Review



the empty pgl3-basic vector was used as negative control  (Promega)

 
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 90

    Structured Review

    Promega the empty pgl3-basic vector was used as negative control
    Dual-luciferase reporter assay in HEK-293T cell line. The <t>pGL3</t> Basic and promoter vectors were used as negative and positive control in this study, respectively. Relative luciferase activity was performed in triplicates.
    The Empty Pgl3 Basic Vector Was Used As Negative Control, supplied by Promega, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/empty+pgl3-basic+vectors/pgl3+basic/pmc05593964-70-2-13
    Average 90 stars, based on 1 article reviews
    the empty pgl3-basic vector was used as negative control - by Bioz Stars, 2026-09
    90/100 stars

    Images

    1) Product Images from "Elevated UMOD methylation level in peripheral blood is associated with gout risk"

    Article Title: Elevated UMOD methylation level in peripheral blood is associated with gout risk

    Journal: Scientific Reports

    doi: 10.1038/s41598-017-11627-w

    Dual-luciferase reporter assay in HEK-293T cell line. The pGL3 Basic and promoter vectors were used as negative and positive control in this study, respectively. Relative luciferase activity was performed in triplicates.
    Figure Legend Snippet: Dual-luciferase reporter assay in HEK-293T cell line. The pGL3 Basic and promoter vectors were used as negative and positive control in this study, respectively. Relative luciferase activity was performed in triplicates.

    Techniques Used: Luciferase, Reporter Assay, Positive Control, Activity Assay

    Related Articles

    Luciferase:

    Article Title: Proline hydroxylation of CREB-regulated transcriptional coactivator 2 controls hepatic glucose metabolism
    Article Snippet: .. Dual luciferase activity assays—HEK293T cells were co-transfected with 0.5 μg of empty vector or plasmids encoding CRTC2 variants as indicated, along with 0.5 μg luciferase reporter plasmids and 80 ng of Renilla luciferase plasmid pRL-SV40 (Promega) as an internal control in 12 well plates. ..

    Activity Assay:

    Article Title: Proline hydroxylation of CREB-regulated transcriptional coactivator 2 controls hepatic glucose metabolism
    Article Snippet: .. Dual luciferase activity assays—HEK293T cells were co-transfected with 0.5 μg of empty vector or plasmids encoding CRTC2 variants as indicated, along with 0.5 μg luciferase reporter plasmids and 80 ng of Renilla luciferase plasmid pRL-SV40 (Promega) as an internal control in 12 well plates. ..

    Plasmid Preparation:

    Article Title: Proline hydroxylation of CREB-regulated transcriptional coactivator 2 controls hepatic glucose metabolism
    Article Snippet: .. Dual luciferase activity assays—HEK293T cells were co-transfected with 0.5 μg of empty vector or plasmids encoding CRTC2 variants as indicated, along with 0.5 μg luciferase reporter plasmids and 80 ng of Renilla luciferase plasmid pRL-SV40 (Promega) as an internal control in 12 well plates. ..

    Control:

    Article Title: Proline hydroxylation of CREB-regulated transcriptional coactivator 2 controls hepatic glucose metabolism
    Article Snippet: .. Dual luciferase activity assays—HEK293T cells were co-transfected with 0.5 μg of empty vector or plasmids encoding CRTC2 variants as indicated, along with 0.5 μg luciferase reporter plasmids and 80 ng of Renilla luciferase plasmid pRL-SV40 (Promega) as an internal control in 12 well plates. ..

    other:

    Article Title:
    Article Snippet: The plasmids for enhancer activity analysis were generated from pNL1.1 (Promega, N1001) (Supplemental Fig. S9B), and the plasmid served as the internal reference was generated from pGL4.10 (Promega, E6651) by insert a promoter of BmNPV ie-1 before luc2 (Supplemental Fig. S9A), which enables stable expression of the reference luciferase in BmN cells.

    Article Title: Egr-1 promotes the proliferation and migration of vascular smooth muscle cells by transcriptionally activating Egr-2 in arteriovenous fistulas
    Article Snippet: Rat EGR1 promoter (~1.3 Kb; PCR-amplified from rat VSMCs) cloned into pGL3-basic luciferase rep plasmid (Promega Corporation) to form EGR1 luciferase reporters.

    Article Title: Folie 1
    Article Snippet: Vendor Bulk anti-TGFB1,2,3 In Vivo 1D11.1 Human, Mouse, Bovine, Chicken Mouse IgG1 10μg/gBW AB_292143 6 Ichorbio Mouse IgG1 Isotype Control HKSP - Mouse IgG1 10μg/gBW AB_292138 2 Ichorbio Anti-mouse CD8 in vivo YTS169 Mouse Rat IgG2b 12,5μg/g BW AB_292144 5 Ichorbio Anti-mouse CD4 in vivo GK1.5 Mouse Rat IgG2b 12,5μg/g BW AB_292144 4 Ichorbio Rat IgG2b Isotype Control in vivo 1-2 - Rat IgG2b 12,5μg/g BW AB_292137 8 Ichorbio Supplementary Table S3: Primers used for RT-qPCR Target gene Direction Sequence (5’3’) GC [%] Length TM hu-TGF-β1 Fwd ATTCCTGGCGATACCTCAGC 55 20 59,4 hu-TGF-β1 Rev CGGTAGTGAACCCGTTGATG 55 20 59,4 hu-GAPDH Fwd GTCAGTGGTGGACCTGACCT 60 20 61,4 hu-GAPDH Rev TGAGCTTGACAAAGTGGTCG 50 20 57,3 Supplementary Table S4: Expression vectors Name Backbone Insert (cDNA) Selection marker RRID/parentage pMIG pMSCV empty IRES-GFP RRID:Addgene_ 9044 pMIG-CALRWT pMSCV Human CALRWT IRES-GFP Provided by Ann Mullally pMIG-CALRins5 pMSCV Human CALRins5 IRES-GFP Provided by Ann Mullally 9 pMIG-CALRdel52 pMSCV Human CALRdel52 IRES-GFP Provided by Ann Mullally pMSCV-MPL pMSCV Human MPL PKG- hygromycin resistance gene Provided by Ann Mullally pMIG-JAK2WT pMSCV Human JAK2WT IRES-GFP Provided by Justus Duyster pMIG-JAK2V617F pMSCV Human JAK2V617F IRES-GFP Provided by Justus Duyster pMSCV-EpoR pMSCV Human EPOR neomycin resistance gene In-house pMIG-STAT3WT pMX Human STAT3WT IRES-GFP In-house pMIGSTAT3V640F pMX Human STAT3V640F IRES-GFP In-house pGL4.73[ hRluc/SV40] pGL4 SV40 early enhancer, rRluc renilla luciferase Promega (E691A) pGL3-TGFb1 pGL3 Human TGFb1 promoter luciferase RRID:Addgene_ 101762 References: 1.

    Article Title:
    Article Snippet: RIG-I ubiquitination assays Purification of GST-RIG-I 2CARD from mammalian cells was done as previously described (8, 11). pEBGRIG-I 2CARD (4 μg) and pcDNA4 carrying indicated gene or pCAGGS-NS1 (Influenza A virus, 10 μg) (7) and pGL4.45[luc2P/ISRE/Hygro] (Promega) (100 ng) were transfected with Mirus TransIT-LT1 into 5x106 HEK293T cells in a 10 cm2 dish in DMEM high glucose with 5% FBS per manufacturer guidelines.

    Article Title:
    Article Snippet: The constructed pGL3-ELO11 reporter plasmid was cotransfected 211 with the pac-dsxM or pac-dsxF expression plasmid by FuGENE HD Transfection Reagent 212 (Promega) into Sf9 cells.

    Article Title:
    Article Snippet: A total of 24 h after gene KD in 6-well culture plates, 2 μg TOPFlash and 0.5 μg pRL (Promega, E2261) plasmids were transfected into SH-SY5Y cells (7.5×105) using FuGENE HD Transfection Reagent (Promega).

    Article Title:
    Article Snippet: A total of 2 μg of DKK1 promoter and 0.5 μg of pRL (Promega, E2261) plasmids were transfected into SH-SY5Y cells (7.5×105) using FuGENE HD Transfection Reagent (Promega) in a 6-well culture plate.



    Similar Products

    93
    Addgene inc pgl3 basic empty vector
    Pgl3 Basic Empty Vector, supplied by Addgene inc, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/empty+pgl3-basic+vectors/pGL3+Basic+Control+Vector+(Plasmid+%23137707)/pm40373767-543-11-16
    Average 93 stars, based on 1 article reviews
    pgl3 basic empty vector - by Bioz Stars, 2026-09
    93/100 stars
      Buy from Supplier

    90
    Promega pgl3-basic empty vector
    (a) Schematic diagram for constructing wild-type or mutant promoter at the ABCG1 rs57137919G>A polymorphism site. Two constructs were subcloned into <t>pGL3-basic</t> plasmid vectors with firefly luciferase reporter gene. pG, -367G (open bar); pA, -367A (grey bar). Luciferase activity assays for two ABCG1 promoter constructs in HEK293T cells (b), THP-1 cells (c), and HepG2 cells (d) are shown. Luciferase activities were measured with the dual-luciferase reporter assay system and normalized to Renilla luciferase activity 24 hours after transfection in the presence or absence of TO901317. The luciferase activity was a corrected relative value. Data are shown as mean ± SD of four independent experiments in triplicate. P <0.01 vs. pG in HEK293 cells, THP-1 cells, and HepG2 cells under both basal state and LXR agonist stimulation.
    Pgl3 Basic Empty Vector, supplied by Promega, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/empty+pgl3-basic+vectors/pgl3+basic/pmc04074052-69-1-14
    Average 90 stars, based on 1 article reviews
    pgl3-basic empty vector - by Bioz Stars, 2026-09
    90/100 stars
      Buy from Supplier

    90
    Promega empty vectors pgl3-basic
    (a) Schematic diagram for constructing wild-type or mutant promoter at the ABCG1 rs57137919G>A polymorphism site. Two constructs were subcloned into <t>pGL3-basic</t> plasmid vectors with firefly luciferase reporter gene. pG, -367G (open bar); pA, -367A (grey bar). Luciferase activity assays for two ABCG1 promoter constructs in HEK293T cells (b), THP-1 cells (c), and HepG2 cells (d) are shown. Luciferase activities were measured with the dual-luciferase reporter assay system and normalized to Renilla luciferase activity 24 hours after transfection in the presence or absence of TO901317. The luciferase activity was a corrected relative value. Data are shown as mean ± SD of four independent experiments in triplicate. P <0.01 vs. pG in HEK293 cells, THP-1 cells, and HepG2 cells under both basal state and LXR agonist stimulation.
    Empty Vectors Pgl3 Basic, supplied by Promega, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/empty+pgl3-basic+vectors/pgl3+basic/pmc09441333-348-0-10
    Average 90 stars, based on 1 article reviews
    empty vectors pgl3-basic - by Bioz Stars, 2026-09
    90/100 stars
      Buy from Supplier

    90
    Millipore pgl3 empty vector basic
    (a) Schematic diagram for constructing wild-type or mutant promoter at the ABCG1 rs57137919G>A polymorphism site. Two constructs were subcloned into <t>pGL3-basic</t> plasmid vectors with firefly luciferase reporter gene. pG, -367G (open bar); pA, -367A (grey bar). Luciferase activity assays for two ABCG1 promoter constructs in HEK293T cells (b), THP-1 cells (c), and HepG2 cells (d) are shown. Luciferase activities were measured with the dual-luciferase reporter assay system and normalized to Renilla luciferase activity 24 hours after transfection in the presence or absence of TO901317. The luciferase activity was a corrected relative value. Data are shown as mean ± SD of four independent experiments in triplicate. P <0.01 vs. pG in HEK293 cells, THP-1 cells, and HepG2 cells under both basal state and LXR agonist stimulation.
    Pgl3 Empty Vector Basic, supplied by Millipore, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/empty+pgl3-basic+vectors/pgl3+empty+vector+basic/pm32377817-81-14-18
    Average 90 stars, based on 1 article reviews
    pgl3 empty vector basic - by Bioz Stars, 2026-09
    90/100 stars
      Buy from Supplier

    90
    Promega the empty pgl3 basic vector was used as the negative control
    Dual-luciferase reporter assay in the 293T cell line. The <t>pGL3-Basic</t> and pGL3-Promoter vectors were used as negative and positive controls, respectively. The relative luciferase level is displayed for pGL3-Promoter, pGL3-Basic and pGL3-EED The pGL3-EED indicates the recombinant EED fragment ligated to the pGL3-Basic vector. An analysis of variance and Bonferroni's correction were applied for statistical analysis. P<0.05 was considered to indicate a statistically significant difference. *P<0.0001. EED, embryonic ectoderm development; Luc, luciferase.
    The Empty Pgl3 Basic Vector Was Used As The Negative Control, supplied by Promega, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/empty+pgl3-basic+vectors/pgl3+basic/pmc06607394-115-2-17
    Average 90 stars, based on 1 article reviews
    the empty pgl3 basic vector was used as the negative control - by Bioz Stars, 2026-09
    90/100 stars
      Buy from Supplier

    90
    Promega pgl3-basic empty vectors
    Dual-luciferase reporter assay in the 293T cell line. The <t>pGL3-Basic</t> and pGL3-Promoter vectors were used as negative and positive controls, respectively. The relative luciferase level is displayed for pGL3-Promoter, pGL3-Basic and pGL3-EED The pGL3-EED indicates the recombinant EED fragment ligated to the pGL3-Basic vector. An analysis of variance and Bonferroni's correction were applied for statistical analysis. P<0.05 was considered to indicate a statistically significant difference. *P<0.0001. EED, embryonic ectoderm development; Luc, luciferase.
    Pgl3 Basic Empty Vectors, supplied by Promega, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/empty+pgl3-basic+vectors/pgl3+basic/pmc05884815-222-4-2
    Average 90 stars, based on 1 article reviews
    pgl3-basic empty vectors - by Bioz Stars, 2026-09
    90/100 stars
      Buy from Supplier

    90
    Promega the empty pgl3-basic vector was used as negative control
    Dual-luciferase reporter assay in HEK-293T cell line. The <t>pGL3</t> Basic and promoter vectors were used as negative and positive control in this study, respectively. Relative luciferase activity was performed in triplicates.
    The Empty Pgl3 Basic Vector Was Used As Negative Control, supplied by Promega, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/empty+pgl3-basic+vectors/pgl3+basic/pmc05593964-70-2-13
    Average 90 stars, based on 1 article reviews
    the empty pgl3-basic vector was used as negative control - by Bioz Stars, 2026-09
    90/100 stars
      Buy from Supplier

    90
    Promega empty pgl3-basic vectors
    Dual-luciferase reporter assay in HEK-293T cell line. The <t>pGL3</t> Basic and promoter vectors were used as negative and positive control in this study, respectively. Relative luciferase activity was performed in triplicates.
    Empty Pgl3 Basic Vectors, supplied by Promega, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/empty+pgl3-basic+vectors/pgl3+basic/pm27660075-39-12-29
    Average 90 stars, based on 1 article reviews
    empty pgl3-basic vectors - by Bioz Stars, 2026-09
    90/100 stars
      Buy from Supplier

    90
    Promega pgl3-basic (empty pgl3 vector)
    Involvement of A1AR and A2AAR on GDM and insulin effect on hCAT-1 expression. a Western blot for hCAT-1 protein abundance in HUVECs from normal (Normal) or gestational diabetes mellitus (GDM) pregnancies incubated in the absence (−) or presence (+) insulin (1 nM, 8 h) and/or A1 adenosine receptor (A1AR) antagonist (Antag). Lower panel, hCAT-1/β-actin ratio densitometries normalized to 1 in cells from normal pregnancies in the absence of insulin or the antagonist. b hCAT-1 protein abundance as in a for A2AAR antagonist. c hCAT-1 mRNA expression as in a for A1AR antagonist. d hCAT-1 mRNA expression as in b for A2AAR antagonist. e Luciferase (Luc) reporter constructs containing two truncations of SLC7A1 promoter (−1606 and −650 bp from the transcription start point) were transfected in HUVECs from normal or GDM pregnancies, along with Renilla reporter plasmid, and assayed for Firefly and Renilla luciferase activity, respectively. Results depict ratio of Firefly/Renilla luciferase activity. After 36 h of transfection, cells were incubated for further 8 h without (Without insulin) or with (With insulin) insulin (1 nM) in the absence (Control) or presence of A1AR or A2AAR antagonists. Cells were also transfected with the empty <t>pGL3-basic</t> vector or pGL3-control vector (SV40 pGL3) as negative or positive controls, respectively (see “Materials and methods”). In a and c, *P < 0.05 vs. corresponding values in Normal. †P < 0.05 vs. values in the absence of insulin or A1AR antagonist. ‡P < 0.05 vs. all other corresponding values. In b and d, *P < 0.05 vs. corresponding values in Normal. †P < 0.05 vs. all other corresponding values. In e, *P < 0.05 vs. vs. all other values except between themselves in the corresponding promoter constructs. Values are mean ± SEM (n = 38)
    Pgl3 Basic (Empty Pgl3 Vector), supplied by Promega, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/empty+pgl3-basic+vectors/pgl3+basic/pmc04749529-250-23-45
    Average 90 stars, based on 1 article reviews
    pgl3-basic (empty pgl3 vector) - by Bioz Stars, 2026-09
    90/100 stars
      Buy from Supplier

    Image Search Results


    (a) Schematic diagram for constructing wild-type or mutant promoter at the ABCG1 rs57137919G>A polymorphism site. Two constructs were subcloned into pGL3-basic plasmid vectors with firefly luciferase reporter gene. pG, -367G (open bar); pA, -367A (grey bar). Luciferase activity assays for two ABCG1 promoter constructs in HEK293T cells (b), THP-1 cells (c), and HepG2 cells (d) are shown. Luciferase activities were measured with the dual-luciferase reporter assay system and normalized to Renilla luciferase activity 24 hours after transfection in the presence or absence of TO901317. The luciferase activity was a corrected relative value. Data are shown as mean ± SD of four independent experiments in triplicate. P <0.01 vs. pG in HEK293 cells, THP-1 cells, and HepG2 cells under both basal state and LXR agonist stimulation.

    Journal: PLoS ONE

    Article Title: ABCG1 rs57137919G>A Polymorphism Is Functionally Associated with Varying Gene Expression and Apoptosis of Macrophages

    doi: 10.1371/journal.pone.0097044

    Figure Lengend Snippet: (a) Schematic diagram for constructing wild-type or mutant promoter at the ABCG1 rs57137919G>A polymorphism site. Two constructs were subcloned into pGL3-basic plasmid vectors with firefly luciferase reporter gene. pG, -367G (open bar); pA, -367A (grey bar). Luciferase activity assays for two ABCG1 promoter constructs in HEK293T cells (b), THP-1 cells (c), and HepG2 cells (d) are shown. Luciferase activities were measured with the dual-luciferase reporter assay system and normalized to Renilla luciferase activity 24 hours after transfection in the presence or absence of TO901317. The luciferase activity was a corrected relative value. Data are shown as mean ± SD of four independent experiments in triplicate. P <0.01 vs. pG in HEK293 cells, THP-1 cells, and HepG2 cells under both basal state and LXR agonist stimulation.

    Article Snippet: The pGL3-basic empty vector was used as a negative control and the pGL3-control vector (Promega) was used as a positive control for the luciferase assay.

    Techniques: Mutagenesis, Construct, Plasmid Preparation, Luciferase, Activity Assay, Reporter Assay, Transfection

    Dual-luciferase reporter assay in the 293T cell line. The pGL3-Basic and pGL3-Promoter vectors were used as negative and positive controls, respectively. The relative luciferase level is displayed for pGL3-Promoter, pGL3-Basic and pGL3-EED The pGL3-EED indicates the recombinant EED fragment ligated to the pGL3-Basic vector. An analysis of variance and Bonferroni's correction were applied for statistical analysis. P<0.05 was considered to indicate a statistically significant difference. *P<0.0001. EED, embryonic ectoderm development; Luc, luciferase.

    Journal: Oncology Letters

    Article Title: Significant association of EED promoter hypomethylation with colorectal cancer

    doi: 10.3892/ol.2019.10432

    Figure Lengend Snippet: Dual-luciferase reporter assay in the 293T cell line. The pGL3-Basic and pGL3-Promoter vectors were used as negative and positive controls, respectively. The relative luciferase level is displayed for pGL3-Promoter, pGL3-Basic and pGL3-EED The pGL3-EED indicates the recombinant EED fragment ligated to the pGL3-Basic vector. An analysis of variance and Bonferroni's correction were applied for statistical analysis. P<0.05 was considered to indicate a statistically significant difference. *P<0.0001. EED, embryonic ectoderm development; Luc, luciferase.

    Article Snippet: The empty pGL3 basic vector was used as the negative control and the pGL3 promoter vector (both Promega Cooperation, Madison, WI, USA) was used as the positive control, which contained an SV40 promoter upstream of the luciferase gene.

    Techniques: Luciferase, Reporter Assay, Recombinant, Plasmid Preparation

    Dual-luciferase reporter assay in HEK-293T cell line. The pGL3 Basic and promoter vectors were used as negative and positive control in this study, respectively. Relative luciferase activity was performed in triplicates.

    Journal: Scientific Reports

    Article Title: Elevated UMOD methylation level in peripheral blood is associated with gout risk

    doi: 10.1038/s41598-017-11627-w

    Figure Lengend Snippet: Dual-luciferase reporter assay in HEK-293T cell line. The pGL3 Basic and promoter vectors were used as negative and positive control in this study, respectively. Relative luciferase activity was performed in triplicates.

    Article Snippet: The empty pGL3-Basic vector was used as negative control, and the pGL3-Control vector, (Promega, Madison city, WI, USA) containing an SV40 promoter upstream of the luciferase gene was used as positive control.

    Techniques: Luciferase, Reporter Assay, Positive Control, Activity Assay

    Involvement of A1AR and A2AAR on GDM and insulin effect on hCAT-1 expression. a Western blot for hCAT-1 protein abundance in HUVECs from normal (Normal) or gestational diabetes mellitus (GDM) pregnancies incubated in the absence (−) or presence (+) insulin (1 nM, 8 h) and/or A1 adenosine receptor (A1AR) antagonist (Antag). Lower panel, hCAT-1/β-actin ratio densitometries normalized to 1 in cells from normal pregnancies in the absence of insulin or the antagonist. b hCAT-1 protein abundance as in a for A2AAR antagonist. c hCAT-1 mRNA expression as in a for A1AR antagonist. d hCAT-1 mRNA expression as in b for A2AAR antagonist. e Luciferase (Luc) reporter constructs containing two truncations of SLC7A1 promoter (−1606 and −650 bp from the transcription start point) were transfected in HUVECs from normal or GDM pregnancies, along with Renilla reporter plasmid, and assayed for Firefly and Renilla luciferase activity, respectively. Results depict ratio of Firefly/Renilla luciferase activity. After 36 h of transfection, cells were incubated for further 8 h without (Without insulin) or with (With insulin) insulin (1 nM) in the absence (Control) or presence of A1AR or A2AAR antagonists. Cells were also transfected with the empty pGL3-basic vector or pGL3-control vector (SV40 pGL3) as negative or positive controls, respectively (see “Materials and methods”). In a and c, *P < 0.05 vs. corresponding values in Normal. †P < 0.05 vs. values in the absence of insulin or A1AR antagonist. ‡P < 0.05 vs. all other corresponding values. In b and d, *P < 0.05 vs. corresponding values in Normal. †P < 0.05 vs. all other corresponding values. In e, *P < 0.05 vs. vs. all other values except between themselves in the corresponding promoter constructs. Values are mean ± SEM (n = 38)

    Journal: Purinergic Signalling

    Article Title: Insulin requires A 1 adenosine receptors expression to reverse gestational diabetes-increased L-arginine transport in human umbilical vein endothelium

    doi: 10.1007/s11302-015-9491-2

    Figure Lengend Snippet: Involvement of A1AR and A2AAR on GDM and insulin effect on hCAT-1 expression. a Western blot for hCAT-1 protein abundance in HUVECs from normal (Normal) or gestational diabetes mellitus (GDM) pregnancies incubated in the absence (−) or presence (+) insulin (1 nM, 8 h) and/or A1 adenosine receptor (A1AR) antagonist (Antag). Lower panel, hCAT-1/β-actin ratio densitometries normalized to 1 in cells from normal pregnancies in the absence of insulin or the antagonist. b hCAT-1 protein abundance as in a for A2AAR antagonist. c hCAT-1 mRNA expression as in a for A1AR antagonist. d hCAT-1 mRNA expression as in b for A2AAR antagonist. e Luciferase (Luc) reporter constructs containing two truncations of SLC7A1 promoter (−1606 and −650 bp from the transcription start point) were transfected in HUVECs from normal or GDM pregnancies, along with Renilla reporter plasmid, and assayed for Firefly and Renilla luciferase activity, respectively. Results depict ratio of Firefly/Renilla luciferase activity. After 36 h of transfection, cells were incubated for further 8 h without (Without insulin) or with (With insulin) insulin (1 nM) in the absence (Control) or presence of A1AR or A2AAR antagonists. Cells were also transfected with the empty pGL3-basic vector or pGL3-control vector (SV40 pGL3) as negative or positive controls, respectively (see “Materials and methods”). In a and c, *P < 0.05 vs. corresponding values in Normal. †P < 0.05 vs. values in the absence of insulin or A1AR antagonist. ‡P < 0.05 vs. all other corresponding values. In b and d, *P < 0.05 vs. corresponding values in Normal. †P < 0.05 vs. all other corresponding values. In e, *P < 0.05 vs. vs. all other values except between themselves in the corresponding promoter constructs. Values are mean ± SEM (n = 38)

    Article Snippet: Aliquots of cell suspension (0.5 mL, 3.2 × 10 6 cells/mL) were mixed with 10 μg of pGL3–hCAT1 −1606 or pGL3–hCAT1 −650 constructs, pGL3-Basic (empty pGL3 vector), pGL3-Control (Simian Virus 40 promoter (SV40) pGL3 vector), and the internal transfection control vector pRL-TK expressing Renilla luciferase (Promega) [ 6 ].

    Techniques: Expressing, Western Blot, Incubation, Luciferase, Construct, Transfection, Plasmid Preparation, Activity Assay

    GDM and insulin effect on hCAT-1 expression in A1AR and A2AAR knockdown cells. a Western blot for hCAT-1 protein abundance in HUVECs in the absence (−) or presence (+) of insulin (1 nM, 8 h) in non-transfected (−) or transfected (+) cells with siRNA against A1AR (KDA1AR). Lower panel, hCAT-1/β-actin ratio densitometries normalized to 1 in cells transfected with sc-siRNA from normal or GDM pregnancies in the absence of insulin. b Western blot for hCAT-1 protein abundance with siRNA against A2AAR (KDA2AAR) as in A. c hCAT-1 mRNA expression in KDA1AR or KDA2AAR cells as in A. d Luciferase (Luc) reporter construct pGL3-hCAT-1−1606 of SLC7A1 promoter transfected in KDA1AR or KDA2AAR cells, along with Renilla reporter plasmid. After 36 h of transfection, cells were incubated without (−) or with (+) insulin (1 nM, 8 h) (see “Materials and methods”). e Luciferase (Luc) reporter construct SLC7A1 promoter transfected in KDA1AR or KDA2AAR cells as in d. In a, *P < 0.05 vs. all other values except between themselves, †P < 0.05 vs. all other corresponding values in GDM. In b, *P < 0.05 vs. all other values. †P < 0.05 vs. all other values except between themselves. In c–e, *P < 0.05 vs. all other values in Normal except between themselves. †P < 0.05 vs. all other values in GDM except between themselves. ‡P < 0.05 vs. corresponding values in Normal. Values are mean ± SEM (n = 29)

    Journal: Purinergic Signalling

    Article Title: Insulin requires A 1 adenosine receptors expression to reverse gestational diabetes-increased L-arginine transport in human umbilical vein endothelium

    doi: 10.1007/s11302-015-9491-2

    Figure Lengend Snippet: GDM and insulin effect on hCAT-1 expression in A1AR and A2AAR knockdown cells. a Western blot for hCAT-1 protein abundance in HUVECs in the absence (−) or presence (+) of insulin (1 nM, 8 h) in non-transfected (−) or transfected (+) cells with siRNA against A1AR (KDA1AR). Lower panel, hCAT-1/β-actin ratio densitometries normalized to 1 in cells transfected with sc-siRNA from normal or GDM pregnancies in the absence of insulin. b Western blot for hCAT-1 protein abundance with siRNA against A2AAR (KDA2AAR) as in A. c hCAT-1 mRNA expression in KDA1AR or KDA2AAR cells as in A. d Luciferase (Luc) reporter construct pGL3-hCAT-1−1606 of SLC7A1 promoter transfected in KDA1AR or KDA2AAR cells, along with Renilla reporter plasmid. After 36 h of transfection, cells were incubated without (−) or with (+) insulin (1 nM, 8 h) (see “Materials and methods”). e Luciferase (Luc) reporter construct SLC7A1 promoter transfected in KDA1AR or KDA2AAR cells as in d. In a, *P < 0.05 vs. all other values except between themselves, †P < 0.05 vs. all other corresponding values in GDM. In b, *P < 0.05 vs. all other values. †P < 0.05 vs. all other values except between themselves. In c–e, *P < 0.05 vs. all other values in Normal except between themselves. †P < 0.05 vs. all other values in GDM except between themselves. ‡P < 0.05 vs. corresponding values in Normal. Values are mean ± SEM (n = 29)

    Article Snippet: Aliquots of cell suspension (0.5 mL, 3.2 × 10 6 cells/mL) were mixed with 10 μg of pGL3–hCAT1 −1606 or pGL3–hCAT1 −650 constructs, pGL3-Basic (empty pGL3 vector), pGL3-Control (Simian Virus 40 promoter (SV40) pGL3 vector), and the internal transfection control vector pRL-TK expressing Renilla luciferase (Promega) [ 6 ].

    Techniques: Expressing, Western Blot, Transfection, Luciferase, Construct, Plasmid Preparation, Incubation