Review



algorithms graphpad prism version 9 5 1 graphpad  (Tree Star Inc)

 
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 86

    Structured Review

    Tree Star Inc algorithms graphpad prism version 9 5 1 graphpad
    Algorithms Graphpad Prism Version 9 5 1 Graphpad, supplied by Tree Star Inc, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/graphpad/flowjo10/pm42166330-192-5-19
    Average 86 stars, based on 1 article reviews
    algorithms graphpad prism version 9 5 1 graphpad - by Bioz Stars, 2026-09
    86/100 stars

    Images

    Related Articles

    Software:

    Article Title: 5' UTR introns reduce nuclear transgene silencing and enable robust protein expression in Chlamydomonas reinhardtii.
    Article Snippet: .. This paper N/A Software and algorithms GraphPad Prism version 9.5.1 GraphPad https://www.graphpad.com/ R version 4.2.2 R https://cran.r-project.org/bin/windows/base/ FlowJo v10 TreeStar https://www.flowjo.com/solutions/flowjo/downloads QuantStudioTM Design & Analysis Software Thermo Fisher https://www.thermofisher.cn/cn/zh/home/technical- resources/software-downloads/quantstudio-3-5real-time-pcr-systems.html Fiji Schindelin et al.34 https://imagej.net/software/fiji/downloads Other LSM 980 Confocal Microscope Zeiss LSM 980 BD LSR II flow cytometer BD biosciences N/A SapphireTM Biomolecular Imager Azure Biosystems N/A Cell Reports 45, 117424, June 23, 2026 13 ..

    Article Title: Glutathione is critical for NK cell-mediated immunity.
    Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER Software and algorithms FlowJo Software 10.10 Tree Star RRID:SCR_008520 Graphpad Prism 10 GraphPad Software, Inc RRID:SCR_002798 BioRender.com BioRender RRID:SCR_018361 SoftMax Pro7.1 Molecular Devices RRID:SCR_014240 Inkscape 1.3 Inkscape Developers RRID:SCR_014479 Salmon – RRID:SCR_017036 DESeq2 – RRID:SCR_015687 .. BioNavigator 63 Pamgene N/A 18 Cell Reports 45, 116986, March 24, 2026 infected mice, the plaque forming assay unit assay was performed as previously described.

    Article Title: Endothelial protein C receptor CD201 is a better marker than SCA1 to identify mouse long-term reconstituting hematopoietic stem cells following septic challenge
    Article Snippet: Samples were analyzed either on a Cytoflex (Beckman Coulter) flow cytometer equipped with 640nm, 561nm, 488nm, and 405nm lasers. .. Uncompensated FCS files were analyzed using FlowJo10 software following compensation with single color antibody stains (Tree Star, Ashland, OR) following post-hoc compensation with single color controls. ..

    Article Title: Endothelial protein C receptor CD201 is a better marker than SCA1 to identify mouse long-term reconstituting hematopoietic stem cells following septic challenge.
    Article Snippet: Stem cell antigen-1 (SCA1) is widely used to identify mouse hematopoietic stem cells (HSC) and multipotent progenitors (MPP) among lineage-negative KIT (LK) cells.. However, SCA1 is expressed only in a few inbred mouse strains and becomes strongly upregulated on LK cells following in vivo challenge with interferons, lipopolysaccharide (LPS) or pathogens leading to incorrect analysis of HSC function subsets and delineation of HSC, MPP and lineage-restricted progenitor subsets.. Endothelial protein C receptor CD201can be used as an alternative marker for mouse and even human HSC.

    Article Title: The mechanosensitive channel TRPV4 inhibits pulmonary inflammation by limiting NF-KB signaling in alveolar macrophages
    Article Snippet: Samples were run on a FACSymphony A1 (BD Biosciences) flow cytometer with standard configuration with 50,000 to 100,000 events acquired. .. Data was analyzed using FlowJo10 software (Tree Star). ..

    Microscopy:

    Article Title: 5' UTR introns reduce nuclear transgene silencing and enable robust protein expression in Chlamydomonas reinhardtii.
    Article Snippet: .. This paper N/A Software and algorithms GraphPad Prism version 9.5.1 GraphPad https://www.graphpad.com/ R version 4.2.2 R https://cran.r-project.org/bin/windows/base/ FlowJo v10 TreeStar https://www.flowjo.com/solutions/flowjo/downloads QuantStudioTM Design & Analysis Software Thermo Fisher https://www.thermofisher.cn/cn/zh/home/technical- resources/software-downloads/quantstudio-3-5real-time-pcr-systems.html Fiji Schindelin et al.34 https://imagej.net/software/fiji/downloads Other LSM 980 Confocal Microscope Zeiss LSM 980 BD LSR II flow cytometer BD biosciences N/A SapphireTM Biomolecular Imager Azure Biosystems N/A Cell Reports 45, 117424, June 23, 2026 13 ..

    Flow Cytometry:

    Article Title: 5' UTR introns reduce nuclear transgene silencing and enable robust protein expression in Chlamydomonas reinhardtii.
    Article Snippet: .. This paper N/A Software and algorithms GraphPad Prism version 9.5.1 GraphPad https://www.graphpad.com/ R version 4.2.2 R https://cran.r-project.org/bin/windows/base/ FlowJo v10 TreeStar https://www.flowjo.com/solutions/flowjo/downloads QuantStudioTM Design & Analysis Software Thermo Fisher https://www.thermofisher.cn/cn/zh/home/technical- resources/software-downloads/quantstudio-3-5real-time-pcr-systems.html Fiji Schindelin et al.34 https://imagej.net/software/fiji/downloads Other LSM 980 Confocal Microscope Zeiss LSM 980 BD LSR II flow cytometer BD biosciences N/A SapphireTM Biomolecular Imager Azure Biosystems N/A Cell Reports 45, 117424, June 23, 2026 13 ..

    other:

    Article Title: Glehnia littoralis and imperatorin attenuate allergic airway inflammation via mast cell stabilization and transcriptome-defined suppression of FcεRI/TLR-MAPK/NF-κB signaling.
    Article Snippet: 20 Background: Allergic airway inflammation is driven by mast cell activation and IgE–FcεRI 21 signaling.. Current pharmacological treatments often present limited efficacy or long-term 22 adverse effects.. Glehnia littoralis Fr.

    Article Title: STING-OPTN signaling confers cytoprotection through TBK1-dependent mitophagy.
    Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER YPH mito-keima Dr. Richard J. Youle N/A HEK293T stably expressing YFP-Parkin Dr. Han-Ming Shen N/A SH-SY5Y ATCC Cat#CRL-2266; RRID:CVCL_0019 Oligonucleotides siRNA targeting cGAS Purchased from Integrated DNA Technologies (IDT) Design ID: hs.Ri.MB21D1.13 siRNA targeting TBK1 Purchased from Integrated DNA Technologies (IDT) Design ID: hs.Ri.TBK1.13 siRNA targeting STING #1: AGCATTACAACAACCTGCT Synthesized by Tsingke Biotechnology (Beijing, China) N/A siRNA targeting STING #2: CGAACTTACAATCAGCATT Synthesized by Tsingke Biotechnology (Beijing, China) N/A siRNA targeting OPTN: CCACCAGCTGAAAGAAGCC Synthesized by Tsingke Biotechnology (Beijing, China) N/A siRNA targeting PINK1 Purchased from Invitrogen Cat#1299001 siRNA targeting sequence: VCP #1: CAGUGUUGCUGAAAGGAAAGA UUUCCUUUCAGCAACACUGUG Synthesized by Tsingke Biotechnology (Beijing, China) N/A siRNA targeting sequence: VCP #2: GCAGCUAGCUCAGAUCAAAGA UUUGAUCUGAGCUAGCUGCUU Synthesized by Tsingke Biotechnology (Beijing, China) N/A siRNA targeting sequence: VCP #3: GCAAGAAGAUGGAUCUCAUUG AUGAGAUCCAUCUUCUUGCGG Synthesized by Tsingke Biotechnology (Beijing, China) N/A Recombinant DNA lentiCRISPR v2 Dr. Feng Zhang Addgene plasmid # 52961; RRID:Addgene_52961 Lentiguide V2-sgcGAS Dr. James Chen N/A Lentiguide V2-sgSTING Dr. James Chen N/A Lentiguide V2-sgTBK1 Dr. James Chen N/A pCDNA4-TREX1-WT-3XFLAG This paper N/A pCDNA4-PINK1-WT-3XFLAG This paper N/A pCDNA4-PINK1-E240K-3XFLAG This paper N/A pCDNA4-PINK1-G309D-3XFLAG This paper N/A Parkin-WT-FLAG Dr. Liming Wang N/A Parkin-S65A-FLAG Dr. Liming Wang N/A OPTN-FLAG Dr. Qiming Sun N/A TBK1-FLAG Dr. Wei Wan N/A Software and algorithms GraphPad Prism (https://www.graphpad. com/features) GraphPad Software Version 8.0 FlowJo (https://www.flowjo.com/) Tree Star Software Version 10.0 Adobe Illustrator (http://www.adobe.com/ cn/) Adobe Systems Version 26.0 ImageJ (https://imagej.nih.gov/ij/) Java Version 1.8.0 Other 1 × PBS BioChannel Biological Technology Co., Ltd. Cat#BC-BPBS-01 not-fat milk Biosharp Cat#BS102-500g Protease Inhibitor Cocktail TargetMol Cat#C0001-1 mL Phosphatase Inhibitor Cocktail III TargetMol Cat#C0004-2 mL Stripping Buffer CWBIO Cat#CW0056 Cell Reports 45, 117515, June 23, 2026 19



    Similar Products

    86
    Dotmatics Limited graphpad prism dotmatics
    Graphpad Prism Dotmatics, supplied by Dotmatics Limited, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/graphpad/graphpad+prism/pm42268716-582-220-222
    Average 86 stars, based on 1 article reviews
    graphpad prism dotmatics - by Bioz Stars, 2026-09
    86/100 stars
      Buy from Supplier

    86
    Tree Star Inc algorithms graphpad prism
    Algorithms Graphpad Prism, supplied by Tree Star Inc, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/graphpad/flowjo10/pm42268710-553-201-212
    Average 86 stars, based on 1 article reviews
    algorithms graphpad prism - by Bioz Stars, 2026-09
    86/100 stars
      Buy from Supplier

    86
    Deepmind Technologies Ltd algorithms prism 8 0 graphpad
    Algorithms Prism 8 0 Graphpad, supplied by Deepmind Technologies Ltd, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/graphpad/1+10+3+algorithms+graphpad+graphpad+prism+software/pm42228568-188-165-178
    Average 86 stars, based on 1 article reviews
    algorithms prism 8 0 graphpad - by Bioz Stars, 2026-09
    86/100 stars
      Buy from Supplier

    86
    Tree Star Inc algorithms graphpad prism version 9 5 1 graphpad
    Algorithms Graphpad Prism Version 9 5 1 Graphpad, supplied by Tree Star Inc, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/graphpad/flowjo10/pm42166330-192-5-19
    Average 86 stars, based on 1 article reviews
    algorithms graphpad prism version 9 5 1 graphpad - by Bioz Stars, 2026-09
    86/100 stars
      Buy from Supplier

    86
    Dotmatics Limited graphpad by dotmatics
    Graphpad By Dotmatics, supplied by Dotmatics Limited, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/graphpad/by+dotmatics+graphpad/pmc13050503-99-10-12
    Average 86 stars, based on 1 article reviews
    graphpad by dotmatics - by Bioz Stars, 2026-09
    86/100 stars
      Buy from Supplier

    86
    Dotmatics Limited algorithms graphpad prism dotmatics
    Algorithms Graphpad Prism Dotmatics, supplied by Dotmatics Limited, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/graphpad/graphpad+prism/pm41903141-212-194-197
    Average 86 stars, based on 1 article reviews
    algorithms graphpad prism dotmatics - by Bioz Stars, 2026-09
    86/100 stars
      Buy from Supplier

    86
    Deepmind Technologies Ltd algorithms graphpad prism 10 4 1 graphpad software
    Algorithms Graphpad Prism 10 4 1 Graphpad Software, supplied by Deepmind Technologies Ltd, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/graphpad/1+10+3+algorithms+graphpad+graphpad+prism+software/pm41903133-211-97-117
    Average 86 stars, based on 1 article reviews
    algorithms graphpad prism 10 4 1 graphpad software - by Bioz Stars, 2026-09
    86/100 stars
      Buy from Supplier

    99
    New England Biolabs e2621 software graphpad prism 9
    E2621 Software Graphpad Prism 9, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/graphpad/NEBuilder+HiFi+DNA+Assembly+Master+Mix/pm41872551-248-303-298
    Average 99 stars, based on 1 article reviews
    e2621 software graphpad prism 9 - by Bioz Stars, 2026-09
    99/100 stars
      Buy from Supplier

    86
    Deepmind Technologies Ltd algorithms graphpad prism 10 3 1 graphpad software
    Algorithms Graphpad Prism 10 3 1 Graphpad Software, supplied by Deepmind Technologies Ltd, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/graphpad/1+10+3+algorithms+graphpad+graphpad+prism+software/pm41824449-733-235-256
    Average 86 stars, based on 1 article reviews
    algorithms graphpad prism 10 3 1 graphpad software - by Bioz Stars, 2026-09
    86/100 stars
      Buy from Supplier

    86
    Biognosys algorithms prism graphpad software
    Algorithms Prism Graphpad Software, supplied by Biognosys, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/graphpad/algorithms+graphpad+prism+software/pm41747732-295-59-89
    Average 86 stars, based on 1 article reviews
    algorithms prism graphpad software - by Bioz Stars, 2026-09
    86/100 stars
      Buy from Supplier

    Image Search Results