Review



e0554s camp glosensor assay promega  (New England Biolabs)


Bioz Verified Symbol New England Biolabs is a verified supplier
Bioz Manufacturer Symbol New England Biolabs manufactures this product  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 99

    Structured Review

    New England Biolabs e0554s camp glosensor assay promega
    E0554s Camp Glosensor Assay Promega, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 99/100, based on 5716 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/glosensor+kit/Q5+Site-Directed+Mutagenesis+Kit/pm33571432-397-127-125
    Average 99 stars, based on 5716 article reviews
    e0554s camp glosensor assay promega - by Bioz Stars, 2026-10
    99/100 stars

    Images

    Related Articles

    Mutagenesis:

    Article Title: Drug-induced changes in connectivity to midbrain dopamine cells revealed by rabies monosynaptic tracing
    Article Snippet: Recombinant DNA reagent , pAAV2-5 , Addgene , Plasmid #232922, RRID: Addgene_232922 , . .. Commercial assay or kit , Q5 Site-directed mutagenesis kit , New England Biolabs , E0554S , . .. Commercial assay or kit , Luna Universal One-Step RT-qPCR Kit , New England Biolabs , E3005L , .

    Article Title: BromoCatch: a self-labelling tag platform for protein modification and live cell imaging.
    Article Snippet: .. Reactions using the Q5® Site-Directed Mutagenesis Kit (NEB #E0554S) contained 25 ng of the original pMA-RQ plasmid, 1× Q5 Hot Start High-Fidelity 2× Master Mix, and 0.5 μM forward (TCCTGACCATTGTGTGGTGGCCATG) and reverse (GGGTTGTACTTATAGCAGTTG) primers. ..

    Article Title: Investigating the functional components of YAP condensates
    Article Snippet: Yes-associated protein (YAP) condensates are critical for cell survival under hyperosmotic stress, yet how these condensates execute their specific functions remains incompletely understood.. Here, we employed proximity-based proteomics to identify YAP-interacting proteins in both the diffuse and condensate-forming states.. Upon YAP condensate formation, the composition of YAPinteracting proteins changed markedly.

    Article Title: IgLON5 autoimmune antibodies activate Tau via neuronal hyperactivity
    Article Snippet: Sections were washed with PBS before mounting with Immo-Mount (Epredia) and imaging using an inverted epifluorescence microscope (Leica SPE). .. To map the epitopes of patient-derived α-IgLON5#1, we cloned human IgLON5 deletion constructs from full-length Myc-DKK-tagged human IgLON5 plasmid (OriGene, no. 225495) using a Q5 Site-Directed Mutagenesis kit (New England Biolabs). ..

    Article Title: OptoLoop – an optogenetic tool to probe the functional role of genome organization
    Article Snippet: .. A list of all plasmids with their corresponding sources can be found in . pCMV-CRY2hiclu-mCherry was obtained by replacing residues 504–507 from pCMV-CRY2high-mCherry by Asp-Leu-Asp-Asn via site-directed mutagenesis with the Q5 Site-Directed Mutagenesis kit (New England Biolabs, Ipswich, MA, USA). pHAGE-dCas9-mCherry-CRY2 was generated by replacing 2XmCherry in pHAGE-dCas9-3XmCh with PCR-amplified CRY2hiclu using NotI/XhoI sites. pHAGE-dCas9-3XmCherry-CRY2 and pHAGE-dCas9-3XGFP-CRY2 were generated with the NEB HiFi DNA assembly kit (New England Biolabs, Ipswich, MA, USA) by inserting PCR-amplified CRY2hiclu in XhoI-linearized pHAGE-dCas9-3XmCh and pHAGE-dCas9-3XGFP, respectively. pHAGE-dCas9-3XGFP-CIBN was generated by inserting PCR-amplified CIBN from pEF1a-dCas9-CIBN in pHAGE-dCas9-3XGFP using XhoI/Xba sites. .. All plasmid constructs generated in this work were verified by whole-plasmid sequencing and deposited in Addgene (see ).

    Article Title: AmXlnR, a transcription factor involved in xylan degradation and pentose catabolism, enhances pullulan production from xylose in Aureobasidium melanogenum
    Article Snippet: The obtained promoter fragments were ligated into a GFP expression plasmid of pNATX13- GFP using ClonExpress II One Step Cloning Kit C112-02 (Vazyme), yielding pNATX13- GFP - AmXLN2 , pNATX13- GFP - AmBXL2 , and pNATX13- GFP - AmABF1 . .. Subsequently, the variant promoters of P XLN2 Δ (deletion of GGCTGA site), P BXL2 Δ (deletion of GGTTAA) and P ABF1 Δ (deletion of GGCTAT) genes were constructed using a Site-Directed Mutagenesis Kit (NEB, USA) using the primers BXL2WD-F/R, BXLWD2-F/R and ABF1WD-F/R ( ) and cloned similarly, yielding pNATX13- GFP -Δ AmXLN2 , pNATX13- GFP -Δ AmBXL2 , and pNATX13- GFP -Δ AmABF1 . ..

    Article Title: Mutation-Tolerant Inhibition of HIV-1 Integrase Strand Transfer by Secondary Metabolites from the Endophytic Fungus Alternaria alternata PO4PR2
    Article Snippet: Mutagenic primers (Table 2) were designed using the NEBaseChanger primer design tool (New England Biolabs, MA, USA). .. Mutations were introduced into the HIV-1 molecular clone pNL4.3 using the Q5 site-directed mutagenesis kit (New England Biolabs, Ipswich, MA, USA). ..

    Article Title: Directed evolution of novel AAV capsids for enhanced delivery to mouse and human Schwann cells
    Article Snippet: .. The stop codon (nucleotide sequence TGA) was inserted after amino acid G586 of C1, G588 of C6, and D590 of C5 using the Q5 Site-Directed Mutagenesis Kit (New England Biolabs). ..

    Plasmid Preparation:

    Article Title: BromoCatch: a self-labelling tag platform for protein modification and live cell imaging.
    Article Snippet: .. Reactions using the Q5® Site-Directed Mutagenesis Kit (NEB #E0554S) contained 25 ng of the original pMA-RQ plasmid, 1× Q5 Hot Start High-Fidelity 2× Master Mix, and 0.5 μM forward (TCCTGACCATTGTGTGGTGGCCATG) and reverse (GGGTTGTACTTATAGCAGTTG) primers. ..

    Article Title: Investigating the functional components of YAP condensates
    Article Snippet: Yes-associated protein (YAP) condensates are critical for cell survival under hyperosmotic stress, yet how these condensates execute their specific functions remains incompletely understood.. Here, we employed proximity-based proteomics to identify YAP-interacting proteins in both the diffuse and condensate-forming states.. Upon YAP condensate formation, the composition of YAPinteracting proteins changed markedly.

    Article Title: IgLON5 autoimmune antibodies activate Tau via neuronal hyperactivity
    Article Snippet: Sections were washed with PBS before mounting with Immo-Mount (Epredia) and imaging using an inverted epifluorescence microscope (Leica SPE). .. To map the epitopes of patient-derived α-IgLON5#1, we cloned human IgLON5 deletion constructs from full-length Myc-DKK-tagged human IgLON5 plasmid (OriGene, no. 225495) using a Q5 Site-Directed Mutagenesis kit (New England Biolabs). ..

    Control:

    Article Title: Investigating the functional components of YAP condensates
    Article Snippet: Yes-associated protein (YAP) condensates are critical for cell survival under hyperosmotic stress, yet how these condensates execute their specific functions remains incompletely understood.. Here, we employed proximity-based proteomics to identify YAP-interacting proteins in both the diffuse and condensate-forming states.. Upon YAP condensate formation, the composition of YAPinteracting proteins changed markedly.

    Polymerase Chain Reaction:

    Article Title: Investigating the functional components of YAP condensates
    Article Snippet: Yes-associated protein (YAP) condensates are critical for cell survival under hyperosmotic stress, yet how these condensates execute their specific functions remains incompletely understood.. Here, we employed proximity-based proteomics to identify YAP-interacting proteins in both the diffuse and condensate-forming states.. Upon YAP condensate formation, the composition of YAPinteracting proteins changed markedly.

    Article Title: OptoLoop – an optogenetic tool to probe the functional role of genome organization
    Article Snippet: .. A list of all plasmids with their corresponding sources can be found in . pCMV-CRY2hiclu-mCherry was obtained by replacing residues 504–507 from pCMV-CRY2high-mCherry by Asp-Leu-Asp-Asn via site-directed mutagenesis with the Q5 Site-Directed Mutagenesis kit (New England Biolabs, Ipswich, MA, USA). pHAGE-dCas9-mCherry-CRY2 was generated by replacing 2XmCherry in pHAGE-dCas9-3XmCh with PCR-amplified CRY2hiclu using NotI/XhoI sites. pHAGE-dCas9-3XmCherry-CRY2 and pHAGE-dCas9-3XGFP-CRY2 were generated with the NEB HiFi DNA assembly kit (New England Biolabs, Ipswich, MA, USA) by inserting PCR-amplified CRY2hiclu in XhoI-linearized pHAGE-dCas9-3XmCh and pHAGE-dCas9-3XGFP, respectively. pHAGE-dCas9-3XGFP-CIBN was generated by inserting PCR-amplified CIBN from pEF1a-dCas9-CIBN in pHAGE-dCas9-3XGFP using XhoI/Xba sites. .. All plasmid constructs generated in this work were verified by whole-plasmid sequencing and deposited in Addgene (see ).

    Clone Assay:

    Article Title: IgLON5 autoimmune antibodies activate Tau via neuronal hyperactivity
    Article Snippet: Sections were washed with PBS before mounting with Immo-Mount (Epredia) and imaging using an inverted epifluorescence microscope (Leica SPE). .. To map the epitopes of patient-derived α-IgLON5#1, we cloned human IgLON5 deletion constructs from full-length Myc-DKK-tagged human IgLON5 plasmid (OriGene, no. 225495) using a Q5 Site-Directed Mutagenesis kit (New England Biolabs). ..

    Article Title: AmXlnR, a transcription factor involved in xylan degradation and pentose catabolism, enhances pullulan production from xylose in Aureobasidium melanogenum
    Article Snippet: The obtained promoter fragments were ligated into a GFP expression plasmid of pNATX13- GFP using ClonExpress II One Step Cloning Kit C112-02 (Vazyme), yielding pNATX13- GFP - AmXLN2 , pNATX13- GFP - AmBXL2 , and pNATX13- GFP - AmABF1 . .. Subsequently, the variant promoters of P XLN2 Δ (deletion of GGCTGA site), P BXL2 Δ (deletion of GGTTAA) and P ABF1 Δ (deletion of GGCTAT) genes were constructed using a Site-Directed Mutagenesis Kit (NEB, USA) using the primers BXL2WD-F/R, BXLWD2-F/R and ABF1WD-F/R ( ) and cloned similarly, yielding pNATX13- GFP -Δ AmXLN2 , pNATX13- GFP -Δ AmBXL2 , and pNATX13- GFP -Δ AmABF1 . ..

    Construct:

    Article Title: IgLON5 autoimmune antibodies activate Tau via neuronal hyperactivity
    Article Snippet: Sections were washed with PBS before mounting with Immo-Mount (Epredia) and imaging using an inverted epifluorescence microscope (Leica SPE). .. To map the epitopes of patient-derived α-IgLON5#1, we cloned human IgLON5 deletion constructs from full-length Myc-DKK-tagged human IgLON5 plasmid (OriGene, no. 225495) using a Q5 Site-Directed Mutagenesis kit (New England Biolabs). ..

    Article Title: AmXlnR, a transcription factor involved in xylan degradation and pentose catabolism, enhances pullulan production from xylose in Aureobasidium melanogenum
    Article Snippet: The obtained promoter fragments were ligated into a GFP expression plasmid of pNATX13- GFP using ClonExpress II One Step Cloning Kit C112-02 (Vazyme), yielding pNATX13- GFP - AmXLN2 , pNATX13- GFP - AmBXL2 , and pNATX13- GFP - AmABF1 . .. Subsequently, the variant promoters of P XLN2 Δ (deletion of GGCTGA site), P BXL2 Δ (deletion of GGTTAA) and P ABF1 Δ (deletion of GGCTAT) genes were constructed using a Site-Directed Mutagenesis Kit (NEB, USA) using the primers BXL2WD-F/R, BXLWD2-F/R and ABF1WD-F/R ( ) and cloned similarly, yielding pNATX13- GFP -Δ AmXLN2 , pNATX13- GFP -Δ AmBXL2 , and pNATX13- GFP -Δ AmABF1 . ..

    Generated:

    Article Title: OptoLoop – an optogenetic tool to probe the functional role of genome organization
    Article Snippet: .. A list of all plasmids with their corresponding sources can be found in . pCMV-CRY2hiclu-mCherry was obtained by replacing residues 504–507 from pCMV-CRY2high-mCherry by Asp-Leu-Asp-Asn via site-directed mutagenesis with the Q5 Site-Directed Mutagenesis kit (New England Biolabs, Ipswich, MA, USA). pHAGE-dCas9-mCherry-CRY2 was generated by replacing 2XmCherry in pHAGE-dCas9-3XmCh with PCR-amplified CRY2hiclu using NotI/XhoI sites. pHAGE-dCas9-3XmCherry-CRY2 and pHAGE-dCas9-3XGFP-CRY2 were generated with the NEB HiFi DNA assembly kit (New England Biolabs, Ipswich, MA, USA) by inserting PCR-amplified CRY2hiclu in XhoI-linearized pHAGE-dCas9-3XmCh and pHAGE-dCas9-3XGFP, respectively. pHAGE-dCas9-3XGFP-CIBN was generated by inserting PCR-amplified CIBN from pEF1a-dCas9-CIBN in pHAGE-dCas9-3XGFP using XhoI/Xba sites. .. All plasmid constructs generated in this work were verified by whole-plasmid sequencing and deposited in Addgene (see ).

    Variant Assay:

    Article Title: AmXlnR, a transcription factor involved in xylan degradation and pentose catabolism, enhances pullulan production from xylose in Aureobasidium melanogenum
    Article Snippet: The obtained promoter fragments were ligated into a GFP expression plasmid of pNATX13- GFP using ClonExpress II One Step Cloning Kit C112-02 (Vazyme), yielding pNATX13- GFP - AmXLN2 , pNATX13- GFP - AmBXL2 , and pNATX13- GFP - AmABF1 . .. Subsequently, the variant promoters of P XLN2 Δ (deletion of GGCTGA site), P BXL2 Δ (deletion of GGTTAA) and P ABF1 Δ (deletion of GGCTAT) genes were constructed using a Site-Directed Mutagenesis Kit (NEB, USA) using the primers BXL2WD-F/R, BXLWD2-F/R and ABF1WD-F/R ( ) and cloned similarly, yielding pNATX13- GFP -Δ AmXLN2 , pNATX13- GFP -Δ AmBXL2 , and pNATX13- GFP -Δ AmABF1 . ..

    Sequencing:

    Article Title: Directed evolution of novel AAV capsids for enhanced delivery to mouse and human Schwann cells
    Article Snippet: .. The stop codon (nucleotide sequence TGA) was inserted after amino acid G586 of C1, G588 of C6, and D590 of C5 using the Q5 Site-Directed Mutagenesis Kit (New England Biolabs). ..



    Similar Products

    90
    Promega glosensor camp kit
    Glosensor Camp Kit, supplied by Promega, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/glosensor+kit/glosensor+camp+assay/pm40670604-246-1-5
    Average 90 stars, based on 1 article reviews
    glosensor camp kit - by Bioz Stars, 2026-10
    90/100 stars
      Buy from Supplier

    90
    Promega glosensor camp assay kit
    FUT8 knockdown attenuates the FSH/FSHR signaling pathway. A, CCK8 cell proliferation assay. Cells were treated with 100 ng/mL rhFSH, and cell proliferation was measured by absorbance at a wavelength of 450 nm. Significant differences are shown as the means ± SD, n = 4. B, Immunofluorescence assay. KGN, KGN-KD and KGN-KD-Re cells were treated with FSH (400 ng/mL) and stained with anti-FSHR (red) (1:500) and DAPI (blue). C, Western blot. Cell lysates of KGN, KGN-KD and KGN-KD-Re cells were resolved by 7.5 % SDS-PAGE, transferred to a PVDF membrane and probed with anti-FSHR (1:2000). GAPDH was used as the reference gene for the cytoplasm. D, Western blot. Cell lysates of Fut8 +/+ and Fut8 −/− ovaries were resolved by 7.5 % SDS-PAGE, transferred to a PVDF membrane and probed with anti-FSHR (1:2000). GAPDH was used as a loading control. E, Quantitative real-time PCR. RNA was isolated from the granulosa cells of MOR and POR patients. The mRNA expression levels of FSHR were compared. The relative expression of mRNAs was normalized to GAPDH. Data are presented as the means ± SEM, n = 3. F, FSH-induced cAMP production was measured using a <t>GloSensor</t> cAMP Assay kit. Cells were seeded in a 6-well plate for 24 h, and then 100 μM of IBMX was added, to inhibit phosphodiesterases, for 20 min. The cAMP levels were measured in KGN, KGN-KD, and KGN-KD-Re cells following stimulation with 100 IU/L of rhFSH or 100 μM of forskolin for 5 min. Data are presented as the means ± SEM, n = 3. G, PKA-CREB signaling pathway and Akt-FoxO3a signaling pathway. Serum-starved KGN, KGN-KD, and KGN-KD-Re cells were treated with FSH for 30 min, and cell lysates were resolved by 10 % SDS-PAGE, followed by transfer to a PVDF membrane. Membranes were probed with anti-phospho-PKA (1:2000) and anti-PKA (1:2000); anti-phospho-CREB (1:2000) and anti-CREB (1:2000); and anti-KITL (1:2000); anti-phospho-Akt (1:2000) and anti-Akt (1:2000); anti-phospho-FoxO3a (1:2000) and anti-FoxO3a (1:2000), and GAPDH was used as a loading control. Quantitative data are represented as the means ± SD, n = 3. H, Western blot. Lysates of Fut8 +/+ and Fut8 −/− ovaries were resolved by 10 % SDS-PAGE, and probed with anti-KITL (1:2000), with GAPDH used as the loading control. Quantitative data are represented as the means ± SD, n = 3. I, Western blot. Lysates of Fut8 +/+ and Fut8 −/− ovaries were resolved by 10 % SDS-PAGE and probed with anti-pFoxO3a (1:2000) and anti-FoxO3a (1:2000). Quantitative data are represented as the means ± SD, n = 3. J, TUNEL assay in the Fut8 +/+ and Fut8 −/− ovarian follicles. Representative micrographs are shown. Quantitative data are represented as the means ± SD, n = 3. K, Western blot analysis. Cell lysates of Fut8 +/+ and Fut8 −/− ovaries were resolved by 7.5 % SDS-PAGE, transferred to a PVDF membrane, and probed with anti-BCL2 and anti-BAX (1:2000). Quantitative data are represented as the means ± SD, n = 3. (For interpretation of the references to colour in this figure legend, the reader is referred to the web version of this article.)
    Glosensor Camp Assay Kit, supplied by Promega, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/glosensor+kit/glosensor+camp+assay/pmc11725149-83-7-11
    Average 90 stars, based on 1 article reviews
    glosensor camp assay kit - by Bioz Stars, 2026-10
    90/100 stars
      Buy from Supplier

    90
    Promega camp glosensor assay kit
    FUT8 knockdown attenuates the FSH/FSHR signaling pathway. A, CCK8 cell proliferation assay. Cells were treated with 100 ng/mL rhFSH, and cell proliferation was measured by absorbance at a wavelength of 450 nm. Significant differences are shown as the means ± SD, n = 4. B, Immunofluorescence assay. KGN, KGN-KD and KGN-KD-Re cells were treated with FSH (400 ng/mL) and stained with anti-FSHR (red) (1:500) and DAPI (blue). C, Western blot. Cell lysates of KGN, KGN-KD and KGN-KD-Re cells were resolved by 7.5 % SDS-PAGE, transferred to a PVDF membrane and probed with anti-FSHR (1:2000). GAPDH was used as the reference gene for the cytoplasm. D, Western blot. Cell lysates of Fut8 +/+ and Fut8 −/− ovaries were resolved by 7.5 % SDS-PAGE, transferred to a PVDF membrane and probed with anti-FSHR (1:2000). GAPDH was used as a loading control. E, Quantitative real-time PCR. RNA was isolated from the granulosa cells of MOR and POR patients. The mRNA expression levels of FSHR were compared. The relative expression of mRNAs was normalized to GAPDH. Data are presented as the means ± SEM, n = 3. F, FSH-induced cAMP production was measured using a <t>GloSensor</t> cAMP Assay kit. Cells were seeded in a 6-well plate for 24 h, and then 100 μM of IBMX was added, to inhibit phosphodiesterases, for 20 min. The cAMP levels were measured in KGN, KGN-KD, and KGN-KD-Re cells following stimulation with 100 IU/L of rhFSH or 100 μM of forskolin for 5 min. Data are presented as the means ± SEM, n = 3. G, PKA-CREB signaling pathway and Akt-FoxO3a signaling pathway. Serum-starved KGN, KGN-KD, and KGN-KD-Re cells were treated with FSH for 30 min, and cell lysates were resolved by 10 % SDS-PAGE, followed by transfer to a PVDF membrane. Membranes were probed with anti-phospho-PKA (1:2000) and anti-PKA (1:2000); anti-phospho-CREB (1:2000) and anti-CREB (1:2000); and anti-KITL (1:2000); anti-phospho-Akt (1:2000) and anti-Akt (1:2000); anti-phospho-FoxO3a (1:2000) and anti-FoxO3a (1:2000), and GAPDH was used as a loading control. Quantitative data are represented as the means ± SD, n = 3. H, Western blot. Lysates of Fut8 +/+ and Fut8 −/− ovaries were resolved by 10 % SDS-PAGE, and probed with anti-KITL (1:2000), with GAPDH used as the loading control. Quantitative data are represented as the means ± SD, n = 3. I, Western blot. Lysates of Fut8 +/+ and Fut8 −/− ovaries were resolved by 10 % SDS-PAGE and probed with anti-pFoxO3a (1:2000) and anti-FoxO3a (1:2000). Quantitative data are represented as the means ± SD, n = 3. J, TUNEL assay in the Fut8 +/+ and Fut8 −/− ovarian follicles. Representative micrographs are shown. Quantitative data are represented as the means ± SD, n = 3. K, Western blot analysis. Cell lysates of Fut8 +/+ and Fut8 −/− ovaries were resolved by 7.5 % SDS-PAGE, transferred to a PVDF membrane, and probed with anti-BCL2 and anti-BAX (1:2000). Quantitative data are represented as the means ± SD, n = 3. (For interpretation of the references to colour in this figure legend, the reader is referred to the web version of this article.)
    Camp Glosensor Assay Kit, supplied by Promega, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/glosensor+kit/glosensor+camp+assay/pm35802702-37-37-41
    Average 90 stars, based on 1 article reviews
    camp glosensor assay kit - by Bioz Stars, 2026-10
    90/100 stars
      Buy from Supplier

    99
    New England Biolabs e0554s camp glosensor assay promega
    FUT8 knockdown attenuates the FSH/FSHR signaling pathway. A, CCK8 cell proliferation assay. Cells were treated with 100 ng/mL rhFSH, and cell proliferation was measured by absorbance at a wavelength of 450 nm. Significant differences are shown as the means ± SD, n = 4. B, Immunofluorescence assay. KGN, KGN-KD and KGN-KD-Re cells were treated with FSH (400 ng/mL) and stained with anti-FSHR (red) (1:500) and DAPI (blue). C, Western blot. Cell lysates of KGN, KGN-KD and KGN-KD-Re cells were resolved by 7.5 % SDS-PAGE, transferred to a PVDF membrane and probed with anti-FSHR (1:2000). GAPDH was used as the reference gene for the cytoplasm. D, Western blot. Cell lysates of Fut8 +/+ and Fut8 −/− ovaries were resolved by 7.5 % SDS-PAGE, transferred to a PVDF membrane and probed with anti-FSHR (1:2000). GAPDH was used as a loading control. E, Quantitative real-time PCR. RNA was isolated from the granulosa cells of MOR and POR patients. The mRNA expression levels of FSHR were compared. The relative expression of mRNAs was normalized to GAPDH. Data are presented as the means ± SEM, n = 3. F, FSH-induced cAMP production was measured using a <t>GloSensor</t> cAMP Assay kit. Cells were seeded in a 6-well plate for 24 h, and then 100 μM of IBMX was added, to inhibit phosphodiesterases, for 20 min. The cAMP levels were measured in KGN, KGN-KD, and KGN-KD-Re cells following stimulation with 100 IU/L of rhFSH or 100 μM of forskolin for 5 min. Data are presented as the means ± SEM, n = 3. G, PKA-CREB signaling pathway and Akt-FoxO3a signaling pathway. Serum-starved KGN, KGN-KD, and KGN-KD-Re cells were treated with FSH for 30 min, and cell lysates were resolved by 10 % SDS-PAGE, followed by transfer to a PVDF membrane. Membranes were probed with anti-phospho-PKA (1:2000) and anti-PKA (1:2000); anti-phospho-CREB (1:2000) and anti-CREB (1:2000); and anti-KITL (1:2000); anti-phospho-Akt (1:2000) and anti-Akt (1:2000); anti-phospho-FoxO3a (1:2000) and anti-FoxO3a (1:2000), and GAPDH was used as a loading control. Quantitative data are represented as the means ± SD, n = 3. H, Western blot. Lysates of Fut8 +/+ and Fut8 −/− ovaries were resolved by 10 % SDS-PAGE, and probed with anti-KITL (1:2000), with GAPDH used as the loading control. Quantitative data are represented as the means ± SD, n = 3. I, Western blot. Lysates of Fut8 +/+ and Fut8 −/− ovaries were resolved by 10 % SDS-PAGE and probed with anti-pFoxO3a (1:2000) and anti-FoxO3a (1:2000). Quantitative data are represented as the means ± SD, n = 3. J, TUNEL assay in the Fut8 +/+ and Fut8 −/− ovarian follicles. Representative micrographs are shown. Quantitative data are represented as the means ± SD, n = 3. K, Western blot analysis. Cell lysates of Fut8 +/+ and Fut8 −/− ovaries were resolved by 7.5 % SDS-PAGE, transferred to a PVDF membrane, and probed with anti-BCL2 and anti-BAX (1:2000). Quantitative data are represented as the means ± SD, n = 3. (For interpretation of the references to colour in this figure legend, the reader is referred to the web version of this article.)
    E0554s Camp Glosensor Assay Promega, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/glosensor+kit/Q5+Site-Directed+Mutagenesis+Kit/pm33571432-397-127-125
    Average 99 stars, based on 1 article reviews
    e0554s camp glosensor assay promega - by Bioz Stars, 2026-10
    99/100 stars
      Buy from Supplier

    Image Search Results


    FUT8 knockdown attenuates the FSH/FSHR signaling pathway. A, CCK8 cell proliferation assay. Cells were treated with 100 ng/mL rhFSH, and cell proliferation was measured by absorbance at a wavelength of 450 nm. Significant differences are shown as the means ± SD, n = 4. B, Immunofluorescence assay. KGN, KGN-KD and KGN-KD-Re cells were treated with FSH (400 ng/mL) and stained with anti-FSHR (red) (1:500) and DAPI (blue). C, Western blot. Cell lysates of KGN, KGN-KD and KGN-KD-Re cells were resolved by 7.5 % SDS-PAGE, transferred to a PVDF membrane and probed with anti-FSHR (1:2000). GAPDH was used as the reference gene for the cytoplasm. D, Western blot. Cell lysates of Fut8 +/+ and Fut8 −/− ovaries were resolved by 7.5 % SDS-PAGE, transferred to a PVDF membrane and probed with anti-FSHR (1:2000). GAPDH was used as a loading control. E, Quantitative real-time PCR. RNA was isolated from the granulosa cells of MOR and POR patients. The mRNA expression levels of FSHR were compared. The relative expression of mRNAs was normalized to GAPDH. Data are presented as the means ± SEM, n = 3. F, FSH-induced cAMP production was measured using a GloSensor cAMP Assay kit. Cells were seeded in a 6-well plate for 24 h, and then 100 μM of IBMX was added, to inhibit phosphodiesterases, for 20 min. The cAMP levels were measured in KGN, KGN-KD, and KGN-KD-Re cells following stimulation with 100 IU/L of rhFSH or 100 μM of forskolin for 5 min. Data are presented as the means ± SEM, n = 3. G, PKA-CREB signaling pathway and Akt-FoxO3a signaling pathway. Serum-starved KGN, KGN-KD, and KGN-KD-Re cells were treated with FSH for 30 min, and cell lysates were resolved by 10 % SDS-PAGE, followed by transfer to a PVDF membrane. Membranes were probed with anti-phospho-PKA (1:2000) and anti-PKA (1:2000); anti-phospho-CREB (1:2000) and anti-CREB (1:2000); and anti-KITL (1:2000); anti-phospho-Akt (1:2000) and anti-Akt (1:2000); anti-phospho-FoxO3a (1:2000) and anti-FoxO3a (1:2000), and GAPDH was used as a loading control. Quantitative data are represented as the means ± SD, n = 3. H, Western blot. Lysates of Fut8 +/+ and Fut8 −/− ovaries were resolved by 10 % SDS-PAGE, and probed with anti-KITL (1:2000), with GAPDH used as the loading control. Quantitative data are represented as the means ± SD, n = 3. I, Western blot. Lysates of Fut8 +/+ and Fut8 −/− ovaries were resolved by 10 % SDS-PAGE and probed with anti-pFoxO3a (1:2000) and anti-FoxO3a (1:2000). Quantitative data are represented as the means ± SD, n = 3. J, TUNEL assay in the Fut8 +/+ and Fut8 −/− ovarian follicles. Representative micrographs are shown. Quantitative data are represented as the means ± SD, n = 3. K, Western blot analysis. Cell lysates of Fut8 +/+ and Fut8 −/− ovaries were resolved by 7.5 % SDS-PAGE, transferred to a PVDF membrane, and probed with anti-BCL2 and anti-BAX (1:2000). Quantitative data are represented as the means ± SD, n = 3. (For interpretation of the references to colour in this figure legend, the reader is referred to the web version of this article.)

    Journal: Journal of Advanced Research

    Article Title: Core fucosylation regulates the ovarian response via FSH receptor during follicular development

    doi: 10.1016/j.jare.2024.01.025

    Figure Lengend Snippet: FUT8 knockdown attenuates the FSH/FSHR signaling pathway. A, CCK8 cell proliferation assay. Cells were treated with 100 ng/mL rhFSH, and cell proliferation was measured by absorbance at a wavelength of 450 nm. Significant differences are shown as the means ± SD, n = 4. B, Immunofluorescence assay. KGN, KGN-KD and KGN-KD-Re cells were treated with FSH (400 ng/mL) and stained with anti-FSHR (red) (1:500) and DAPI (blue). C, Western blot. Cell lysates of KGN, KGN-KD and KGN-KD-Re cells were resolved by 7.5 % SDS-PAGE, transferred to a PVDF membrane and probed with anti-FSHR (1:2000). GAPDH was used as the reference gene for the cytoplasm. D, Western blot. Cell lysates of Fut8 +/+ and Fut8 −/− ovaries were resolved by 7.5 % SDS-PAGE, transferred to a PVDF membrane and probed with anti-FSHR (1:2000). GAPDH was used as a loading control. E, Quantitative real-time PCR. RNA was isolated from the granulosa cells of MOR and POR patients. The mRNA expression levels of FSHR were compared. The relative expression of mRNAs was normalized to GAPDH. Data are presented as the means ± SEM, n = 3. F, FSH-induced cAMP production was measured using a GloSensor cAMP Assay kit. Cells were seeded in a 6-well plate for 24 h, and then 100 μM of IBMX was added, to inhibit phosphodiesterases, for 20 min. The cAMP levels were measured in KGN, KGN-KD, and KGN-KD-Re cells following stimulation with 100 IU/L of rhFSH or 100 μM of forskolin for 5 min. Data are presented as the means ± SEM, n = 3. G, PKA-CREB signaling pathway and Akt-FoxO3a signaling pathway. Serum-starved KGN, KGN-KD, and KGN-KD-Re cells were treated with FSH for 30 min, and cell lysates were resolved by 10 % SDS-PAGE, followed by transfer to a PVDF membrane. Membranes were probed with anti-phospho-PKA (1:2000) and anti-PKA (1:2000); anti-phospho-CREB (1:2000) and anti-CREB (1:2000); and anti-KITL (1:2000); anti-phospho-Akt (1:2000) and anti-Akt (1:2000); anti-phospho-FoxO3a (1:2000) and anti-FoxO3a (1:2000), and GAPDH was used as a loading control. Quantitative data are represented as the means ± SD, n = 3. H, Western blot. Lysates of Fut8 +/+ and Fut8 −/− ovaries were resolved by 10 % SDS-PAGE, and probed with anti-KITL (1:2000), with GAPDH used as the loading control. Quantitative data are represented as the means ± SD, n = 3. I, Western blot. Lysates of Fut8 +/+ and Fut8 −/− ovaries were resolved by 10 % SDS-PAGE and probed with anti-pFoxO3a (1:2000) and anti-FoxO3a (1:2000). Quantitative data are represented as the means ± SD, n = 3. J, TUNEL assay in the Fut8 +/+ and Fut8 −/− ovarian follicles. Representative micrographs are shown. Quantitative data are represented as the means ± SD, n = 3. K, Western blot analysis. Cell lysates of Fut8 +/+ and Fut8 −/− ovaries were resolved by 7.5 % SDS-PAGE, transferred to a PVDF membrane, and probed with anti-BCL2 and anti-BAX (1:2000). Quantitative data are represented as the means ± SD, n = 3. (For interpretation of the references to colour in this figure legend, the reader is referred to the web version of this article.)

    Article Snippet: FSH-induced cAMP production was measured using a GloSensor cAMP Assay kit (Promega).

    Techniques: Knockdown, Proliferation Assay, Immunofluorescence, Staining, Western Blot, SDS Page, Membrane, Control, Real-time Polymerase Chain Reaction, Isolation, Expressing, cAMP Assay, TUNEL Assay