Gene Expression:Article Title: Unveiling the spatiotemporal strategies of plants in response to biotic and abiotic stresses:A comprehensive review.
Article Snippet: Plant functions are governed by complex regulatory mechanisms that operate across diverse cell types in various tissues.. However, the challenge of dissecting plant tissues has hindered the widespread application of single-cell technologies in plant research.. Recent advancements in single-cell RNA sequencing (scRNA-seq) and spatial transcriptomics (ST) have propelled the field forward. scRNA-seq enables the examination of gene expression at the single-cell level, while ST preserves the spatial context of cellular organization.
In Situ:Article Title: Unveiling the spatiotemporal strategies of plants in response to biotic and abiotic stresses:A comprehensive review.
Article Snippet: Plant functions are governed by complex regulatory mechanisms that operate across diverse cell types in various tissues.. However, the challenge of dissecting plant tissues has hindered the widespread application of single-cell technologies in plant research.. Recent advancements in single-cell RNA sequencing (scRNA-seq) and spatial transcriptomics (ST) have propelled the field forward. scRNA-seq enables the examination of gene expression at the single-cell level, while ST preserves the spatial context of cellular organization.
other:Article Title: Tissular chromatin-state cartography based on double-barcoded DNA arrays that capture unloaded PA-Tn5 transposase
Article Snippet: Like in our previous study describing the use of double-barcoded DNA arrays for spatial transcriptomics , we have used BCr oligonucleotides presenting an amino C6 linker at the 5′ extremity, followed by four G or C nucleotides (S), a T7 promoter sequence (GACTCGTAATACGACTCACTATAGGG), a unique molecular identifier (UMI; WSNNWSNNV), a molecular barcode (8 nt) associated to the printed row in the DNA array, and a 30 nt adapter sequence with a GC-content of 40% (here named as Gibson sequence “ACATTGAAGAACCTG-TAGATAACTCGCTGT”).
Article Title: Spatial omics for accelerating plant research and crop improvement.
Article Snippet: Spatial transcriptomics facilitates visualization and quantification of gene expression across the entire transcriptome in plant tissue cryosections, using strategies such as barcoded oligo(dT) arrays and highPlant cells communicate information to regulate developmental processes and respond to environmental stresses.. This communication spans various ‘omics’ layers within a cell and operates through intricate regulatory networks.. The emergence of spatial omics presents a promising approach to thoroughly analyze cells, allowing the combined analysis of diverse modalities either in parallel or on the same tissue section.
Article Title: Single cell- and spatial 'Omics revolutionize physiology.
Article Snippet: NGS- based acquisition of spatially resolved gene expression information across whole tissue sections, without the need to manually preselect areas of interest, was first reported in 2016 as Spatial Transcriptomics.75 Here, tissue sections are placed on a glass slide carrying an array of spatially barcoded oligo(d)T- capture probes.
Article Title: Spatial Co-transcriptomics Reveals Discrete Stages of the Arbuscular Mycorrhizal Symbiosis
Article Snippet: Spatial transcriptomics allows for sequencing of cell transcriptomes within the tissue context in an untargeted manner via the use of barcoded oligo (dT) arrays to capture polyadenylated transcripts, adding a novel dimension to the data .
Isolation:Article Title: Exploring the identity of individual plant cells in space and time.
Article Snippet: .. Open access 0 Condition 1 Condition 2 Tissue sectioning Cell or nuclei isolation Tissue composition and organisation Spatially barcoded oligonucleotides Spatially resolved transcriptional domains Spatial transcriptomics Expression Gene A Gene C Gene B Gene D Gene E Gene F Gene G Gene H Gene I Gene J C lu st er 1 C lu st er 2 C lu st er 3 C lu st er 4 C lu st er 5 Cell clustering Imaging of marker genes Gene co-expression modules C orrelation Gene B Gene A Gene C Gene D Gene E Gene F G en e B G en e A G en e C G en e D G en e E G en e F Chromatin accessibility t-SNE1 t-S N E2 –30 –30 –20 –20 –10 –10 0 0 10 10 20 20 30 30 TF binding data TF Candidate TF regulators UMAP – 1 U M AP – 2 –10 –10 10 10 Pseudotim e 10 5 0 Trajectory analyses e.g. developmental lineage, time-course Dynamics of cell identity Comparison analyses e.g. genotypes, treatments Relative abundance Cell state A Cell state B Cell state C Log2 FC 0 5 10 15 20 25 –5–10 0 5 10 Differential expression Changes in cell composition Molecular phenotyping –L og 10 (P v al ue ) Cluster-specific markers Target genes Binding motif Cell 1 Cell 2 Cell 3 Cell N ... ... t-SNE1 –30 –30 –20 –20 0 20 10 10 –10 –10 30 20 30 t-S N E2 A AC CG GGT TTACTACT201 1 2 3 4 5 6 7 8 9Bi ts 5 3 Fig. 1 Biological insights gained from single-cell genomics. ..
Expressing:Article Title: Exploring the identity of individual plant cells in space and time.
Article Snippet: .. Open access 0 Condition 1 Condition 2 Tissue sectioning Cell or nuclei isolation Tissue composition and organisation Spatially barcoded oligonucleotides Spatially resolved transcriptional domains Spatial transcriptomics Expression Gene A Gene C Gene B Gene D Gene E Gene F Gene G Gene H Gene I Gene J C lu st er 1 C lu st er 2 C lu st er 3 C lu st er 4 C lu st er 5 Cell clustering Imaging of marker genes Gene co-expression modules C orrelation Gene B Gene A Gene C Gene D Gene E Gene F G en e B G en e A G en e C G en e D G en e E G en e F Chromatin accessibility t-SNE1 t-S N E2 –30 –30 –20 –20 –10 –10 0 0 10 10 20 20 30 30 TF binding data TF Candidate TF regulators UMAP – 1 U M AP – 2 –10 –10 10 10 Pseudotim e 10 5 0 Trajectory analyses e.g. developmental lineage, time-course Dynamics of cell identity Comparison analyses e.g. genotypes, treatments Relative abundance Cell state A Cell state B Cell state C Log2 FC 0 5 10 15 20 25 –5–10 0 5 10 Differential expression Changes in cell composition Molecular phenotyping –L og 10 (P v al ue ) Cluster-specific markers Target genes Binding motif Cell 1 Cell 2 Cell 3 Cell N ... ... t-SNE1 –30 –30 –20 –20 0 20 10 10 –10 –10 30 20 30 t-S N E2 A AC CG GGT TTACTACT201 1 2 3 4 5 6 7 8 9Bi ts 5 3 Fig. 1 Biological insights gained from single-cell genomics. ..
Imaging:Article Title: Exploring the identity of individual plant cells in space and time.
Article Snippet: .. Open access 0 Condition 1 Condition 2 Tissue sectioning Cell or nuclei isolation Tissue composition and organisation Spatially barcoded oligonucleotides Spatially resolved transcriptional domains Spatial transcriptomics Expression Gene A Gene C Gene B Gene D Gene E Gene F Gene G Gene H Gene I Gene J C lu st er 1 C lu st er 2 C lu st er 3 C lu st er 4 C lu st er 5 Cell clustering Imaging of marker genes Gene co-expression modules C orrelation Gene B Gene A Gene C Gene D Gene E Gene F G en e B G en e A G en e C G en e D G en e E G en e F Chromatin accessibility t-SNE1 t-S N E2 –30 –30 –20 –20 –10 –10 0 0 10 10 20 20 30 30 TF binding data TF Candidate TF regulators UMAP – 1 U M AP – 2 –10 –10 10 10 Pseudotim e 10 5 0 Trajectory analyses e.g. developmental lineage, time-course Dynamics of cell identity Comparison analyses e.g. genotypes, treatments Relative abundance Cell state A Cell state B Cell state C Log2 FC 0 5 10 15 20 25 –5–10 0 5 10 Differential expression Changes in cell composition Molecular phenotyping –L og 10 (P v al ue ) Cluster-specific markers Target genes Binding motif Cell 1 Cell 2 Cell 3 Cell N ... ... t-SNE1 –30 –30 –20 –20 0 20 10 10 –10 –10 30 20 30 t-S N E2 A AC CG GGT TTACTACT201 1 2 3 4 5 6 7 8 9Bi ts 5 3 Fig. 1 Biological insights gained from single-cell genomics. ..
Marker:Article Title: Exploring the identity of individual plant cells in space and time.
Article Snippet: .. Open access 0 Condition 1 Condition 2 Tissue sectioning Cell or nuclei isolation Tissue composition and organisation Spatially barcoded oligonucleotides Spatially resolved transcriptional domains Spatial transcriptomics Expression Gene A Gene C Gene B Gene D Gene E Gene F Gene G Gene H Gene I Gene J C lu st er 1 C lu st er 2 C lu st er 3 C lu st er 4 C lu st er 5 Cell clustering Imaging of marker genes Gene co-expression modules C orrelation Gene B Gene A Gene C Gene D Gene E Gene F G en e B G en e A G en e C G en e D G en e E G en e F Chromatin accessibility t-SNE1 t-S N E2 –30 –30 –20 –20 –10 –10 0 0 10 10 20 20 30 30 TF binding data TF Candidate TF regulators UMAP – 1 U M AP – 2 –10 –10 10 10 Pseudotim e 10 5 0 Trajectory analyses e.g. developmental lineage, time-course Dynamics of cell identity Comparison analyses e.g. genotypes, treatments Relative abundance Cell state A Cell state B Cell state C Log2 FC 0 5 10 15 20 25 –5–10 0 5 10 Differential expression Changes in cell composition Molecular phenotyping –L og 10 (P v al ue ) Cluster-specific markers Target genes Binding motif Cell 1 Cell 2 Cell 3 Cell N ... ... t-SNE1 –30 –30 –20 –20 0 20 10 10 –10 –10 30 20 30 t-S N E2 A AC CG GGT TTACTACT201 1 2 3 4 5 6 7 8 9Bi ts 5 3 Fig. 1 Biological insights gained from single-cell genomics. ..
Binding Assay:Article Title: Exploring the identity of individual plant cells in space and time.
Article Snippet: .. Open access 0 Condition 1 Condition 2 Tissue sectioning Cell or nuclei isolation Tissue composition and organisation Spatially barcoded oligonucleotides Spatially resolved transcriptional domains Spatial transcriptomics Expression Gene A Gene C Gene B Gene D Gene E Gene F Gene G Gene H Gene I Gene J C lu st er 1 C lu st er 2 C lu st er 3 C lu st er 4 C lu st er 5 Cell clustering Imaging of marker genes Gene co-expression modules C orrelation Gene B Gene A Gene C Gene D Gene E Gene F G en e B G en e A G en e C G en e D G en e E G en e F Chromatin accessibility t-SNE1 t-S N E2 –30 –30 –20 –20 –10 –10 0 0 10 10 20 20 30 30 TF binding data TF Candidate TF regulators UMAP – 1 U M AP – 2 –10 –10 10 10 Pseudotim e 10 5 0 Trajectory analyses e.g. developmental lineage, time-course Dynamics of cell identity Comparison analyses e.g. genotypes, treatments Relative abundance Cell state A Cell state B Cell state C Log2 FC 0 5 10 15 20 25 –5–10 0 5 10 Differential expression Changes in cell composition Molecular phenotyping –L og 10 (P v al ue ) Cluster-specific markers Target genes Binding motif Cell 1 Cell 2 Cell 3 Cell N ... ... t-SNE1 –30 –30 –20 –20 0 20 10 10 –10 –10 30 20 30 t-S N E2 A AC CG GGT TTACTACT201 1 2 3 4 5 6 7 8 9Bi ts 5 3 Fig. 1 Biological insights gained from single-cell genomics. ..
Comparison:Article Title: Exploring the identity of individual plant cells in space and time.
Article Snippet: .. Open access 0 Condition 1 Condition 2 Tissue sectioning Cell or nuclei isolation Tissue composition and organisation Spatially barcoded oligonucleotides Spatially resolved transcriptional domains Spatial transcriptomics Expression Gene A Gene C Gene B Gene D Gene E Gene F Gene G Gene H Gene I Gene J C lu st er 1 C lu st er 2 C lu st er 3 C lu st er 4 C lu st er 5 Cell clustering Imaging of marker genes Gene co-expression modules C orrelation Gene B Gene A Gene C Gene D Gene E Gene F G en e B G en e A G en e C G en e D G en e E G en e F Chromatin accessibility t-SNE1 t-S N E2 –30 –30 –20 –20 –10 –10 0 0 10 10 20 20 30 30 TF binding data TF Candidate TF regulators UMAP – 1 U M AP – 2 –10 –10 10 10 Pseudotim e 10 5 0 Trajectory analyses e.g. developmental lineage, time-course Dynamics of cell identity Comparison analyses e.g. genotypes, treatments Relative abundance Cell state A Cell state B Cell state C Log2 FC 0 5 10 15 20 25 –5–10 0 5 10 Differential expression Changes in cell composition Molecular phenotyping –L og 10 (P v al ue ) Cluster-specific markers Target genes Binding motif Cell 1 Cell 2 Cell 3 Cell N ... ... t-SNE1 –30 –30 –20 –20 0 20 10 10 –10 –10 30 20 30 t-S N E2 A AC CG GGT TTACTACT201 1 2 3 4 5 6 7 8 9Bi ts 5 3 Fig. 1 Biological insights gained from single-cell genomics. ..
Quantitative Proteomics:Article Title: Exploring the identity of individual plant cells in space and time.
Article Snippet: .. Open access 0 Condition 1 Condition 2 Tissue sectioning Cell or nuclei isolation Tissue composition and organisation Spatially barcoded oligonucleotides Spatially resolved transcriptional domains Spatial transcriptomics Expression Gene A Gene C Gene B Gene D Gene E Gene F Gene G Gene H Gene I Gene J C lu st er 1 C lu st er 2 C lu st er 3 C lu st er 4 C lu st er 5 Cell clustering Imaging of marker genes Gene co-expression modules C orrelation Gene B Gene A Gene C Gene D Gene E Gene F G en e B G en e A G en e C G en e D G en e E G en e F Chromatin accessibility t-SNE1 t-S N E2 –30 –30 –20 –20 –10 –10 0 0 10 10 20 20 30 30 TF binding data TF Candidate TF regulators UMAP – 1 U M AP – 2 –10 –10 10 10 Pseudotim e 10 5 0 Trajectory analyses e.g. developmental lineage, time-course Dynamics of cell identity Comparison analyses e.g. genotypes, treatments Relative abundance Cell state A Cell state B Cell state C Log2 FC 0 5 10 15 20 25 –5–10 0 5 10 Differential expression Changes in cell composition Molecular phenotyping –L og 10 (P v al ue ) Cluster-specific markers Target genes Binding motif Cell 1 Cell 2 Cell 3 Cell N ... ... t-SNE1 –30 –30 –20 –20 0 20 10 10 –10 –10 30 20 30 t-S N E2 A AC CG GGT TTACTACT201 1 2 3 4 5 6 7 8 9Bi ts 5 3 Fig. 1 Biological insights gained from single-cell genomics. ..
Spatial Transcriptomics:
|
