Review



using an rt-pcr kit that uses multiscribe reverse transcriptase and random hexamer primers  (Thermo Fisher)


Bioz Verified Symbol Thermo Fisher is a verified supplier
Bioz Manufacturer Symbol Thermo Fisher manufactures this product  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 90

    Structured Review

    Thermo Fisher using an rt-pcr kit that uses multiscribe reverse transcriptase and random hexamer primers
    Using An Rt Pcr Kit That Uses Multiscribe Reverse Transcriptase And Random Hexamer Primers, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/multiscribe+reverse+transcriptase+using+random+hexamers/pm12358780-72-50-61
    Average 90 stars, based on 1 article reviews
    using an rt-pcr kit that uses multiscribe reverse transcriptase and random hexamer primers - by Bioz Stars, 2026-09
    90/100 stars

    Images

    Related Articles

    Clinical Proteomics:

    Article Title: Progression to AIDS in South Africa Is Associated with both Reverting and Compensatory Viral Mutations
    Article Snippet: .. In brief, to amplify the autologous HIV gag-protease viral RNA was extracted from plasma, reverse transcribed and amplified using specific primers in the first round of nested PCR using the Superscript III One-step RT-PCR kit with high fidelity Platinum Taq polymerase (Invitrogen) (forward primer: 5′ AAATCTCTAGCAGTGGCGCCCGAACAG 3′ , HXB2 nucleotides 623 to 649; reverse primer: 5′ TTTAACCCTGCTGGGTGTGGTATYCCT 3′ , HXB2 nucleotides 2851 to 2825). .. The second round of the nested PCR was conducted using a 100-mer primer pair (forward primer: 5′ GACTCGGCTTGCTGAAGCGCGCACGGCAAGAGGCGAGGGGCGGCGACTGGTGAGTACGCCAAAAATTTTGACTAGCGGAGGCTAGAAGGAGAGAGATGGG 3′ , HXB2 nucleotides 695 to 794; reverse primer: 5′ GGCCCAATTTTTGAAATTTTTCCTTCCTTTTCCATTTCTGTACAAATTTCTACTAATGCTTTTATTTTTTCTTCTGTCAATGGCCATTGTTTAACTTTTG 3′ , HXB2 nucleotides 2704 to 2605) that completely matched the pNL4-3 sequences using Platinum Taq polymerase (Invitrogen).

    Reverse Transcription:

    Article Title: Progression to AIDS in South Africa Is Associated with both Reverting and Compensatory Viral Mutations
    Article Snippet: .. In brief, to amplify the autologous HIV gag-protease viral RNA was extracted from plasma, reverse transcribed and amplified using specific primers in the first round of nested PCR using the Superscript III One-step RT-PCR kit with high fidelity Platinum Taq polymerase (Invitrogen) (forward primer: 5′ AAATCTCTAGCAGTGGCGCCCGAACAG 3′ , HXB2 nucleotides 623 to 649; reverse primer: 5′ TTTAACCCTGCTGGGTGTGGTATYCCT 3′ , HXB2 nucleotides 2851 to 2825). .. The second round of the nested PCR was conducted using a 100-mer primer pair (forward primer: 5′ GACTCGGCTTGCTGAAGCGCGCACGGCAAGAGGCGAGGGGCGGCGACTGGTGAGTACGCCAAAAATTTTGACTAGCGGAGGCTAGAAGGAGAGAGATGGG 3′ , HXB2 nucleotides 695 to 794; reverse primer: 5′ GGCCCAATTTTTGAAATTTTTCCTTCCTTTTCCATTTCTGTACAAATTTCTACTAATGCTTTTATTTTTTCTTCTGTCAATGGCCATTGTTTAACTTTTG 3′ , HXB2 nucleotides 2704 to 2605) that completely matched the pNL4-3 sequences using Platinum Taq polymerase (Invitrogen).

    Amplification:

    Article Title: Progression to AIDS in South Africa Is Associated with both Reverting and Compensatory Viral Mutations
    Article Snippet: .. In brief, to amplify the autologous HIV gag-protease viral RNA was extracted from plasma, reverse transcribed and amplified using specific primers in the first round of nested PCR using the Superscript III One-step RT-PCR kit with high fidelity Platinum Taq polymerase (Invitrogen) (forward primer: 5′ AAATCTCTAGCAGTGGCGCCCGAACAG 3′ , HXB2 nucleotides 623 to 649; reverse primer: 5′ TTTAACCCTGCTGGGTGTGGTATYCCT 3′ , HXB2 nucleotides 2851 to 2825). .. The second round of the nested PCR was conducted using a 100-mer primer pair (forward primer: 5′ GACTCGGCTTGCTGAAGCGCGCACGGCAAGAGGCGAGGGGCGGCGACTGGTGAGTACGCCAAAAATTTTGACTAGCGGAGGCTAGAAGGAGAGAGATGGG 3′ , HXB2 nucleotides 695 to 794; reverse primer: 5′ GGCCCAATTTTTGAAATTTTTCCTTCCTTTTCCATTTCTGTACAAATTTCTACTAATGCTTTTATTTTTTCTTCTGTCAATGGCCATTGTTTAACTTTTG 3′ , HXB2 nucleotides 2704 to 2605) that completely matched the pNL4-3 sequences using Platinum Taq polymerase (Invitrogen).

    Nested PCR:

    Article Title: Progression to AIDS in South Africa Is Associated with both Reverting and Compensatory Viral Mutations
    Article Snippet: .. In brief, to amplify the autologous HIV gag-protease viral RNA was extracted from plasma, reverse transcribed and amplified using specific primers in the first round of nested PCR using the Superscript III One-step RT-PCR kit with high fidelity Platinum Taq polymerase (Invitrogen) (forward primer: 5′ AAATCTCTAGCAGTGGCGCCCGAACAG 3′ , HXB2 nucleotides 623 to 649; reverse primer: 5′ TTTAACCCTGCTGGGTGTGGTATYCCT 3′ , HXB2 nucleotides 2851 to 2825). .. The second round of the nested PCR was conducted using a 100-mer primer pair (forward primer: 5′ GACTCGGCTTGCTGAAGCGCGCACGGCAAGAGGCGAGGGGCGGCGACTGGTGAGTACGCCAAAAATTTTGACTAGCGGAGGCTAGAAGGAGAGAGATGGG 3′ , HXB2 nucleotides 695 to 794; reverse primer: 5′ GGCCCAATTTTTGAAATTTTTCCTTCCTTTTCCATTTCTGTACAAATTTCTACTAATGCTTTTATTTTTTCTTCTGTCAATGGCCATTGTTTAACTTTTG 3′ , HXB2 nucleotides 2704 to 2605) that completely matched the pNL4-3 sequences using Platinum Taq polymerase (Invitrogen).

    One Step RT-PCR:

    Article Title: Progression to AIDS in South Africa Is Associated with both Reverting and Compensatory Viral Mutations
    Article Snippet: .. In brief, to amplify the autologous HIV gag-protease viral RNA was extracted from plasma, reverse transcribed and amplified using specific primers in the first round of nested PCR using the Superscript III One-step RT-PCR kit with high fidelity Platinum Taq polymerase (Invitrogen) (forward primer: 5′ AAATCTCTAGCAGTGGCGCCCGAACAG 3′ , HXB2 nucleotides 623 to 649; reverse primer: 5′ TTTAACCCTGCTGGGTGTGGTATYCCT 3′ , HXB2 nucleotides 2851 to 2825). .. The second round of the nested PCR was conducted using a 100-mer primer pair (forward primer: 5′ GACTCGGCTTGCTGAAGCGCGCACGGCAAGAGGCGAGGGGCGGCGACTGGTGAGTACGCCAAAAATTTTGACTAGCGGAGGCTAGAAGGAGAGAGATGGG 3′ , HXB2 nucleotides 695 to 794; reverse primer: 5′ GGCCCAATTTTTGAAATTTTTCCTTCCTTTTCCATTTCTGTACAAATTTCTACTAATGCTTTTATTTTTTCTTCTGTCAATGGCCATTGTTTAACTTTTG 3′ , HXB2 nucleotides 2704 to 2605) that completely matched the pNL4-3 sequences using Platinum Taq polymerase (Invitrogen).

    Quantitative RT-PCR:

    Article Title: Severe COVID-19 patients have impaired plasmacytoid dendritic cell-mediated control of SARS-CoV-2
    Article Snippet: .. The mRNA levels of human MXA, ISG15 , IFNL, IL6, TNF and glyceraldehyde-3-phosphate dehydrogenase ( GADPH ) were determined by RT-qPCR using iScript RT kit (Life Technologies) and PCR Master Mix kit (Life Technologies) for qPCR and analyzed using StepOnePlus Real-Time PCR v2.3 system (Life Technologies). ..

    Polymerase Chain Reaction:

    Article Title: Severe COVID-19 patients have impaired plasmacytoid dendritic cell-mediated control of SARS-CoV-2
    Article Snippet: .. The mRNA levels of human MXA, ISG15 , IFNL, IL6, TNF and glyceraldehyde-3-phosphate dehydrogenase ( GADPH ) were determined by RT-qPCR using iScript RT kit (Life Technologies) and PCR Master Mix kit (Life Technologies) for qPCR and analyzed using StepOnePlus Real-Time PCR v2.3 system (Life Technologies). ..

    Article Title: Changes of CD4 + CD25 + Regulatory T Cells, FoxP3 in Adjuvant Arthritis Rats with Damage of Pulmonary Function and Effects of Tripterygium Glycosides Tablet
    Article Snippet: Anti-mouse Foxp3 monoclonal antibody (Santa Cruz, USA, Lot: SC-130666). .. PCR Master Mix Kit and M-Mulv Reverse Kit (Fermentas, Canada, Lot: K0171, K1622). .. Microplate reader was produced by Bio-TEK Corporation, USA (Model: ELX800).

    Real-time Polymerase Chain Reaction:

    Article Title: Severe COVID-19 patients have impaired plasmacytoid dendritic cell-mediated control of SARS-CoV-2
    Article Snippet: .. The mRNA levels of human MXA, ISG15 , IFNL, IL6, TNF and glyceraldehyde-3-phosphate dehydrogenase ( GADPH ) were determined by RT-qPCR using iScript RT kit (Life Technologies) and PCR Master Mix kit (Life Technologies) for qPCR and analyzed using StepOnePlus Real-Time PCR v2.3 system (Life Technologies). ..

    other:

    Article Title: A novel role of macrophage PIST protein in regulating Leishmania major infection
    Article Snippet: From extracted total RNA, cDNA was prepared by RT PCR kit (Superscript III, Invitrogen), and BECN 1 (1 st -445 th amino acid) gene was amplified using forward primer (5’- GCGGGATCCATGGAGGGGTCTAAGGCGTC-3’) and reverse primers (5’- CGCAAGCTTTCAGAACTGTGAGGACACCCAGGC-3’).

    Article Title: Onion plants ( Allium cepa L.) react differently to salinity levels according to the regulation of aquaporins
    Article Snippet: An Applied Biosystems RT-PCR kit (Thermo Fisher Scientific Company) was used for the synthesis of cDNA from the RNA extracted.

    Article Title: Synergistic effect of PARP inhibitor and BRD4 inhibitor in multiple models of ovarian cancer
    Article Snippet: Real‐Time PCR Master Mixes kit (Life Technologies) was used for the thermocycling reaction in a BioRad CFX96 Real‐Time system.

    Article Title: Modulation of TLR 3, 7 and 8 Expressions in HCV Genotype 3 Infected Individuals: Potential Correlations of Pathogenesis and Spontaneous Clearance
    Article Snippet: Quantitative HCV RNA was estimated in-house using ABI real-time RT-PCR kit (AgPath-ID One Step RT-PCR kit).

    Reverse Transcription Polymerase Chain Reaction:

    Article Title: M-CSF Signals through the MAPK/ERK Pathway via Sp1 to Induce VEGF Production and Induces Angiogenesis In Vivo
    Article Snippet: .. Monocyte total RNA was collected using the Absolutely RNATM RT-PCR Miniprep Kit Stratagene® (La Jolla, CA) for total RNA purification as previously described . cDNA was synthesized using the Gibco BRL SuperScript First-Strand Synthesis System for RT-PCR Kit. ..

    Purification:

    Article Title: M-CSF Signals through the MAPK/ERK Pathway via Sp1 to Induce VEGF Production and Induces Angiogenesis In Vivo
    Article Snippet: .. Monocyte total RNA was collected using the Absolutely RNATM RT-PCR Miniprep Kit Stratagene® (La Jolla, CA) for total RNA purification as previously described . cDNA was synthesized using the Gibco BRL SuperScript First-Strand Synthesis System for RT-PCR Kit. ..

    Synthesized:

    Article Title: M-CSF Signals through the MAPK/ERK Pathway via Sp1 to Induce VEGF Production and Induces Angiogenesis In Vivo
    Article Snippet: .. Monocyte total RNA was collected using the Absolutely RNATM RT-PCR Miniprep Kit Stratagene® (La Jolla, CA) for total RNA purification as previously described . cDNA was synthesized using the Gibco BRL SuperScript First-Strand Synthesis System for RT-PCR Kit. ..



    Similar Products

    90
    Thermo Fisher multiscribe reverse transcriptase using random hexamers
    Multiscribe Reverse Transcriptase Using Random Hexamers, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/multiscribe+reverse+transcriptase+using+random+hexamers/multiscribe+reverse+transcriptase+using+random+hexamers/pm40289073-144-5-7
    Average 90 stars, based on 1 article reviews
    multiscribe reverse transcriptase using random hexamers - by Bioz Stars, 2026-09
    90/100 stars
      Buy from Supplier

    90
    Thermo Fisher using an rt-pcr kit that uses multiscribe reverse transcriptase and random hexamer primers
    Using An Rt Pcr Kit That Uses Multiscribe Reverse Transcriptase And Random Hexamer Primers, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/multiscribe+reverse+transcriptase+using+random+hexamers/pm12358780-72-50-61
    Average 90 stars, based on 1 article reviews
    using an rt-pcr kit that uses multiscribe reverse transcriptase and random hexamer primers - by Bioz Stars, 2026-09
    90/100 stars
      Buy from Supplier

    Image Search Results