Review



plasmids  (OriGene)


Bioz Verified Symbol OriGene is a verified supplier
Bioz Manufacturer Symbol OriGene manufactures this product  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
    • 93
      Buy from Supplier

    Structured Review

    OriGene plasmids
    Plasmids, supplied by OriGene, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/nmda+receptor/Glutamate+receptor+ionotropic%2C+NMDA+2D+(GRIN2D)+(NM_000836)+Human+Tagged+ORF+Clone/pm41005304-332-7-19
    Average 93 stars, based on 1 article reviews
    plasmids - by Bioz Stars, 2026-10
    93/100 stars

    Images

    Related Articles

    Labeling:

    Article Title: Sensory neurons drive pancreatic cancer progression through glutamatergic neuron-cancer pseudo-synapses.
    Article Snippet: For generation of the knockdowns, siRNAs for human genes EZH2, E2F1, GRIN2D, and CaMK IV siRNA (2146, 1869, 2906, and 814, respectively, from siTOOLs) and shRNA for murine Grin2d [TRCN0000100210 (GCACAGGTATTTCATGAACAT), Gen-ID 14814, Merck] were used. .. For labeling of cancer and neural cells, plasmids with hGRIN2D-GFP tag, and mSlc17a6-RFP tag (RG224610 and CW310145, respectively, from OriGene) were utilized. .. For delivery of gene-editing tools into the target cells, LipofectamineTM RNAiMAX Transfection Reagent (Thermo Fisher) and LipofectamineTM 3000 (L3000008, Thermo Fisher) were used.



    Similar Products

    nmda antagonist dizocilpine  (TargetMol)
    94
    TargetMol nmda antagonist dizocilpine
    Heat maps of median changes in coherence for δ, θ, α, and β frequency bands across lead pairs after administration of saline (NaCl), caffeine (CAF), sulpiride (SLP), haloperidol (HAL), <t>dizocilpine</t> (DIZ), galantamine (GAL), tropicamide (TRO), hydroxyzine (HXZ), aminophenylbutyric acid (PHB), phenazepam (PHE), atipamezole (ATI), dexmedetomidine (DEX), and 5-ethyl-5-phenyl-2,4,6(1H,3H,5H)-pyrimidinetrione (PhBT). Initial data were differences between mean frequency band coherence ~20 min after administration and values before administration (~30 min of baseline recording). For each group, 6–10 recordings were made.
    Nmda Antagonist Dizocilpine, supplied by TargetMol, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/nmda+receptor/Neurotransmitter+Receptor+Compound+Library/pmc13600116-90-24-27
    Average 94 stars, based on 1 article reviews
    nmda antagonist dizocilpine - by Bioz Stars, 2026-10
    94/100 stars
    		  Buy from Supplier
    rabbit anti glun2a  (Cell Signaling Technology Inc)
    95
    Cell Signaling Technology Inc rabbit anti glun2a
    Heat maps of median changes in coherence for δ, θ, α, and β frequency bands across lead pairs after administration of saline (NaCl), caffeine (CAF), sulpiride (SLP), haloperidol (HAL), <t>dizocilpine</t> (DIZ), galantamine (GAL), tropicamide (TRO), hydroxyzine (HXZ), aminophenylbutyric acid (PHB), phenazepam (PHE), atipamezole (ATI), dexmedetomidine (DEX), and 5-ethyl-5-phenyl-2,4,6(1H,3H,5H)-pyrimidinetrione (PhBT). Initial data were differences between mean frequency band coherence ~20 min after administration and values before administration (~30 min of baseline recording). For each group, 6–10 recordings were made.
    Rabbit Anti Glun2a, supplied by Cell Signaling Technology Inc, used in various techniques. Bioz Stars score: 95/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/nmda+receptor/NMDA+Receptor+2A+(GluN2A)+Antibody/10__1038_slash_s41398___026___04379___7-186-49-53
    Average 95 stars, based on 1 article reviews
    rabbit anti glun2a - by Bioz Stars, 2026-10
    95/100 stars
    		  Buy from Supplier
    nmda receptors  (Tajima Shoji Co Ltd)
    86
    Tajima Shoji Co Ltd nmda receptors
    Heat maps of median changes in coherence for δ, θ, α, and β frequency bands across lead pairs after administration of saline (NaCl), caffeine (CAF), sulpiride (SLP), haloperidol (HAL), <t>dizocilpine</t> (DIZ), galantamine (GAL), tropicamide (TRO), hydroxyzine (HXZ), aminophenylbutyric acid (PHB), phenazepam (PHE), atipamezole (ATI), dexmedetomidine (DEX), and 5-ethyl-5-phenyl-2,4,6(1H,3H,5H)-pyrimidinetrione (PhBT). Initial data were differences between mean frequency band coherence ~20 min after administration and values before administration (~30 min of baseline recording). For each group, 6–10 recordings were made.
    Nmda Receptors, supplied by Tajima Shoji Co Ltd, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/nmda+receptor/nmda+receptors/pm42308865-84-0-27
    Average 86 stars, based on 1 article reviews
    nmda receptors - by Bioz Stars, 2026-10
    86/100 stars
    		  Buy from Supplier
    nmda receptor antagonist d ap5  (Alomone Labs)
    95
    Alomone Labs nmda receptor antagonist d ap5
    Heat maps of median changes in coherence for δ, θ, α, and β frequency bands across lead pairs after administration of saline (NaCl), caffeine (CAF), sulpiride (SLP), haloperidol (HAL), <t>dizocilpine</t> (DIZ), galantamine (GAL), tropicamide (TRO), hydroxyzine (HXZ), aminophenylbutyric acid (PHB), phenazepam (PHE), atipamezole (ATI), dexmedetomidine (DEX), and 5-ethyl-5-phenyl-2,4,6(1H,3H,5H)-pyrimidinetrione (PhBT). Initial data were differences between mean frequency band coherence ~20 min after administration and values before administration (~30 min of baseline recording). For each group, 6–10 recordings were made.
    Nmda Receptor Antagonist D Ap5, supplied by Alomone Labs, used in various techniques. Bioz Stars score: 95/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/nmda+receptor/D-AP5/pm42249483-203-10-16
    Average 95 stars, based on 1 article reviews
    nmda receptor antagonist d ap5 - by Bioz Stars, 2026-10
    95/100 stars
    		  Buy from Supplier
    nmda  (TargetMol)
    94
    TargetMol nmda
    Heat maps of median changes in coherence for δ, θ, α, and β frequency bands across lead pairs after administration of saline (NaCl), caffeine (CAF), sulpiride (SLP), haloperidol (HAL), <t>dizocilpine</t> (DIZ), galantamine (GAL), tropicamide (TRO), hydroxyzine (HXZ), aminophenylbutyric acid (PHB), phenazepam (PHE), atipamezole (ATI), dexmedetomidine (DEX), and 5-ethyl-5-phenyl-2,4,6(1H,3H,5H)-pyrimidinetrione (PhBT). Initial data were differences between mean frequency band coherence ~20 min after administration and values before administration (~30 min of baseline recording). For each group, 6–10 recordings were made.
    Nmda, supplied by TargetMol, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/nmda+receptor/Neurotransmitter+Receptor+Compound+Library/pm41984843-214-2-6
    Average 94 stars, based on 1 article reviews
    nmda - by Bioz Stars, 2026-10
    94/100 stars
    		  Buy from Supplier
    nmda receptors  (Tocris)
    95
    Tocris nmda receptors
    Heat maps of median changes in coherence for δ, θ, α, and β frequency bands across lead pairs after administration of saline (NaCl), caffeine (CAF), sulpiride (SLP), haloperidol (HAL), <t>dizocilpine</t> (DIZ), galantamine (GAL), tropicamide (TRO), hydroxyzine (HXZ), aminophenylbutyric acid (PHB), phenazepam (PHE), atipamezole (ATI), dexmedetomidine (DEX), and 5-ethyl-5-phenyl-2,4,6(1H,3H,5H)-pyrimidinetrione (PhBT). Initial data were differences between mean frequency band coherence ~20 min after administration and values before administration (~30 min of baseline recording). For each group, 6–10 recordings were made.
    Nmda Receptors, supplied by Tocris, used in various techniques. Bioz Stars score: 95/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/nmda+receptor/(R)-CPP/bio_rxiv__64898__2026__03__27__714842-228-12-14
    Average 95 stars, based on 1 article reviews
    nmda receptors - by Bioz Stars, 2026-10
    95/100 stars
    		  Buy from Supplier
    nmda receptor mediated epscs  (MedChemExpress)
    95
    MedChemExpress nmda receptor mediated epscs
    Heat maps of median changes in coherence for δ, θ, α, and β frequency bands across lead pairs after administration of saline (NaCl), caffeine (CAF), sulpiride (SLP), haloperidol (HAL), <t>dizocilpine</t> (DIZ), galantamine (GAL), tropicamide (TRO), hydroxyzine (HXZ), aminophenylbutyric acid (PHB), phenazepam (PHE), atipamezole (ATI), dexmedetomidine (DEX), and 5-ethyl-5-phenyl-2,4,6(1H,3H,5H)-pyrimidinetrione (PhBT). Initial data were differences between mean frequency band coherence ~20 min after administration and values before administration (~30 min of baseline recording). For each group, 6–10 recordings were made.
    Nmda Receptor Mediated Epscs, supplied by MedChemExpress, used in various techniques. Bioz Stars score: 95/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/nmda+receptor/NMDA/pmc13039951-80-1-14
    Average 95 stars, based on 1 article reviews
    nmda receptor mediated epscs - by Bioz Stars, 2026-10
    95/100 stars
    		  Buy from Supplier
    postsynaptic nmda receptor activation  (Dawley Inc)
    86
    Dawley Inc postsynaptic nmda receptor activation
    Heat maps of median changes in coherence for δ, θ, α, and β frequency bands across lead pairs after administration of saline (NaCl), caffeine (CAF), sulpiride (SLP), haloperidol (HAL), <t>dizocilpine</t> (DIZ), galantamine (GAL), tropicamide (TRO), hydroxyzine (HXZ), aminophenylbutyric acid (PHB), phenazepam (PHE), atipamezole (ATI), dexmedetomidine (DEX), and 5-ethyl-5-phenyl-2,4,6(1H,3H,5H)-pyrimidinetrione (PhBT). Initial data were differences between mean frequency band coherence ~20 min after administration and values before administration (~30 min of baseline recording). For each group, 6–10 recordings were made.
    Postsynaptic Nmda Receptor Activation, supplied by Dawley Inc, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/nmda+receptor/activation+nmda+postsynaptic+receptor/pm41763189-300-25-6
    Average 86 stars, based on 1 article reviews
    postsynaptic nmda receptor activation - by Bioz Stars, 2026-10
    86/100 stars
    		  Buy from Supplier

    Image Search Results


    Heat maps of median changes in coherence for δ, θ, α, and β frequency bands across lead pairs after administration of saline (NaCl), caffeine (CAF), sulpiride (SLP), haloperidol (HAL), dizocilpine (DIZ), galantamine (GAL), tropicamide (TRO), hydroxyzine (HXZ), aminophenylbutyric acid (PHB), phenazepam (PHE), atipamezole (ATI), dexmedetomidine (DEX), and 5-ethyl-5-phenyl-2,4,6(1H,3H,5H)-pyrimidinetrione (PhBT). Initial data were differences between mean frequency band coherence ~20 min after administration and values before administration (~30 min of baseline recording). For each group, 6–10 recordings were made.

    Journal: Methods and Protocols

    Article Title: Comparison of the Utility of Amplitude–Spectral and Coherence Features of Psychotropic Drugs’ Action on ECoG Signal for Pharmaco-EEG Based Drug Screening in Rats

    doi: 10.3390/mps9050123

    Figure Lengend Snippet: Heat maps of median changes in coherence for δ, θ, α, and β frequency bands across lead pairs after administration of saline (NaCl), caffeine (CAF), sulpiride (SLP), haloperidol (HAL), dizocilpine (DIZ), galantamine (GAL), tropicamide (TRO), hydroxyzine (HXZ), aminophenylbutyric acid (PHB), phenazepam (PHE), atipamezole (ATI), dexmedetomidine (DEX), and 5-ethyl-5-phenyl-2,4,6(1H,3H,5H)-pyrimidinetrione (PhBT). Initial data were differences between mean frequency band coherence ~20 min after administration and values before administration (~30 min of baseline recording). For each group, 6–10 recordings were made.

    Article Snippet: The training set, against which test-set pharmacological effects were classified, comprised previously published matrices of drug effects [ , , , , ]: the NMDA antagonist dizocilpine (Targetmol Chemicals Inc., Wellesley Hills, MA, USA); D2/D3 dopamine antagonists haloperidol (OOO Velpharm, Russia) and sulpiride (AO Organica, Novokuznetsk, Russia); the M-anticholinergic tropicamide (Tocris Bioscience, Bristol, UK); the H1/5-HT2A receptor blocker hydroxyzine (Sigma-Aldrich Chemie GmbH, Taufkirchen, Germany); the acetylcholinesterase inhibitor galantamine (Sopharma AD, Sofia, Bulgaria); the α2-adrenergic agonist dexmedetomidine (Orion Corporation, Espoo, Finland); and GABA-mimetics aminophenylbutyric acid (phenibut) (Tocris Bioscience, Bristol, UK) and bromdihydrochlorophenylbenzodiazepine (phenazepam) (AO Novosibkhimpharm, Novosibirsk, Russia) ( C).

    Techniques: Saline