Review



pbluescript® ii ks+vector  (Agilent technologies)


Bioz Verified Symbol Agilent technologies is a verified supplier
Bioz Manufacturer Symbol Agilent technologies manufactures this product  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 90

    Structured Review

    Agilent technologies pbluescript® ii ks+vector
    Pbluescript® Ii Ks+Vector, supplied by Agilent technologies, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/pbluescript+ii+ks++vector/us11773408-279-48-51
    Average 90 stars, based on 1 article reviews
    pbluescript® ii ks+vector - by Bioz Stars, 2026-10
    90/100 stars

    Images

    Related Articles

    other:

    Article Title: X Ray-Induced Insulinoma Cell Line Rin-5F Has a Novel Mutation Site, C.A1459G (P.T487A), in Death Domain Associated Protein (DAXX) Gene
    Article Snippet: In order to facilitate sub-cloning into the pBlueScript II SK (+) vector (Stratagene, Santa Clara, California), XhoI and EcoRI sites were incorporated into the primer at the 5' and 3' ends, respectively, for Exon 1-7 and the cDNA of the DAXX gene.

    Article Title: Affinity-tagged SMAD1 and SMAD5 mouse lines reveal transcriptional reprogramming mechanisms during early pregnancy
    Article Snippet: The reference plasmids containing PA tag sequence were constructed in pBluescript II SK (+) vector (Agilent, Palo Alto, CA, USA).

    Article Title: Gene-therapy vectors for treating cardiomyopathy
    Article Snippet: Briefly, a 8105 bp-fragment containing the 5′ part of mouse Mybpc3 gene, which covers 1747 bp upstream of exon 1 up to exon 15, was obtained by long-range PCR or cloning from a FIX II genomic library derived from a 129/Svj mouse strain, and then cloned into the pBluescript® II KS+vector (Stratagene).

    Article Title: Crystal structure reveals the binding mode and selectivity of a photoswitchable ligand for the adenosine A 2A receptor.
    Article Snippet: The cDNA region of human A2AR was amplified from human spleen marathonready cDNA library (Clontech) by nested PCR method, and the coding sequence of A2AR was cloned into EcoRV restriction site of pBluescript II SK(+) vector (Stratagene).

    Article Title: Zelda is dispensable for Drosophila melanogaster histone gene regulation
    Article Snippet: To generate the HA TAG histone array transgene, we inserted a wild-type histone array sequence containing the 5 replication-dependent histone genes into a pBluescript II KS+ vector (Agilent #212207) and introduced mutations using a Q5 Site-Directed PCR Mutagenesis Kit (New England Biolabs).

    Article Title: Ccrk-Mak/Ick kinase signaling axis is a ciliary transport regulator essential for retinal photoreceptor maintenance
    Article Snippet: To generate the Ccrk flox mouse line, we subcloned an ∼ 11.5 kb Ccrk genomic fragment using C57BL/6 genomic DNA by PCR, inserted one loxP site into intron 2 and another loxP site into intron 4, cloned it into a modified pBluescript II KS (+) vector (Agilent) to make a targeting construct, and transfected the linearized targeting construct into the JM8A3 embryonic stem (ES) cell line ( ).

    Construct:

    Article Title: Nucleoporin Elys attaches peripheral chromatin to the nuclear pores in interphase nuclei
    Article Snippet: .. To generate pUAST-attB-hsp70-loxP-stop-loxP-Dam-Elys construct, the whole Elys ORF, lacking start codon, was initially assembled in the pBluescript II vector (Stratagene). ..

    Plasmid Preparation:

    Article Title: Nucleoporin Elys attaches peripheral chromatin to the nuclear pores in interphase nuclei
    Article Snippet: .. To generate pUAST-attB-hsp70-loxP-stop-loxP-Dam-Elys construct, the whole Elys ORF, lacking start codon, was initially assembled in the pBluescript II vector (Stratagene). ..

    Article Title: Brain-specific glycosylation enzyme GnT-IX maintains levels of protein tyrosine phosphatase receptor PTPRZ, thereby mediating glioma growth.
    Article Snippet: Plasmids All PCR steps were performed using Tks Gflex DNA Polymerase (TaKaRa). .. Human PTPRZ-long (6948 bp) was cloned by real-time PCR using total RNA from LN-229 cells with the primers 5′-GGAATTCGATATCAAATGCGAATCCTAAAGCGTTT-3′ (forward) and 5′- ACGGTATCGATAAGCTTTAAACTAAAGACTCTAAG-3′ (reverse) and subcloned into the EcoRV site of the pBluescript II SK vector (Stratagene) using an In-Fusion HD Cloning Kit (TaKaRa). .. For C-terminal sPTPRZ754-His, extracellular regions of PTPRZ-long after the signal peptide were amplified using PCR with the primers 5′-CCGGCCAGATCTCCCTACTACAGACAACAGAGAAA-3′ (forward) and 5′- CGTCGACCTGCAGCCTTAGTGATGGTGGTGATGATGGTGGTGATGATGATTGTATACCGGTTGGGT-3′ (reverse) and inserted between the SmaI and SacII sites of pDisplay (Thermo Fisher Scientific).

    Clone Assay:

    Article Title: Brain-specific glycosylation enzyme GnT-IX maintains levels of protein tyrosine phosphatase receptor PTPRZ, thereby mediating glioma growth.
    Article Snippet: Plasmids All PCR steps were performed using Tks Gflex DNA Polymerase (TaKaRa). .. Human PTPRZ-long (6948 bp) was cloned by real-time PCR using total RNA from LN-229 cells with the primers 5′-GGAATTCGATATCAAATGCGAATCCTAAAGCGTTT-3′ (forward) and 5′- ACGGTATCGATAAGCTTTAAACTAAAGACTCTAAG-3′ (reverse) and subcloned into the EcoRV site of the pBluescript II SK vector (Stratagene) using an In-Fusion HD Cloning Kit (TaKaRa). .. For C-terminal sPTPRZ754-His, extracellular regions of PTPRZ-long after the signal peptide were amplified using PCR with the primers 5′-CCGGCCAGATCTCCCTACTACAGACAACAGAGAAA-3′ (forward) and 5′- CGTCGACCTGCAGCCTTAGTGATGGTGGTGATGATGGTGGTGATGATGATTGTATACCGGTTGGGT-3′ (reverse) and inserted between the SmaI and SacII sites of pDisplay (Thermo Fisher Scientific).

    Real-time Polymerase Chain Reaction:

    Article Title: Brain-specific glycosylation enzyme GnT-IX maintains levels of protein tyrosine phosphatase receptor PTPRZ, thereby mediating glioma growth.
    Article Snippet: Plasmids All PCR steps were performed using Tks Gflex DNA Polymerase (TaKaRa). .. Human PTPRZ-long (6948 bp) was cloned by real-time PCR using total RNA from LN-229 cells with the primers 5′-GGAATTCGATATCAAATGCGAATCCTAAAGCGTTT-3′ (forward) and 5′- ACGGTATCGATAAGCTTTAAACTAAAGACTCTAAG-3′ (reverse) and subcloned into the EcoRV site of the pBluescript II SK vector (Stratagene) using an In-Fusion HD Cloning Kit (TaKaRa). .. For C-terminal sPTPRZ754-His, extracellular regions of PTPRZ-long after the signal peptide were amplified using PCR with the primers 5′-CCGGCCAGATCTCCCTACTACAGACAACAGAGAAA-3′ (forward) and 5′- CGTCGACCTGCAGCCTTAGTGATGGTGGTGATGATGGTGGTGATGATGATTGTATACCGGTTGGGT-3′ (reverse) and inserted between the SmaI and SacII sites of pDisplay (Thermo Fisher Scientific).

    Cloning:

    Article Title: Brain-specific glycosylation enzyme GnT-IX maintains levels of protein tyrosine phosphatase receptor PTPRZ, thereby mediating glioma growth.
    Article Snippet: Plasmids All PCR steps were performed using Tks Gflex DNA Polymerase (TaKaRa). .. Human PTPRZ-long (6948 bp) was cloned by real-time PCR using total RNA from LN-229 cells with the primers 5′-GGAATTCGATATCAAATGCGAATCCTAAAGCGTTT-3′ (forward) and 5′- ACGGTATCGATAAGCTTTAAACTAAAGACTCTAAG-3′ (reverse) and subcloned into the EcoRV site of the pBluescript II SK vector (Stratagene) using an In-Fusion HD Cloning Kit (TaKaRa). .. For C-terminal sPTPRZ754-His, extracellular regions of PTPRZ-long after the signal peptide were amplified using PCR with the primers 5′-CCGGCCAGATCTCCCTACTACAGACAACAGAGAAA-3′ (forward) and 5′- CGTCGACCTGCAGCCTTAGTGATGGTGGTGATGATGGTGGTGATGATGATTGTATACCGGTTGGGT-3′ (reverse) and inserted between the SmaI and SacII sites of pDisplay (Thermo Fisher Scientific).



    Similar Products

    97
    New England Biolabs pbluescript ii ks vector
    Pbluescript Ii Ks Vector, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 97/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/pbluescript+ii+ks++vector/NcoI-HF/pmc10944469-177-13-22
    Average 97 stars, based on 1 article reviews
    pbluescript ii ks vector - by Bioz Stars, 2026-10
    97/100 stars
      Buy from Supplier

    90
    Agilent technologies modified pbluescript ii ks (+) vector
    Modified Pbluescript Ii Ks (+) Vector, supplied by Agilent technologies, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/pbluescript+ii+ks++vector/bio_rxiv__2024__05__24__595694-255-41-46
    Average 90 stars, based on 1 article reviews
    modified pbluescript ii ks (+) vector - by Bioz Stars, 2026-10
    90/100 stars
      Buy from Supplier

    90
    GenScript corporation pbluescript ii ks (+) transcription vector
    Pbluescript Ii Ks (+) Transcription Vector, supplied by GenScript corporation, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/pbluescript+ii+ks++vector/pbluescript+ii+sk/pm38885779-101-1-11
    Average 90 stars, based on 1 article reviews
    pbluescript ii ks (+) transcription vector - by Bioz Stars, 2026-10
    90/100 stars
      Buy from Supplier

    99
    New England Biolabs bamhi digested pbluescript ii ks vector
    Bamhi Digested Pbluescript Ii Ks Vector, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/pbluescript+ii+ks++vector/BamHI/pmc10759152-104-16-28
    Average 99 stars, based on 1 article reviews
    bamhi digested pbluescript ii ks vector - by Bioz Stars, 2026-10
    99/100 stars
      Buy from Supplier

    90
    Agilent technologies pbluescript ii ks+ vector
    Pbluescript Ii Ks+ Vector, supplied by Agilent technologies, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/pbluescript+ii+ks++vector/bio_rxiv__2023__12__19__572383-144-23-27
    Average 90 stars, based on 1 article reviews
    pbluescript ii ks+ vector - by Bioz Stars, 2026-10
    90/100 stars
      Buy from Supplier

    90
    Agilent technologies pbluescript® ii ks+vector
    Pbluescript® Ii Ks+Vector, supplied by Agilent technologies, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/pbluescript+ii+ks++vector/us11773408-279-48-51
    Average 90 stars, based on 1 article reviews
    pbluescript® ii ks+vector - by Bioz Stars, 2026-10
    90/100 stars
      Buy from Supplier

    Image Search Results