fibroblast cell line, Rat1a, transfected with either pCMV-cJun or empty pCMV vector with the PAK3 promoter construct containing vector, pGL 3 -Basic-pPAK3 (−2436/+149). A plasmid containing four AP-1 binding sites, 4 X AP-1-Luc, was used as a control showing cJun activation. C: Luciferase reporter promoter assays for deletion constructs of the PAK3 promoter region (−2436/+149), (−2329/+149), (−684/+149) and (−179/+149) as well as a (−179/+149) with a mutated cJun/AP-1 binding site at position (+52/+60), in the presence and absence of doxycycline-induced cJun/AP-1 expression. D: Luciferase reporter assays, using the (−179/+149) PAK3 promoter construct, showing the effect of transient cJun inhibition on PAK3 promoter activity in the absence and presence of doxycycline induced cJun/AP-1 over-expression. Results show the mean±S.E. of experiments performed in triplicate and repeated at least three times. (*p≤0.05 and **p≤0.01).
    Luciferase Reporter Plasmid Pgl 3 Basic Mrna And Protein, supplied by Promega, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/pgl-3+basic/pgl3+basic/pmc08891156-67-18-19
    Average 90 stars, based on 1 article reviews
    luciferase reporter plasmid pgl-3 basic mrna and protein - by Bioz Stars, 2026-09
    90/100 stars
    		  Buy from Supplier

    Image Search Results


    The (−2436/+149) region of the PAK3 promoter, containing several putative cJun/AP- binding sites, was cloned into the pGL 3 -Basic reporter vector. A: Luciferase promoter reporter assays performed in control cells, Rat1a-GFP, and Rat1a-J4 cells transiently transfected with empty vector, pGL 3 -Basic, and PAK3 promoter construct containing vector, pGL 3 -Basic-pPAK3 (−2436/+149). Cells were grown in the absence and presence of doxycycline. B: Luciferase promoter reporter assays performed in the parental rat fibroblast cell line, Rat1a, transfected with either pCMV-cJun or empty pCMV vector with the PAK3 promoter construct containing vector, pGL 3 -Basic-pPAK3 (−2436/+149). A plasmid containing four AP-1 binding sites, 4 X AP-1-Luc, was used as a control showing cJun activation. C: Luciferase reporter promoter assays for deletion constructs of the PAK3 promoter region (−2436/+149), (−2329/+149), (−684/+149) and (−179/+149) as well as a (−179/+149) with a mutated cJun/AP-1 binding site at position (+52/+60), in the presence and absence of doxycycline-induced cJun/AP-1 expression. D: Luciferase reporter assays, using the (−179/+149) PAK3 promoter construct, showing the effect of transient cJun inhibition on PAK3 promoter activity in the absence and presence of doxycycline induced cJun/AP-1 over-expression. Results show the mean±S.E. of experiments performed in triplicate and repeated at least three times. (*p≤0.05 and **p≤0.01).

    Journal: PLoS ONE

    Article Title: p21-Activated Kinase 3 (PAK3) Is an AP-1 Regulated Gene Contributing to Actin Organisation and Migration of Transformed Fibroblasts

    doi: 10.1371/journal.pone.0066892

    Figure Lengend Snippet: The (−2436/+149) region of the PAK3 promoter, containing several putative cJun/AP- binding sites, was cloned into the pGL 3 -Basic reporter vector. A: Luciferase promoter reporter assays performed in control cells, Rat1a-GFP, and Rat1a-J4 cells transiently transfected with empty vector, pGL 3 -Basic, and PAK3 promoter construct containing vector, pGL 3 -Basic-pPAK3 (−2436/+149). Cells were grown in the absence and presence of doxycycline. B: Luciferase promoter reporter assays performed in the parental rat fibroblast cell line, Rat1a, transfected with either pCMV-cJun or empty pCMV vector with the PAK3 promoter construct containing vector, pGL 3 -Basic-pPAK3 (−2436/+149). A plasmid containing four AP-1 binding sites, 4 X AP-1-Luc, was used as a control showing cJun activation. C: Luciferase reporter promoter assays for deletion constructs of the PAK3 promoter region (−2436/+149), (−2329/+149), (−684/+149) and (−179/+149) as well as a (−179/+149) with a mutated cJun/AP-1 binding site at position (+52/+60), in the presence and absence of doxycycline-induced cJun/AP-1 expression. D: Luciferase reporter assays, using the (−179/+149) PAK3 promoter construct, showing the effect of transient cJun inhibition on PAK3 promoter activity in the absence and presence of doxycycline induced cJun/AP-1 over-expression. Results show the mean±S.E. of experiments performed in triplicate and repeated at least three times. (*p≤0.05 and **p≤0.01).

    Article Snippet: PCR using high fidelity Expand Plus DNA Polymerase (Roche) was performed on rat genomic DNA, the products were sub-cloned into the pGEM-T Easy vector (Promega) and excised for cloning into the luciferase reported vector, pGL 3 -Basic (Promega) using Mlu1 and Xho1 restriction enzymes.

    Techniques: Binding Assay, Clone Assay, Plasmid Preparation, Luciferase, Transfection, Construct, Activation Assay, Expressing, Inhibition, Activity Assay, Over Expression