Review



multiscripe reverse transcriptase  (Thermo Fisher)


Bioz Verified Symbol Thermo Fisher is a verified supplier
Bioz Manufacturer Symbol Thermo Fisher manufactures this product  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
    • 90
      Buy from Supplier

    Structured Review

    Thermo Fisher multiscripe reverse transcriptase
    Multiscripe Reverse Transcriptase, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/multiscripe+reverse+transcriptase/us09708619-1627-18-21
    Average 90 stars, based on 1 article reviews
    multiscripe reverse transcriptase - by Bioz Stars, 2026-11
    90/100 stars

    Images

    Related Articles

    Reverse Transcription:

    Article Title: Methods for controlling gene expression using ta-siRNA
    Article Snippet: The primers and probes used were: PDS forward primer MW-P83F (TTGGAGAACTTGGGATCAATG) (SEQ ID NO: 211), PDS reverse primer MW-P84R (GGCATAGCAAAAATCATGGAG) (SEQ ID NO: 212), PDS Taqman probe #86 (GCAGTGGA) (SEQ ID NO: 214) from Roche Applied Science Q-RT-PCR universal probe library (cat# 04689119001); GAPDH forward primer MW-P71F (TCGAGGGAACAGGAGTGTTT) (SEQ ID NO: 197), GAPDH reverse primer MW-P72R(CTCCGGCTTGGATATGCTT) (SEQ ID NO: 198), GAPDH taqman probe #68 (AGGAGCAG) (SEQ ID NO: 207) from Roche Applied Science Q-RT-PCR universal probe library (cat# 04688678001); Actin 2 forward primer MW-P67F (TCCTTGTACGCCAGTGGTC) (SEQ ID NO: 199), Actin 2 reverse primer MW-P68R(CACGTCCAGCAAGGTCAAG) (SEQ ID NO: 200), Actin 2 Taqman probe #88 (CATCCTCC) (SEQ ID NO: 208) from Roche Applied Science Q-RT-PCR universal probe library (cat# 04689135001) Total RNA was purified from plants using Trizol Reagent (Invitrogen, #15596-026). .. Fifteen ng of the total RNA was used in reverse transcription reaction (15 L) using reverse primers and MultiScripe Reverse Transcriptase (Applied Biosystems, # 4139983) according to the manufacturer protocol. .. The primers and probes used were: PDS forward primer MW-P83F (TTGGAGAACTTGGGATCAATG) (SEQ ID NO: 211), PDS reverse primer MW-P84R (GGCATAGCAAAAATCATGGAG) (SEQ ID NO: 212), PDS Taqman probe #86 (GCAGTGGA) (SEQ ID NO: 214) from Roche Applied Science Q-RT-PCR universal probe library (cat# 04689119001); GAPDH forward primer MW-P71F (TCGAGGGAACAGGAGTGTTT) (SEQ ID NO: 197), GAPDH reverse primer MW-P72R(CTCCGGCTTGGATATGCTT) (SEQ ID NO: 198), GAPDH taqman probe #68 (AGGAGCAG) (SEQ ID NO: 207) from Roche Applied Science Q-RT-PCR universal probe library (cat# 04688678001); Actin 2 forward primer MW-P67F (TCCTTGTACGCCAGTGGTC) (SEQ ID NO: 199), Actin 2 reverse primer MW-P68R(CACGTCCAGCAAGGTCAAG) (SEQ ID NO: 200), Actin 2 Taqman probe #88 (CATCCTCC) (SEQ ID NO: 208) from Roche Applied Science Q-RT-PCR universal probe library (cat# 04689135001) Total RNA was purified from plants using Trizol Reagent (Invitrogen, #15596-026).



    Similar Products

    multiscripe® reverse transcriptase  (Thermo Fisher)
    90
    Thermo Fisher multiscripe® reverse transcriptase
    Multiscripe® Reverse Transcriptase, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/multiscripe+reverse+transcriptase/multiscripe++reverse+transcriptase/pmc08563617__125_2021_5557_MOESM1_ESM-36-25-37
    Average 90 stars, based on 1 article reviews
    multiscripe® reverse transcriptase - by Bioz Stars, 2026-11
    90/100 stars
    		  Buy from Supplier
    multiscripe reverse transcriptase  (Thermo Fisher)
    90
    Thermo Fisher multiscripe reverse transcriptase
    Multiscripe Reverse Transcriptase, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/multiscripe+reverse+transcriptase/us09708619-1627-18-21
    Average 90 stars, based on 1 article reviews
    multiscripe reverse transcriptase - by Bioz Stars, 2026-11
    90/100 stars
    		  Buy from Supplier

    Image Search Results