lambda zap ii vector at xhoi neb (New England Biolabs)
New England Biolabs is a verified supplier 
New England Biolabs manufactures this product 
99
Structured Review
New England Biolabs
lambda zap ii vector at xhoi neb
Lambda Zap Ii Vector At Xhoi Neb, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 99/100, based on 9085 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/lambda+zap+ii/XhoI/pm34509026-86-5-11
Average 99 stars, based on 9085 article reviews
Lambda Zap Ii Vector At Xhoi Neb, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 99/100, based on 9085 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/lambda+zap+ii/XhoI/pm34509026-86-5-11
Average 99 stars, based on 9085 article reviews
lambda zap ii vector at xhoi neb - by Bioz Stars,
2026-10
99/100 stars
Images
Related Articles
In Vitro:Article Title: Mechanistic insights into Sindbis virus infection: noncapped genomic RNAs enhance the translation of capped genomic RNAs to promote viral infectivity Article Snippet: .. Linearized templates for in vitro transcription of vRNA were prepared by digesting 4 μg of the infectious clone plasmids with the Amplification:Article Title: Enzymatic mutant suitable for homogeneous immunoassay method Article Snippet: This DNA encoded in a plasmid was amplified by PCR with reaction at 94° C. for 2 minutes followed by 30 cycles of reaction at 94° C. for 30 seconds, at 55° C. for 30 seconds, and at 68° C. for 1 minute by using the primers GUS_NotBack (ATAAGAATGCGGCCGCTATGTTACGTCCTGTAGAAA) (SEQ ID NO: 4) and GUSmIV5 XhoFor (GCCCTCGAGTCATTGTTTGTCTCCCTG) (SEQ ID NO: 5) and KOD-Plus-Neo DNA polymerase (TOYOBO CO., LTD.). .. The amplified GUS(IV-5)KE fragment was cleaved with the restriction enzymes NotI and Ligation:Article Title: Enzymatic mutant suitable for homogeneous immunoassay method Article Snippet: This DNA encoded in a plasmid was amplified by PCR with reaction at 94° C. for 2 minutes followed by 30 cycles of reaction at 94° C. for 30 seconds, at 55° C. for 30 seconds, and at 68° C. for 1 minute by using the primers GUS_NotBack (ATAAGAATGCGGCCGCTATGTTACGTCCTGTAGAAA) (SEQ ID NO: 4) and GUSmIV5 XhoFor (GCCCTCGAGTCATTGTTTGTCTCCCTG) (SEQ ID NO: 5) and KOD-Plus-Neo DNA polymerase (TOYOBO CO., LTD.). .. The amplified GUS(IV-5)KE fragment was cleaved with the restriction enzymes NotI and Purification:Article Title: FUT10 and FUT11 are protein O-fucosyltransferases that modify protein EMI domains. Article Snippet: Primers RU004 and RU005, synthesized by Invitrogen, were used. .. The purified PCR product was digested with restriction enzymes BamHI (NEB) and Polymerase Chain Reaction:Article Title: FUT10 and FUT11 are protein O-fucosyltransferases that modify protein EMI domains. Article Snippet: Primers RU004 and RU005, synthesized by Invitrogen, were used. .. The purified PCR product was digested with restriction enzymes BamHI (NEB) and Article Title: FUT10 and FUT11 are protein O-fucosyltransferases that modify protein EMI domains. Article Snippet: PCR products were treated with DpnI to remove the parental plasmid before being transformed into DH5α-competent cells (Invitrogen). pcDNA4-hMMRN1 N-terminal EMI-Myc-His6 encoding the first 290 amino acids covering the N-terminal EMI domain of hMMRN1 was subcloned from pcDNA3.1-hMMRN1 WT-Myc-His6 using CloneAmp HiFi PCR Premix with primers AI364 and AI365. .. PCR products were digested with HindIII and Article Title: Influenza A Virus H7 nanobody recognizes a conserved immunodominant epitope on hemagglutinin head and confers heterosubtypic protection Article Snippet: .. The cloning strategy involved double-digestion of the pDZ plasmid with E co RI-HF (NEB, R3101S) and Article Title: Influenza A Virus H7 nanobody recognizes a conserved immunodominant epitope on hemagglutinin head and confers heterosubtypic protection. Article Snippet: .. The cloning strategy involved doubledigestion of the pDZ plasmid with EcoRI-HF (NEB, R3101S) and Clone Assay:Article Title: FUT10 and FUT11 are protein O-fucosyltransferases that modify protein EMI domains. Article Snippet: Primers RU004 and RU005, synthesized by Invitrogen, were used. .. The purified PCR product was digested with restriction enzymes BamHI (NEB) and Article Title: FUT10 and FUT11 are protein O-fucosyltransferases that modify protein EMI domains. Article Snippet: PCR products were treated with DpnI to remove the parental plasmid before being transformed into DH5α-competent cells (Invitrogen). pcDNA4-hMMRN1 N-terminal EMI-Myc-His6 encoding the first 290 amino acids covering the N-terminal EMI domain of hMMRN1 was subcloned from pcDNA3.1-hMMRN1 WT-Myc-His6 using CloneAmp HiFi PCR Premix with primers AI364 and AI365. .. PCR products were digested with HindIII and Expressing:Article Title: FUT10 and FUT11 are protein O-fucosyltransferases that modify protein EMI domains. Article Snippet: PCR products were treated with DpnI to remove the parental plasmid before being transformed into DH5α-competent cells (Invitrogen). pcDNA4-hMMRN1 N-terminal EMI-Myc-His6 encoding the first 290 amino acids covering the N-terminal EMI domain of hMMRN1 was subcloned from pcDNA3.1-hMMRN1 WT-Myc-His6 using CloneAmp HiFi PCR Premix with primers AI364 and AI365. .. PCR products were digested with HindIII and Cloning:Article Title: Influenza A Virus H7 nanobody recognizes a conserved immunodominant epitope on hemagglutinin head and confers heterosubtypic protection Article Snippet: .. The cloning strategy involved double-digestion of the pDZ plasmid with E co RI-HF (NEB, R3101S) and Article Title: Influenza A Virus H7 nanobody recognizes a conserved immunodominant epitope on hemagglutinin head and confers heterosubtypic protection. Article Snippet: .. The cloning strategy involved doubledigestion of the pDZ plasmid with EcoRI-HF (NEB, R3101S) and Plasmid Preparation:Article Title: Influenza A Virus H7 nanobody recognizes a conserved immunodominant epitope on hemagglutinin head and confers heterosubtypic protection Article Snippet: .. The cloning strategy involved double-digestion of the pDZ plasmid with E co RI-HF (NEB, R3101S) and Article Title: Context-dependent translation inhibition as a novel oncology therapeutic modality Article Snippet: .. The plasmid pT7CFE1 (Thermo Scientific) was digested in rCutsmart buffer with the Article Title: Influenza A Virus H7 nanobody recognizes a conserved immunodominant epitope on hemagglutinin head and confers heterosubtypic protection. Article Snippet: .. The cloning strategy involved doubledigestion of the pDZ plasmid with EcoRI-HF (NEB, R3101S) and |